The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045461	Salmonella enterica subsp. enterica serovar Anatum strain M-3851 chromosome, complete genome	4670959	310372	319454	4670959	integrase,protease	Ralstonia_phage(16.67%)	8	299801:299813	322825:322837
299801:299813	attL	AATAAAAAGATCA	NA	NA	NA	NA
WP_024155556.1|310372_311614_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|312141_312519_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|312680_312878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|313090_315367_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|315397_315718_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|316041_316263_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|316392_318339_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|318335_319454_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
322825:322837	attR	TGATCTTTTTATT	NA	NA	NA	NA
>prophage 2
NZ_CP045461	Salmonella enterica subsp. enterica serovar Anatum strain M-3851 chromosome, complete genome	4670959	1677627	1722405	4670959	tRNA,tail,plate	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|1677627_1678626_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|1678713_1680024_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|1680270_1680786_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|1680885_1681095_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|1681116_1681230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|1681226_1682552_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|1682730_1683339_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|1683447_1683816_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|1683986_1686407_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|1686505_1687378_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|1687391_1687889_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|1688069_1688987_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|1689150_1690509_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|1690597_1691707_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|1692068_1693259_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|1693390_1694935_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|1694949_1695840_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|1696005_1696416_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|1696558_1698655_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|1698654_1699392_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|1699388_1700057_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|1700090_1700333_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|1700776_1702426_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|1702770_1704120_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|1704250_1704598_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|1705173_1705461_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|1705463_1706069_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|1706081_1706396_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|1706555_1707011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|1707007_1707205_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|1707194_1708622_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_110962133.1|1708621_1709146_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	8.1e-68
WP_001003640.1|1709197_1709515_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|1709474_1709603_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|1709699_1712054_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|1712053_1713007_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|1713006_1713216_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|1713203_1714247_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|1714256_1714979_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|1715306_1715669_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|1715665_1716595_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|1716594_1718142_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|1718305_1718665_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|1718655_1719771_+	bacteriophage protein	NA	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|1719763_1720396_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|1720398_1721880_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_001177097.1|1721889_1722405_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
>prophage 3
NZ_CP045461	Salmonella enterica subsp. enterica serovar Anatum strain M-3851 chromosome, complete genome	4670959	3199193	3204997	4670959		Enterobacteria_phage(100.0%)	8	NA	NA
WP_021000674.1|3199193_3201527_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
WP_000743150.1|3201541_3201862_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001604623.1|3201858_3202086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243884.1|3202082_3202634_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_001604627.1|3202630_3202897_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_024155472.1|3203434_3204172_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.0	8.4e-79
WP_000984211.1|3204168_3204414_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|3204430_3204997_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 4
NZ_CP045461	Salmonella enterica subsp. enterica serovar Anatum strain M-3851 chromosome, complete genome	4670959	3236653	3300014	4670959	integrase,head,tRNA,portal,tail,terminase,capsid,holin	Cronobacter_phage(55.26%)	61	3244631:3244646	3274008:3274023
WP_000469807.1|3236653_3237421_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|3237461_3237809_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|3237965_3239186_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212380.1|3239178_3239697_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|3240136_3241207_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225191.1|3241216_3242338_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210990.1|3242395_3243304_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200080.1|3243264_3244425_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|3244524_3244572_-	hypothetical protein	NA	NA	NA	NA	NA
3244631:3244646	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_024132356.1|3244735_3245728_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.2	1.4e-108
WP_000185337.1|3245794_3246100_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	47.5	1.6e-15
WP_000661531.1|3246197_3246536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079960662.1|3246561_3246894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079960661.1|3246903_3247473_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.3	3.4e-43
WP_076009995.1|3247475_3247694_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.7	5.2e-05
WP_079960660.1|3247732_3250390_+	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	47.3	7.9e-244
WP_000088096.1|3250417_3250741_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_023210894.1|3250740_3251760_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.1	1.1e-134
WP_054175274.1|3251756_3253541_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_023375469.1|3253751_3254588_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|3254622_3255651_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|3255662_3256361_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_031602415.1|3256420_3256912_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.3e-48
WP_000080871.1|3256908_3257391_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|3257387_3258092_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|3258088_3259216_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|3259212_3259668_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|3259680_3259977_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|3259973_3260315_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|3260314_3260647_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|3260793_3261051_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|3261238_3263206_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|3263202_3263532_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|3263528_3264713_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_006772868.1|3264705_3265293_+	protein phage	NA	F1BUK5	Cronobacter_phage	81.5	2.4e-89
WP_054175279.1|3265302_3267315_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|3267317_3267848_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267951.1|3267837_3268563_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200789.1|3268534_3269080_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_054175283.1|3269082_3270783_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_000777801.1|3271900_3273373_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_080073196.1|3273508_3273895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|3274052_3274391_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
