The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049979	Escherichia coli strain IBS28 chromosome, complete genome	4934027	1774241	1836433	4934027	tRNA,transposase,plate,protease	Emiliania_huxleyi_virus(12.5%)	51	NA	NA
WP_001295561.1|1774241_1775594_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240906.1|1775623_1778056_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|1778177_1778663_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139288.1|1778666_1779692_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|1779796_1780252_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|1780255_1781044_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|1781043_1782192_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|1782188_1782785_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|1782821_1786304_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|1786316_1787276_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|1787374_1789516_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|1789572_1789962_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|1790026_1791325_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|1791373_1791634_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|1791620_1791821_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|1791986_1792532_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|1792528_1792951_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|1792964_1793675_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399648.1|1793924_1794905_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001260712.1|1795985_1797704_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|1797815_1798523_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202335.1|1798519_1798924_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|1799041_1799857_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|1799896_1800550_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|1800542_1801574_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140174.1|1801761_1802334_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|1808095_1808899_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648606.1|1808895_1809810_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|1810050_1810851_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211690.1|1810928_1811699_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|1811746_1813105_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|1813176_1813932_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|1813965_1814688_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|1814684_1815152_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|1815216_1815948_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|1816487_1817273_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|1817409_1817889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|1817898_1818813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|1818856_1819339_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087745.1|1819362_1820715_-	membrane protein	NA	NA	NA	NA	NA
WP_122985538.1|1820725_1824160_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240530.1|1824268_1825681_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088859.1|1825685_1826429_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614334.1|1826425_1829185_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	4.7e-82
WP_000343293.1|1829193_1829955_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246416.1|1829959_1831291_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|1831293_1831818_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113703.1|1831814_1833095_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|1833119_1834202_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|1834165_1836016_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|1836019_1836433_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP049979	Escherichia coli strain IBS28 chromosome, complete genome	4934027	2145335	2210993	4934027	capsid,tRNA,integrase,tail,protease,transposase,head,terminase,portal,lysis	Enterobacteria_phage(57.14%)	78	2155497:2155543	2202466:2202512
WP_000912345.1|2145335_2146721_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|2146756_2147278_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|2147385_2147598_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|2147599_2148466_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001315309.1|2148946_2149489_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988375.1|2149708_2150401_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001306954.1|2150431_2153041_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691056.1|2153053_2154061_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250422.1|2154071_2154587_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|2154589_2155222_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
2155497:2155543	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|2155556_2156720_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000488407.1|2156918_2157197_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|2157244_2157463_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001443983.1|2157561_2157843_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|2157853_2158045_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|2158017_2158200_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|2158196_2158877_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|2158873_2159659_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|2159664_2159961_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|2160035_2160179_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198861.1|2160147_2160312_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000213971.1|2160556_2160736_-	Restriction inhibitor protein ral	NA	M1FQU1	Enterobacteria_phage	100.0	6.6e-30
WP_000281856.1|2161002_2161485_+	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000340011.1|2161485_2161809_-	antitermination protein	NA	A4KWR8	Enterobacteria_phage	99.1	1.0e-52
WP_000191544.1|2162243_2163005_-	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	46.3	1.1e-09
WP_001274755.1|2163036_2163750_-	LexA family transcriptional regulator	NA	A4KWS8	Enterobacteria_phage	100.0	2.1e-127
