The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045509	Salmonella enterica subsp. enterica serovar Anatum strain M-5360 chromosome M-5360, complete sequence	4641638	310336	319418	4641638	protease,integrase	Ralstonia_phage(16.67%)	8	299755:299767	322789:322801
299755:299767	attL	AATAAAAAGATCA	NA	NA	NA	NA
WP_024155556.1|310336_311578_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|312105_312483_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|312644_312842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|313054_315331_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|315361_315682_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|316005_316227_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|316356_318303_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|318299_319418_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
322789:322801	attR	TGATCTTTTTATT	NA	NA	NA	NA
>prophage 2
NZ_CP045509	Salmonella enterica subsp. enterica serovar Anatum strain M-5360 chromosome M-5360, complete sequence	4641638	1677551	1722330	4641638	tRNA,plate,tail	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|1677551_1678550_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|1678637_1679948_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|1680194_1680710_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|1680809_1681019_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|1681040_1681154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|1681150_1682476_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|1682654_1683263_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|1683371_1683740_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|1683910_1686331_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|1686429_1687302_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|1687315_1687813_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|1687993_1688911_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|1689074_1690433_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|1690521_1691631_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|1691992_1693183_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|1693314_1694859_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|1694873_1695764_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|1695929_1696340_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|1696482_1698579_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|1698578_1699316_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|1699312_1699981_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|1700014_1700257_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|1700700_1702350_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|1702694_1704044_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|1704174_1704522_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|1705098_1705386_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|1705388_1705994_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|1706006_1706321_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|1706480_1706936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|1706932_1707130_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|1707119_1708547_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_110962133.1|1708546_1709071_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	8.1e-68
WP_001003640.1|1709122_1709440_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|1709399_1709528_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|1709624_1711979_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|1711978_1712932_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|1712931_1713141_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|1713128_1714172_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|1714181_1714904_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|1715231_1715594_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|1715590_1716520_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|1716519_1718067_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|1718230_1718590_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|1718580_1719696_+	bacteriophage protein	NA	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|1719688_1720321_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|1720323_1721805_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_001177097.1|1721814_1722330_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
>prophage 3
NZ_CP045509	Salmonella enterica subsp. enterica serovar Anatum strain M-5360 chromosome M-5360, complete sequence	4641638	3199246	3205050	4641638		Enterobacteria_phage(100.0%)	8	NA	NA
WP_021000674.1|3199246_3201580_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
WP_000743150.1|3201594_3201915_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001604623.1|3201911_3202139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243884.1|3202135_3202687_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_001604627.1|3202683_3202950_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_024155472.1|3203487_3204225_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.0	8.4e-79
WP_000984211.1|3204221_3204467_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|3204483_3205050_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 4
NZ_CP045509	Salmonella enterica subsp. enterica serovar Anatum strain M-5360 chromosome M-5360, complete sequence	4641638	3727922	3737093	4641638	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|3727922_3728870_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|3728853_3729585_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|3729565_3729673_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|3729732_3730464_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|3730686_3732372_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|3732368_3733088_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|3733134_3733602_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|3733658_3734189_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|3734360_3734819_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|3735059_3737093_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP045509	Salmonella enterica subsp. enterica serovar Anatum strain M-5360 chromosome M-5360, complete sequence	4641638	3805185	3811482	4641638		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|3805185_3806589_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|3806766_3807660_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|3808036_3809122_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|3809121_3810021_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|3810068_3810947_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|3810951_3811482_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 6
NZ_CP045509	Salmonella enterica subsp. enterica serovar Anatum strain M-5360 chromosome M-5360, complete sequence	4641638	3921727	3928976	4641638		Morganella_phage(33.33%)	8	NA	NA
WP_023243860.1|3921727_3922147_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|3922149_3923418_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|3923872_3924085_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|3924095_3924284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|3924543_3925737_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|3926385_3926697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|3926776_3927472_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|3927545_3928976_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP045509	Salmonella enterica subsp. enterica serovar Anatum strain M-5360 chromosome M-5360, complete sequence	4641638	4032244	4040007	4641638	integrase	Enterobacteria_phage(28.57%)	12	4034454:4034476	4046577:4046599
WP_000856224.1|4032244_4032475_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|4032612_4032987_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|4032987_4033863_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|4033879_4034233_+	YebY family protein	NA	NA	NA	NA	NA
4034454:4034476	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|4034604_4035684_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|4035680_4036787_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|4036817_4037048_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|4037101_4037635_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|4037891_4038059_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|4038123_4038312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|4038366_4038858_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|4039410_4040007_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
4046577:4046599	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 1
NZ_CP045510	Salmonella enterica subsp. enterica serovar Anatum strain M-5360 plasmid pM-5360_DHA, complete sequence	90966	15132	52069	90966	integrase,transposase	Salmonella_phage(31.25%)	46	2813:2832	36892:36911
2813:2832	attL	CTTTCACATGTGAAAGTTTG	NA	NA	NA	NA
WP_000543934.1|15132_16143_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|16145_16682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575657.1|16980_17262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|17523_18126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|18141_18594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011872911.1|18760_19060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787563.1|19354_19627_-	MafI family immunity protein	NA	NA	NA	NA	NA
WP_001067855.1|20070_20775_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_165885301.1|20665_23026_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	69.0	3.2e-297
WP_001162012.1|23028_23586_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001067855.1|24169_24874_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|24879_25020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|25505_26243_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|26239_26464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|26674_28168_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_021598067.1|28198_29083_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_023300759.1|29299_30514_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|30541_30847_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000804063.1|31113_32313_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|32418_33069_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|33100_33343_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000480968.1|33648_34485_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|34484_35288_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|35348_36164_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000338945.1|36470_36782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342215.1|36796_36928_-	hypothetical protein	NA	NA	NA	NA	NA
36892:36911	attR	CTTTCACATGTGAAAGTTTG	NA	NA	NA	NA
WP_001151304.1|36955_37741_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_001207227.1|37744_38926_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_000703827.1|38974_39247_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000074431.1|39299_39935_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000939033.1|40026_40170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125905.1|40488_40866_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
WP_014342216.1|41008_41128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344151.1|41114_41789_+	thymidylate kinase	NA	NA	NA	NA	NA
WP_005507681.1|41856_42288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210541.1|42293_42605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000647189.1|42613_43114_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
WP_000936896.1|43117_44545_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|45060_45765_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_165885302.1|45755_46610_+|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	85.0	1.3e-120
WP_110962188.1|46688_47693_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_042849136.1|48428_48776_+	hypothetical protein	NA	A0A1V0SB21	Catovirus	39.4	2.6e-06
WP_001143450.1|48775_49336_+	trimethoprim-resistant dihydrofolate reductase DfrA23	NA	A0A076FMI9	Aureococcus_anophage	29.0	1.6e-05
WP_001274976.1|49316_49763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000256638.1|49788_50406_+	hypothetical protein	NA	G3BM17	Salmonella_phage	28.3	2.3e-05
WP_000050481.1|50527_52069_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
