The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050009	Citrobacter sp. Y3 chromosome, complete genome	5246113	580713	588392	5246113		Thermobifida_phage(16.67%)	10	NA	NA
WP_012908509.1|580713_581568_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_042325036.1|581601_582093_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003025078.1|582208_582496_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	4.2e-10
WP_109739797.1|582518_583952_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_044263650.1|583999_584725_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.9e-22
WP_042325045.1|584731_585286_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_044255950.1|585254_585830_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_109739798.1|585826_586393_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.5	5.0e-55
WP_042998302.1|586413_587400_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	5.1e-39
WP_042998301.1|587414_588392_-	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	22.0	5.6e-06
>prophage 2
NZ_CP050009	Citrobacter sp. Y3 chromosome, complete genome	5246113	1278035	1285975	5246113	transposase,integrase	Enterobacteria_phage(33.33%)	6	1268187:1268201	1288949:1288963
1268187:1268201	attL	GCTGCATATTGGCAT	NA	NA	NA	NA
WP_109739896.1|1278035_1279088_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	1.0e-117
WP_110129298.1|1279231_1280460_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.4	1.3e-145
WP_110129298.1|1280582_1281810_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.4	1.3e-145
WP_042997817.1|1282047_1283151_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	1.5e-60
WP_054177340.1|1283162_1284416_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.0e-97
WP_023303126.1|1284769_1285975_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.4	1.9e-128
1288949:1288963	attR	GCTGCATATTGGCAT	NA	NA	NA	NA
>prophage 3
NZ_CP050009	Citrobacter sp. Y3 chromosome, complete genome	5246113	2018902	2074782	5246113	protease,tail,holin,terminase,integrase	uncultured_Caudovirales_phage(24.24%)	63	2034123:2034182	2069727:2069793
WP_043001160.1|2018902_2020663_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_043001159.1|2020848_2021301_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_043001975.1|2021377_2022433_-	porin OmpA	NA	NA	NA	NA	NA
WP_043001158.1|2022788_2023298_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_043001157.1|2023515_2024145_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_109740139.1|2024098_2026261_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_043001155.1|2026267_2026726_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_109740140.1|2026849_2028904_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	8.5e-20
WP_044256300.1|2028935_2029394_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_043001152.1|2029486_2030149_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_044256299.1|2030321_2030735_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_042319966.1|2030803_2031121_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_109740141.1|2031178_2032369_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_043001149.1|2032463_2032745_+	acylphosphatase	NA	NA	NA	NA	NA
WP_043001148.1|2032741_2033071_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_012905355.1|2033160_2033820_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	4.4e-47
2034123:2034182	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
WP_150547168.1|2034287_2035307_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.7	1.7e-93
WP_166444209.1|2035307_2035532_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_044265724.1|2035744_2035927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150547075.1|2035929_2036484_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.0	1.6e-50
WP_150547076.1|2036483_2038754_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.4	9.5e-97
WP_150547077.1|2038800_2039124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150547078.1|2039622_2040024_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	55.6	3.9e-38
WP_150547079.1|2040102_2040306_+	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	45.9	2.3e-07
WP_150547081.1|2040370_2040817_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.1	8.5e-26
WP_150547082.1|2040839_2041064_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	64.9	2.4e-21
WP_164566085.1|2041066_2042050_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	78.6	1.4e-44
WP_150547083.1|2042046_2043435_+	replicative DNA helicase	NA	Q8HA30	Enterobacteria_phage	46.6	3.1e-106
WP_150547084.1|2043474_2044155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150547085.1|2044158_2044407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150547086.1|2044399_2045002_+	adenine methylase	NA	G9L699	Escherichia_phage	85.4	1.9e-97
WP_150547087.1|2044998_2045259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150547088.1|2045255_2047232_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.4	6.1e-201
WP_150547089.1|2047231_2047570_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	87.5	1.4e-49
WP_150547091.1|2048017_2048614_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	8.6e-82
