The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045516	Salmonella enterica subsp. enterica serovar Anatum strain Sal-4737 chromosome Sal-4737, complete sequence	4641555	310441	319523	4641555	protease,integrase	Ralstonia_phage(16.67%)	8	299850:299862	322894:322906
299850:299862	attL	AATAAAAAGATCA	NA	NA	NA	NA
WP_024155556.1|310441_311683_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|312210_312588_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|312749_312947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|313159_315436_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|315466_315787_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|316110_316332_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|316461_318408_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|318404_319523_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
322894:322906	attR	TGATCTTTTTATT	NA	NA	NA	NA
>prophage 2
NZ_CP045516	Salmonella enterica subsp. enterica serovar Anatum strain Sal-4737 chromosome Sal-4737, complete sequence	4641555	1677684	1722461	4641555	tail,plate,tRNA	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|1677684_1678683_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|1678770_1680081_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|1680327_1680843_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|1680942_1681152_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|1681173_1681287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|1681283_1682609_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|1682787_1683396_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|1683504_1683873_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|1684043_1686464_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|1686562_1687435_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|1687448_1687946_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|1688126_1689044_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|1689207_1690566_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|1690654_1691764_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|1692124_1693315_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|1693446_1694991_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|1695005_1695896_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|1696061_1696472_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|1696614_1698711_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|1698710_1699448_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|1699444_1700113_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|1700146_1700389_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|1700832_1702482_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|1702826_1704176_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|1704306_1704654_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|1705229_1705517_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|1705519_1706125_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|1706137_1706452_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|1706611_1707067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|1707063_1707261_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|1707250_1708678_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_110962133.1|1708677_1709202_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	8.1e-68
WP_001003640.1|1709253_1709571_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|1709530_1709659_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|1709755_1712110_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|1712109_1713063_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|1713062_1713272_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|1713259_1714303_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|1714312_1715035_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|1715362_1715725_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|1715721_1716651_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|1716650_1718198_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|1718361_1718721_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|1718711_1719827_+	bacteriophage protein	NA	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|1719819_1720452_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|1720454_1721936_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_001177097.1|1721945_1722461_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
>prophage 3
NZ_CP045516	Salmonella enterica subsp. enterica serovar Anatum strain Sal-4737 chromosome Sal-4737, complete sequence	4641555	3199152	3204956	4641555		Enterobacteria_phage(100.0%)	8	NA	NA
WP_021000674.1|3199152_3201486_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
WP_000743150.1|3201500_3201821_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001604623.1|3201817_3202045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243884.1|3202041_3202593_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_001604627.1|3202589_3202856_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_024155472.1|3203393_3204131_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.0	8.4e-79
WP_000984211.1|3204127_3204373_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|3204389_3204956_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 4
NZ_CP045516	Salmonella enterica subsp. enterica serovar Anatum strain Sal-4737 chromosome Sal-4737, complete sequence	4641555	3727831	3737002	4641555	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|3727831_3728779_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|3728762_3729494_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|3729474_3729582_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|3729641_3730373_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|3730595_3732281_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|3732277_3732997_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|3733043_3733511_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|3733567_3734098_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|3734269_3734728_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|3734968_3737002_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP045516	Salmonella enterica subsp. enterica serovar Anatum strain Sal-4737 chromosome Sal-4737, complete sequence	4641555	3805094	3811391	4641555		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|3805094_3806498_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|3806675_3807569_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|3807945_3809031_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|3809030_3809930_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|3809977_3810856_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|3810860_3811391_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 6
NZ_CP045516	Salmonella enterica subsp. enterica serovar Anatum strain Sal-4737 chromosome Sal-4737, complete sequence	4641555	3921644	3928893	4641555		Morganella_phage(33.33%)	8	NA	NA
WP_023243860.1|3921644_3922064_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|3922066_3923335_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|3923789_3924002_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|3924012_3924201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|3924460_3925654_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|3926302_3926614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|3926693_3927389_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|3927462_3928893_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP045516	Salmonella enterica subsp. enterica serovar Anatum strain Sal-4737 chromosome Sal-4737, complete sequence	4641555	4032161	4039924	4641555	integrase	Enterobacteria_phage(28.57%)	12	4034371:4034393	4046493:4046515
WP_000856224.1|4032161_4032392_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|4032529_4032904_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|4032904_4033780_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|4033796_4034150_+	YebY family protein	NA	NA	NA	NA	NA
4034371:4034393	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|4034521_4035601_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|4035597_4036704_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|4036734_4036965_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|4037018_4037552_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|4037808_4037976_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|4038040_4038229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|4038283_4038775_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|4039327_4039924_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
4046493:4046515	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 1
NZ_CP045517	Salmonella enterica subsp. enterica serovar Anatum strain Sal-4737 plasmid pSal-4737_DHA, complete sequence	86794	15132	47897	86794	transposase,integrase	Salmonella_phage(23.08%)	43	2813:2832	32792:32811
2813:2832	attL	CTTTCACATGTGAAAGTTTG	NA	NA	NA	NA
WP_000543934.1|15132_16143_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|16145_16682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575657.1|16980_17262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|17523_18126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|18141_18594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011872911.1|18760_19060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787563.1|19353_19626_-	MafI family immunity protein	NA	NA	NA	NA	NA
WP_001067855.1|20069_20774_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|20779_20920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|21405_22143_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|22139_22364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|22574_24068_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_021598067.1|24098_24983_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_023300759.1|25199_26414_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|26441_26747_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000804063.1|27013_28213_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|28318_28969_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|29000_29243_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000480968.1|29548_30385_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|30384_31188_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|31248_32064_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000338945.1|32370_32682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342215.1|32696_32828_-	hypothetical protein	NA	NA	NA	NA	NA
32792:32811	attR	CTTTCACATGTGAAAGTTTG	NA	NA	NA	NA
WP_001151304.1|32855_33641_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_001207227.1|33644_34826_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_000703827.1|34874_35147_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000074431.1|35199_35835_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000939033.1|35926_36070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125905.1|36388_36766_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
WP_014342216.1|36908_37028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344151.1|37014_37689_+	thymidylate kinase	NA	NA	NA	NA	NA
WP_005507681.1|37756_38188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210541.1|38193_38505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000647189.1|38513_39014_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
WP_000936896.1|39017_40445_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|40960_41665_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_165884409.1|41655_42438_+|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	83.5	1.1e-105
WP_110962188.1|42516_43521_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_042849136.1|44256_44604_+	hypothetical protein	NA	A0A1V0SB21	Catovirus	39.4	2.6e-06
WP_001143450.1|44603_45164_+	trimethoprim-resistant dihydrofolate reductase DfrA23	NA	A0A076FMI9	Aureococcus_anophage	29.0	1.6e-05
WP_001274976.1|45144_45591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000256638.1|45616_46234_+	hypothetical protein	NA	G3BM17	Salmonella_phage	28.3	2.3e-05
WP_000050481.1|46355_47897_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