3274008:3274023	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_000197660.1|3274662_3275400_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|3275531_3276512_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992639.1|3276508_3277240_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235092.1|3277369_3279943_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_023243218.1|3285816_3286272_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_000807818.1|3286375_3287677_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264467.1|3287673_3287997_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|3288039_3289395_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_023243219.1|3289509_3292170_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000183649.1|3292223_3292904_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098732.1|3292976_3293396_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|3293599_3294637_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|3294752_3295442_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|3295760_3296144_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|3296205_3296793_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001521114.1|3296895_3297795_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023244485.1|3297812_3299147_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	2.7e-43
WP_000083347.1|3299276_3300014_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP045461	Salmonella enterica subsp. enterica serovar Anatum strain M-3851 chromosome, complete genome	4670959	3757253	3766424	4670959	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|3757253_3758201_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|3758184_3758916_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|3758896_3759004_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|3759063_3759795_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|3760017_3761703_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|3761699_3762419_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|3762465_3762933_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|3762989_3763520_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|3763691_3764150_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|3764390_3766424_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 6
NZ_CP045461	Salmonella enterica subsp. enterica serovar Anatum strain M-3851 chromosome, complete genome	4670959	3834516	3840813	4670959		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|3834516_3835920_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|3836097_3836991_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|3837367_3838453_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|3838452_3839352_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|3839399_3840278_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|3840282_3840813_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 7
NZ_CP045461	Salmonella enterica subsp. enterica serovar Anatum strain M-3851 chromosome, complete genome	4670959	3951048	3958297	4670959		Morganella_phage(33.33%)	8	NA	NA
WP_023243860.1|3951048_3951468_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|3951470_3952739_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|3953193_3953406_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|3953416_3953605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|3953864_3955058_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|3955706_3956018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|3956097_3956793_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|3956866_3958297_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
NZ_CP045461	Salmonella enterica subsp. enterica serovar Anatum strain M-3851 chromosome, complete genome	4670959	4061565	4069328	4670959	integrase	Enterobacteria_phage(28.57%)	12	4063775:4063797	4075898:4075920
WP_000856224.1|4061565_4061796_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|4061933_4062308_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|4062308_4063184_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|4063200_4063554_+	YebY family protein	NA	NA	NA	NA	NA
4063775:4063797	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|4063925_4065005_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|4065001_4066108_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|4066138_4066369_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|4066422_4066956_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|4067212_4067380_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|4067444_4067633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|4067687_4068179_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|4068731_4069328_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
4075898:4075920	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 1
NZ_CP045462	Salmonella enterica subsp. enterica serovar Anatum strain M-3851 plasmid pM-3851_DHA, complete sequence	90138	15132	51241	90138	integrase,transposase	Salmonella_phage(28.57%)	44	2812:2831	25513:25532
2812:2831	attL	ACTTTCACATGTGAAAGTTT	NA	NA	NA	NA
WP_000543934.1|15132_16143_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|16145_16682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575657.1|16980_17262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|17523_18126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|18141_18594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011872911.1|18760_19060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787563.1|19354_19627_-	MafI family immunity protein	NA	NA	NA	NA	NA
WP_001067855.1|20070_20775_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000936896.1|21290_22718_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000647189.1|22721_23222_-	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
WP_002210541.1|23230_23542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005507681.1|23547_23979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344151.1|24046_24721_-	thymidylate kinase	NA	NA	NA	NA	NA
WP_014342216.1|24707_24827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001125905.1|24969_25347_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
WP_000939033.1|25665_25809_+	hypothetical protein	NA	NA	NA	NA	NA
25513:25532	attR	ACTTTCACATGTGAAAGTTT	NA	NA	NA	NA
WP_000074431.1|25900_26536_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000703827.1|26588_26861_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001207227.1|26909_28091_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_001151304.1|28094_28880_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_014342215.1|28907_29039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338945.1|29053_29365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|29671_30487_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|30547_31351_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|31350_32187_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000844627.1|32492_32735_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|32766_33417_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804063.1|33522_34722_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|34988_35294_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023300759.1|35321_36536_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_021598067.1|36752_37637_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|37667_39161_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|39371_39596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|39592_40330_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|40815_40956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|40961_41666_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001162012.1|42249_42807_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|42809_45782_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_110962188.1|45860_46865_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_042849136.1|47600_47948_+	hypothetical protein	NA	A0A1V0SB21	Catovirus	39.4	2.6e-06
WP_001143450.1|47947_48508_+	trimethoprim-resistant dihydrofolate reductase DfrA23	NA	A0A076FMI9	Aureococcus_anophage	29.0	1.6e-05
WP_001274976.1|48488_48935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000256638.1|48960_49578_+	hypothetical protein	NA	G3BM17	Salmonella_phage	28.3	2.3e-05
WP_000050481.1|49699_51241_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