WP_110494402.1|2048625_2048928_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	57.9	2.1e-28
WP_110494401.1|2049083_2049380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150547092.1|2049410_2049833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043002016.1|2049874_2050123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150547093.1|2050126_2051749_+|tail	phage tail protein	tail	A0A2H4J3N6	uncultured_Caudovirales_phage	57.7	3.0e-169
WP_150547094.1|2051745_2051979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150547095.1|2051965_2052790_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	41.1	1.2e-41
WP_164566086.1|2052823_2052994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150547096.1|2053207_2054119_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	37.9	2.7e-42
WP_102602534.1|2054176_2054740_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	50.3	1.2e-48
WP_150547097.1|2054741_2056730_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	46.6	1.7e-171
WP_150547098.1|2056732_2057179_+	GNAT family N-acetyltransferase	NA	A0A2K9VAY9	Citrobacter_phage	37.5	4.0e-15
WP_102602531.1|2057178_2057622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150547099.1|2057621_2060330_+	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	67.4	0.0e+00
WP_150547100.1|2060329_2063221_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	76.6	0.0e+00
WP_150547101.1|2063217_2063631_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	37.0	2.5e-08
WP_150547102.1|2063764_2064106_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	52.7	7.4e-22
WP_150547103.1|2064102_2065713_+|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	70.5	1.9e-224
WP_164566087.1|2066630_2068286_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_150547105.1|2068393_2068621_+|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	69.6	2.5e-18
WP_150547106.1|2068601_2069132_+	glycoside hydrolase family protein	NA	H6WRZ4	Salmonella_phage	86.0	2.7e-87
WP_150547107.1|2069128_2069503_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	48.7	6.7e-16
WP_109740142.1|2070387_2071134_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.6	6.0e-08
2069727:2069793	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAGATTAAA	NA	NA	NA	NA
WP_109740143.1|2071204_2071894_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	30.2	6.3e-12
WP_044258129.1|2072278_2072548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043001087.1|2073289_2073736_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_109740144.1|2073745_2074249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044264009.1|2074389_2074782_+	YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	38.2	1.2e-07
>prophage 4
NZ_CP050009	Citrobacter sp. Y3 chromosome, complete genome	5246113	2826810	2944106	5246113	transposase,tRNA,protease,integrase	Escherichia_phage(34.48%)	112	2859892:2859951	2916147:2916967
WP_043000471.1|2826810_2827395_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_043000470.1|2827511_2828603_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_166444214.1|2828699_2830373_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.8	9.0e-12
WP_043000464.1|2831259_2831739_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_109740302.1|2831803_2834959_-	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_044257676.1|2834983_2836159_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_043001911.1|2836495_2836849_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043000461.1|2837054_2838035_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_109740303.1|2838113_2839124_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_109740304.1|2839511_2839823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043000457.1|2840422_2841139_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_109740634.1|2841375_2843280_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_043000454.1|2843520_2844591_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_043000453.1|2844601_2845234_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_109740306.1|2845244_2846678_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_109740307.1|2846780_2848487_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_109740635.1|2848540_2850652_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_043000449.1|2850774_2851029_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_043000448.1|2851232_2851967_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_109740308.1|2851967_2852579_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_043000447.1|2852717_2853632_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_043000446.1|2853729_2855466_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_166444215.1|2855575_2856646_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_044257663.1|2856658_2857957_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_043000443.1|2858285_2859818_+	SpoVR family protein	NA	NA	NA	NA	NA
2859892:2859951	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|2859943_2860648_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001000602.1|2862487_2863639_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.7	6.7e-99