WP_000437875.1|2163850_2164051_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|2164169_2164463_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185505.1|2164495_2165395_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788837.1|2165391_2166093_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	7.1e-128
WP_000145931.1|2166089_2166380_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000736903.1|2166453_2166894_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000153280.1|2166890_2167418_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254223.1|2167414_2167591_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000386643.1|2167593_2167935_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001099522.1|2168141_2168504_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	5.6e-60
WP_000971068.1|2168500_2168641_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204791.1|2168726_2169110_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737266.1|2169299_2170397_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_000839596.1|2170985_2171201_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|2171200_2171698_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|2171914_2172097_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|2172187_2172481_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001415975.1|2172840_2173035_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000453587.1|2173423_2173969_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027283.1|2173943_2175869_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|2175865_2176072_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001369921.1|2176068_2177670_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.9e-309
WP_000123273.1|2177650_2178970_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.6e-232
WP_001369910.1|2178979_2179312_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.1e-54
WP_000063218.1|2179367_2180393_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_000158868.1|2180434_2180830_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000753019.1|2180841_2181195_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975051.1|2181206_2181785_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	3.5e-80
WP_000683105.1|2181781_2182177_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001345558.1|2182184_2182925_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
WP_000479154.1|2182940_2183363_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	9.7e-72
WP_000459458.1|2183344_2183779_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000840258.1|2183771_2186333_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
WP_000847379.1|2186329_2186659_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|2186658_2187357_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|2187362_2188106_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_071532093.1|2188042_2188675_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	1.4e-95
WP_000515725.1|2188735_2192149_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_001233071.1|2192219_2192819_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_000279163.1|2192883_2195844_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_000885616.1|2195843_2196419_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|2196516_2197107_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|2197423_2197657_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2197725_2197839_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|2198204_2198873_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|2198929_2199235_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226378.1|2199418_2200903_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|2201089_2202043_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177469.1|2202555_2203317_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
2202466:2202512	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000662366.1|2204391_2207364_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383965.1|2207350_2209588_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420935.1|2209856_2210993_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP049979	Escherichia coli strain IBS28 chromosome, complete genome	4934027	3225139	3276171	4934027	tail,integrase,protease,terminase,portal,lysis	Enterobacteria_phage(50.0%)	64	3250546:3250562	3280867:3280883
WP_001463415.1|3225139_3225721_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	90.6	1.3e-98
WP_072190873.1|3225720_3228948_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.4e-06
WP_001230352.1|3229012_3229612_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.3e-109
WP_052904173.1|3229678_3233077_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.5	0.0e+00
WP_032198003.1|3233137_3233785_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	2.5e-111
WP_032223304.1|3233682_3234426_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	1.4e-150
WP_032198005.1|3234431_3235130_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.3	1.2e-132
WP_000447253.1|3235139_3235469_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001459760.1|3235468_3238543_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	95.5	0.0e+00
WP_001161009.1|3238514_3238844_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001298500.1|3238852_3239239_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_000211099.1|3239299_3240043_-	hypothetical protein	NA	A0A291AWU6	Escherichia_phage	99.6	3.0e-132
WP_001079398.1|3240054_3240456_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677108.1|3240452_3241031_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001283153.1|3241042_3241318_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097045.1|3241310_3241634_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_077761210.1|3241720_3243748_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.7	0.0e+00
WP_001459763.1|3243725_3245201_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	2.0e-281
WP_001072975.1|3245200_3245413_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_023281932.1|3245409_3247509_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	97.1	0.0e+00