WP_023312637.1|2865377_2866082_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	5.3e-139
WP_059401174.1|2866556_2867279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166444216.1|2867391_2870157_+	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	23.3	1.1e-41
WP_059401176.1|2870167_2870884_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	44.0	7.0e-14
WP_028839766.1|2870895_2871510_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	51.3	2.3e-37
WP_133611388.1|2871570_2872788_-	TniQ family protein	NA	NA	NA	NA	NA
WP_013124601.1|2872784_2873693_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_133611387.1|2873695_2875372_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000993245.1|2875532_2875745_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|2875707_2875827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|2875810_2876047_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277463.1|2876043_2876409_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000281123.1|2876426_2878109_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
WP_000522993.1|2878147_2878555_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732276.1|2878582_2878858_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_166444217.1|2878873_2879224_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|2879295_2879751_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001247892.1|2880115_2880406_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|2880402_2880804_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_166444218.1|2880793_2881150_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000091613.1|2881404_2881719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067848.1|2882033_2882738_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_032432075.1|2883054_2883489_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_028016388.1|2883841_2884810_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077268341.1|2884819_2884996_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	48.1	5.3e-08
WP_012540942.1|2885196_2886168_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	2.5e-75
WP_007372134.1|2886415_2886820_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
WP_000612626.1|2886816_2887164_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_063938205.1|2887212_2888751_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.5	3.9e-280
WP_004026583.1|2889446_2890487_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_032437796.1|2890579_2891218_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026586.1|2891218_2891860_-	TerD family protein	NA	NA	NA	NA	NA
WP_004210261.1|2891884_2892523_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026591.1|2893002_2893461_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_004210256.1|2893463_2894687_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_032437797.1|2894697_2895654_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_064794358.1|2895653_2896733_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	2.3e-40
WP_004181732.1|2896734_2897508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023287198.1|2897500_2898643_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.2	6.3e-33
WP_064794357.1|2898654_2899713_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
WP_012540223.1|2900023_2900608_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.4	2.0e-11
WP_025368659.1|2900604_2901756_+	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004026604.1|2901778_2902234_+	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_012540178.1|2902257_2903298_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.1e-71
WP_004026609.1|2903336_2903915_+	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026611.1|2904001_2904577_+	tellurium resistance cAMP binding protein TerE	NA	NA	NA	NA	NA
WP_014386551.1|2904661_2905903_+	protein TerF	NA	NA	NA	NA	NA
WP_004026615.1|2906239_2906887_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_119906220.1|2907114_2907444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120332.1|2907471_2907861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120333.1|2907926_2908685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043016708.1|2908917_2909649_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_004181720.1|2909908_2910511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|2910734_2911439_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_038988891.1|2912405_2912852_+	DMT family transporter	NA	NA	NA	NA	NA
WP_038988888.1|2913246_2913594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166444219.1|2913818_2915459_-	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_001067855.1|2915449_2916154_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011784757.1|2916322_2917810_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