WP_000421825.1|3247517_3248057_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000548593.1|3248607_3248814_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|3249109_3249283_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|3249455_3249611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528545.1|3249758_3249947_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|3249957_3250170_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071774.1|3250533_3251031_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
3250546:3250562	attL	TTTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_029364068.1|3251027_3251561_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	2.6e-98
WP_001013163.1|3251688_3251985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000165360.1|3252009_3252228_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	63.8	1.6e-17
WP_000839587.1|3252232_3252448_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	2.9e-32
WP_024168019.1|3252638_3253352_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592549.1|3253758_3254718_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780584.1|3254910_3255435_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_001204787.1|3255590_3255968_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_032200038.1|3255985_3257035_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	3.3e-113
WP_023147795.1|3257036_3257315_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_000980999.1|3257381_3257633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044862776.1|3257849_3258062_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	77.1	4.6e-22
WP_072132653.1|3258262_3258481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000753057.1|3258924_3259101_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	1.9e-26
WP_001441843.1|3259138_3259276_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	97.8	1.5e-18
WP_032200040.1|3259783_3260206_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	8.2e-63
WP_032200041.1|3260246_3261212_-	phage O protein family	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_000705349.1|3261192_3261714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|3261697_3261925_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|3262002_3262410_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379591.1|3262602_3262755_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_023281935.1|3262766_3263132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328010.1|3263100_3263388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|3263803_3263992_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|3263988_3264180_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_032216168.1|3264273_3266745_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
WP_000005552.1|3266817_3267069_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_052904171.1|3267103_3268384_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	61.8	1.2e-154
WP_001360138.1|3268403_3268514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836057.1|3268571_3269591_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001295394.1|3269602_3270817_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|3271022_3271349_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|3271483_3271825_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|3271859_3272420_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|3272422_3273133_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|3273240_3273546_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041535.1|3273744_3276171_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
3280867:3280883	attR	TTTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 4
NZ_CP049979	Escherichia coli strain IBS28 chromosome, complete genome	4934027	3647866	3699861	4934027	capsid,tail,integrase,head,holin,terminase,portal	Escherichia_phage(58.62%)	68	3669278:3669293	3707919:3707934
WP_001079074.1|3647866_3648397_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_024175323.1|3649859_3650333_-	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	89.2	2.4e-79
WP_001034588.1|3650420_3651692_-	YadA C-terminal domain-containing protein	NA	A0A2L1IV32	Escherichia_phage	56.4	2.4e-97
WP_001371684.1|3652183_3652852_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	88.6	2.6e-111
WP_001367204.1|3652848_3653073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033885107.1|3653082_3654483_-|tail	tail protein	tail	S5MDN9	Escherichia_phage	91.4	2.8e-147
WP_044191898.1|3654626_3654767_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	93.5	8.5e-17
WP_165895615.1|3654965_3658433_-	host specificity protein J	NA	S5MW25	Escherichia_phage	97.9	0.0e+00
WP_165895630.1|3658673_3659306_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.0	2.5e-100
WP_155955609.1|3659251_3659995_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.8	3.1e-150
WP_155955611.1|3660005_3660704_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.4	6.8e-131
WP_155955613.1|3660703_3661033_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	95.4	1.7e-55
WP_155955615.1|3661029_3663591_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	92.0	0.0e+00
WP_071997252.1|3663571_3663985_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	85.9	2.2e-44
WP_033806765.1|3664011_3664443_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	66.0	2.6e-40
WP_016236258.1|3664461_3665208_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	1.9e-123
WP_000683079.1|3665215_3665611_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_044721869.1|3665607_3666183_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.3	9.2e-49
WP_001204533.1|3666198_3666552_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_028985947.1|3666544_3666928_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522632.1|3666979_3668008_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	2.9e-114
WP_021574150.1|3668065_3668413_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	8.9e-23
WP_063106866.1|3668449_3669955_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.5	1.3e-99
3669278:3669293	attL	CTCTGACGGCAACGCT	NA	NA	NA	NA
WP_044860857.1|3669944_3671537_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	2.2e-185
WP_000259002.1|3671533_3671740_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_063087425.1|3671723_3673652_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	2.3e-261
WP_001405844.1|3673623_3674130_-	DNA-packaging protein	NA	O64316	Escherichia_phage	48.5	1.6e-33