2916147:2916967	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCATGAAAACTGTCTCGTTTAACTCTAGATGATGAAAACGTAACACCAGGATGAGACGAAAACAACCCAAATGAGACAGAAAAACTGTCTCACCGGATTGACTGCTTTGGGTTTAGTCTTAACTGACACCACCTCCCAGGGCCTGATATAAAGCAACACTATCGACTAGGCGTTGTGCCTGGACCGCAACCATATTGATCCGGATTGACTGTGCCTGTTGCTGCGCGATGAGCAGTTGCAGGTAGCTGGCCGCGCCCAGCCGGTATTGCCGCTCGACCGACTGCAAGGAGGCCTGTGCAGCCATATCAGCGGCAGCGAGGGCAGTCAAAGTTTGTGCATCGCTTTCCACCGCGCGCAGGGTGTCGGCGACGTTACGCAAAGACTCCAATACGACGCTCTGGTAATTGGCTACGGCGGCATCAAAAGCGGCGAGCGCCGCTCTTTTTTCAGCGGGTAGCCCTGGATTAAAAAGAGGCTGGGTGAGCTGCGCAACCAGGCCCCACACTGCCGAGCCACCACCGAACAGGGCACCGGTGGTCAGCGCCTGAGAACCAAGGTTGGCGCTCAGGTTGATCTGTGGGTAGAGCTTGGCGACAGCCACACCATAGTCTGCATTGGCCGCATGCAACAGCGCCTCTGACGCCTGGATATCCGGTCGGCGGCGCACCAGTTCTGAGGGCACGACGAGCGGCATCTCGACGGGTAGAGTGAAATCGGCCAGAGTGAAGGCCGGGATGCCACCCGTGCCTGGGGCACGACCGGC	NA	NA	NA	NA
WP_016236502.1|2917796_2918270_-	cytochrome c	NA	NA	NA	NA	NA
WP_004393997.1|2918298_2919009_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.7e-31
WP_000624215.1|2919010_2920216_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016236501.1|2920212_2921364_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004393990.1|2921360_2921969_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000427614.1|2922156_2923161_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001137910.1|2923620_2923941_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_000626969.1|2923915_2924377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241611.1|2924537_2924975_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_000043177.1|2925089_2925566_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	31.7	4.1e-18
WP_000928911.1|2925870_2926221_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000706606.1|2926382_2928041_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001243598.1|2928286_2928751_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_001567981.1|2929030_2930011_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_112974666.1|2930055_2930379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044351353.1|2930375_2931317_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_024223630.1|2931739_2932906_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_166444220.1|2933392_2934289_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	4.3e-170
WP_001067848.1|2934347_2935052_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_009651828.1|2936773_2937145_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007372378.1|2937164_2937977_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_009651826.1|2938091_2938733_-	recombinase family protein	NA	NA	NA	NA	NA
WP_005012528.1|2938983_2940198_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072250409.1|2940231_2941635_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	3.4e-105
WP_032736818.1|2942152_2943175_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|2943401_2944106_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 5
NZ_CP050009	Citrobacter sp. Y3 chromosome, complete genome	5246113	3327944	3336183	5246113		Enterobacteria_phage(42.86%)	8	NA	NA
WP_109740369.1|3327944_3328553_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	29.9	2.9e-08
WP_157959981.1|3328549_3329737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157959988.1|3329853_3330411_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.7	5.1e-52
WP_109740372.1|3330413_3331292_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.2	9.3e-109
WP_109740373.1|3331343_3332243_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_109740374.1|3332242_3333328_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	5.7e-100
WP_044266075.1|3333708_3334602_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.4	1.3e-46
WP_109740375.1|3334779_3336183_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.9	1.8e-21
>prophage 6
NZ_CP050009	Citrobacter sp. Y3 chromosome, complete genome	5246113	3393402	3401825	5246113	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_043000155.1|3393402_3395436_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.7	3.0e-54
WP_043000154.1|3395639_3396098_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	66.7	1.1e-49
WP_043001885.1|3396142_3396613_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.8	3.1e-63
WP_043000153.1|3396659_3397379_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_043000152.1|3397371_3399060_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.5	2.4e-278
WP_043000151.1|3399283_3400015_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	89.9	8.3e-103
WP_042318015.1|3400074_3400182_+	protein YohO	NA	NA	NA	NA	NA
WP_109740397.1|3400162_3400894_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_109740398.1|3400877_3401825_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.8	1.2e-21
>prophage 7
NZ_CP050009	Citrobacter sp. Y3 chromosome, complete genome	5246113	3605934	3693948	5246113	protease,capsid,tail,transposase,tRNA,holin,portal,terminase,head,integrase	Enterobacteria_phage(33.33%)	103	3650279:3650297	3694144:3694162
WP_042999993.1|3605934_3606747_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_042999992.1|3606746_3607760_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_044258488.1|3607826_3608963_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.9	1.2e-18
WP_043001872.1|3609066_3610068_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_109740432.1|3610064_3611243_-	MFS transporter	NA	NA	NA	NA	NA