WP_000736383.1|3674618_3674843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071830239.1|3674928_3675114_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	6.0e-18
WP_032151794.1|3676240_3676390_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	83.7	2.3e-12
WP_062874540.1|3676389_3676956_-	antirepressor	NA	A0A0N7KZV8	Escherichia_phage	94.7	3.6e-98
WP_033806596.1|3677229_3677763_-	lysozyme	NA	G9L6J6	Escherichia_phage	97.2	1.6e-100
WP_062876850.1|3677799_3678357_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.7	2.3e-49
WP_000284506.1|3678360_3678576_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001385760.1|3678652_3678898_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	100.0	1.9e-19
WP_033815707.1|3678938_3679118_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	98.3	4.9e-25
WP_155955617.1|3679268_3681236_-	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	68.6	8.6e-256
WP_021574136.1|3681496_3681832_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.8e-44
WP_000216624.1|3682133_3682298_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	81.1	7.4e-12
WP_001380362.1|3682294_3682726_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_155955619.1|3683187_3684246_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	99.1	1.4e-207
WP_044809006.1|3684396_3684594_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	5.2e-28
WP_000762902.1|3684819_3685641_-	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000334846.1|3685637_3686012_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	3.8e-35
WP_024210716.1|3686025_3687075_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001379655.1|3687076_3687355_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	3.7e-11
WP_001260977.1|3687490_3687748_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_000220600.1|3687753_3688053_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	99.0	3.9e-51
WP_033814887.1|3688255_3688771_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	1.2e-36
WP_000753060.1|3688767_3688944_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_001224672.1|3688936_3689119_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_044808070.1|3689266_3689572_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	96.0	5.2e-51
WP_062877284.1|3689568_3689850_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	74.7	2.1e-30
WP_062877281.1|3689846_3690644_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.1	5.5e-76
WP_158003628.1|3690677_3691220_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	1.3e-81
WP_062876881.1|3691131_3692169_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.7	5.3e-87
WP_000693925.1|3692237_3692663_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_042969575.1|3692646_3692922_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000824162.1|3693029_3693530_+	helix-turn-helix transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	54.5	1.4e-16
WP_000100895.1|3693547_3693739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014966210.1|3693738_3694029_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_062863539.1|3694296_3694449_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.9e-06
WP_062863541.1|3694460_3694862_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	5.0e-09
WP_000449173.1|3695663_3695852_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_033885206.1|3695848_3696037_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_155955711.1|3696129_3698574_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	1.9e-175
WP_000096347.1|3698632_3698836_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533611.1|3698835_3699861_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.0	1.7e-101
3707919:3707934	attR	CTCTGACGGCAACGCT	NA	NA	NA	NA
>prophage 5
NZ_CP049979	Escherichia coli strain IBS28 chromosome, complete genome	4934027	4479821	4486961	4934027		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|4479821_4482383_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141330.1|4482488_4483145_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|4483195_4483963_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|4484158_4485067_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|4485063_4486326_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|4486322_4486961_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 6
NZ_CP049979	Escherichia coli strain IBS28 chromosome, complete genome	4934027	4708606	4833677	4934027	tRNA,integrase,transposase,protease	Enterobacteria_phage(31.58%)	99	4713992:4714008	4764639:4764655
WP_000701842.1|4708606_4709365_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105566.1|4709570_4710491_-	agmatinase	NA	NA	NA	NA	NA
WP_000758903.1|4710626_4711358_-	membrane protein	NA	NA	NA	NA	NA
WP_001295380.1|4711503_4713480_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|4713488_4713620_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|4713755_4713971_+	hypothetical protein	NA	NA	NA	NA	NA
4713992:4714008	attL	CCCCACAATGGCAGAAA	NA	NA	NA	NA
WP_001062128.1|4714274_4715429_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|4715864_4717259_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|4717335_4717833_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|4717927_4718635_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|4718714_4719446_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|4719458_4720409_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000126441.1|4720445_4721081_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|4721080_4721497_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000399648.1|4721695_4722676_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000997795.1|4723949_4724654_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094824.1|4724671_4725238_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|4725234_4725525_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174743.1|4725532_4726126_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239939.1|4726118_4727255_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745217.1|4727409_4728417_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|4728533_4729580_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|4729755_4730475_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|4730658_4730985_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|4730984_4731704_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001298922.1|4731864_4732917_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|4732944_4733220_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|4733284_4734364_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|4734565_4735822_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839812.1|4735871_4738007_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234514.1|4738404_4739112_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218780.1|4739490_4740756_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	7.6e-80
WP_000147021.1|4741011_4742055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165895617.1|4742413_4743313_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000719910.1|4744075_4744822_-	porin family protein	NA	NA	NA	NA	NA
WP_001380856.1|4745611_4746655_+	subtilase AB5 cytotoxin subunit A	NA	NA	NA	NA	NA
WP_024166125.1|4746671_4747094_+	subtilase AB5 cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	44.3	3.6e-26
WP_000323314.1|4747475_4747799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000264907.1|4747832_4748024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155955693.1|4748885_4752977_-|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.5	3.3e-310
WP_000634445.1|4753890_4754628_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001228923.1|4756775_4757912_+	porin	NA	Q1MVN1	Enterobacteria_phage	56.3	1.4e-117
WP_063123034.1|4758006_4759704_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_001032734.1|4759772_4760030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072193376.1|4760204_4760378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071777450.1|4760874_4761066_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_063123033.1|4761207_4762227_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_165895618.1|4763001_4763172_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_063123675.1|4763337_4765308_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
4764639:4764655	attR	CCCCACAATGGCAGAAA	NA	NA	NA	NA
WP_000977393.1|4765326_4766118_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_063123032.1|4766707_4767337_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.2	3.3e-52
WP_063123035.1|4767518_4769264_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_063123031.1|4769492_4770713_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	34.9	9.7e-64
WP_042968614.1|4770838_4771735_-	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_001237806.1|4771830_4772019_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_001210963.1|4772093_4772609_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063123674.1|4772732_4773194_-	LuxR family transcriptional regulator	NA	Q9LA52	Enterobacteria_phage	46.6	1.2e-27
WP_000935977.1|4773271_4773478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001380143.1|4773558_4773702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063123029.1|4773810_4775007_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_042968617.1|4775056_4776322_-	hemagglutinin	NA	Q9MCI8	Enterobacteria_phage	62.5	1.1e-41
WP_086217135.1|4778703_4781001_-	RTX toxin	NA	NA	NA	NA	NA
WP_001368290.1|4785846_4787094_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_165895619.1|4787153_4789301_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	27.4	7.7e-24
WP_165895620.1|4789305_4790574_-	TolC family protein	NA	NA	NA	NA	NA
WP_000560119.1|4790851_4791052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063123016.1|4792231_4793005_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_063123015.1|4793029_4797361_-	hemagglutinin	NA	NA	NA	NA	NA
WP_063123014.1|4798035_4800084_-	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	8.5e-12
WP_000436083.1|4802155_4802581_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	78.4	1.7e-36
WP_000624720.1|4802577_4802928_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	6.2e-40
WP_165895621.1|4802958_4804572_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	5.2e-182
WP_040062126.1|4804703_4804895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063123023.1|4805008_4806040_-	F17G fimbrial adhesin	NA	NA	NA	NA	NA
WP_063123022.1|4806041_4808510_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_021520533.1|4808593_4809316_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_063123021.1|4809383_4809929_-	F17A fimbrial adhesin	NA	NA	NA	NA	NA
WP_063123020.1|4811806_4812319_-	M agglutinin-type afimbrial adhesin BmaE/AfaE-8	NA	NA	NA	NA	NA
WP_000723766.1|4812853_4813273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063123019.1|4813288_4815838_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_097449508.1|4816098_4816851_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_062895748.1|4817309_4817747_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_165895622.1|4817762_4818050_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_063123039.1|4818882_4820496_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	63.2	6.6e-161
WP_000624710.1|4820526_4820877_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	3.6e-40
WP_000422689.1|4820873_4821293_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	94.8	4.8e-47
WP_101898365.1|4821487_4822638_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.1	2.0e-50
WP_000334881.1|4822778_4823051_-	hydrogenase 3 maturation protein HypC	NA	NA	NA	NA	NA
WP_165895623.1|4823041_4823914_-	hydrogenase nickel incorporation protein HypB	NA	NA	NA	NA	NA
WP_001544467.1|4824413_4824596_+	rubredoxin	NA	NA	NA	NA	NA
WP_155955734.1|4824599_4825472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000572543.1|4825519_4825834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001380823.1|4825855_4826041_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063123041.1|4826093_4826588_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001380821.1|4827087_4828062_-	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_001544462.1|4828051_4828630_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_061350410.1|4830156_4830681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001380818.1|4831509_4831737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165895624.1|4832464_4833677_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	3.8e-169