WP_042999989.1|3611989_3612520_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_044258478.1|3612560_3613778_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_109740433.1|3613936_3615937_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_110129298.1|3616077_3617305_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.4	1.3e-145
WP_157959980.1|3617429_3619868_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_042999985.1|3620092_3620452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042999984.1|3620492_3621020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109740435.1|3621361_3622018_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_109740436.1|3622083_3623811_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_109740437.1|3623851_3624538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044258470.1|3624746_3625259_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_109740438.1|3625260_3625695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042999978.1|3625743_3626238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166444232.1|3626437_3626779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042999976.1|3626868_3627231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109740439.1|3627365_3628646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157959979.1|3628639_3629341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109740441.1|3629498_3630458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042999974.1|3630408_3631698_-	CpaF family protein	NA	NA	NA	NA	NA
WP_109740442.1|3631758_3632904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166444233.1|3632919_3634098_-	tight adherence secretin RcpA	NA	NA	NA	NA	NA
WP_166444234.1|3634152_3634335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061069817.1|3634382_3635327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082366160.1|3635664_3635907_-	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_042999969.1|3636344_3636629_-	YfcL family protein	NA	NA	NA	NA	NA
WP_044258458.1|3636660_3637209_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_042999967.1|3637208_3638018_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_109740444.1|3638017_3638842_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_054175943.1|3638845_3639931_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	7.0e-90
WP_042999964.1|3639957_3640890_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_042999963.1|3641058_3641610_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_042999962.1|3641827_3642313_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_109740445.1|3642505_3644665_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_099434018.1|3644664_3645975_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_042317736.1|3646155_3646440_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_042999959.1|3646813_3648154_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_044258452.1|3648215_3648971_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_044258449.1|3649261_3650203_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	90.2	4.3e-152
3650279:3650297	attL	GTCCCCTTAGTTAAATGGA	NA	NA	NA	NA
WP_150546937.1|3650535_3651306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150546936.1|3651295_3651712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166444235.1|3651854_3652244_-	LexA family transcriptional regulator	NA	K7P6F7	Enterobacteria_phage	62.5	6.9e-40
WP_125340022.1|3652322_3652562_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	84.8	2.1e-31
WP_166444308.1|3652839_3653478_-|tail	tail fiber domain-containing protein	tail	A0A0A7RT02	Enterobacteria_phage	42.2	4.2e-34
WP_150546934.1|3654147_3655104_-	hypothetical protein	NA	I6S634	Salmonella_phage	61.9	6.1e-106
WP_166444236.1|3655111_3657823_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	84.1	0.0e+00
WP_044257088.1|3657822_3658221_-	hypothetical protein	NA	S4TR39	Salmonella_phage	81.8	2.1e-60
WP_044257086.1|3658227_3658812_-	hypothetical protein	NA	S4TND4	Salmonella_phage	89.2	8.3e-98
WP_150546931.1|3658811_3659405_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	87.3	7.4e-102
WP_166444237.1|3659567_3659750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949497.1|3659810_3660957_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_094487604.1|3662909_3664117_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
WP_104446312.1|3665265_3665553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150546929.1|3665907_3666288_-|tail	phage tail protein	tail	K7PJU9	Enterobacteria_phage	75.8	4.5e-44
WP_109740729.1|3666340_3666838_-|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	72.5	2.5e-63
WP_150546928.1|3666896_3667262_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	71.1	8.4e-48
WP_150546997.1|3667258_3667798_-	HK97 gp10 family phage protein	NA	K7PM60	Enterobacteria_phage	93.3	1.6e-87
WP_150546927.1|3667790_3668123_-|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	94.5	5.0e-55
WP_150546926.1|3668124_3668337_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	61.6	1.6e-11
WP_150546925.1|3668400_3668727_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	87.0	6.1e-50
WP_150546924.1|3668726_3668915_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	54.5	3.9e-09
WP_150546923.1|3668956_3670174_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	86.6	5.3e-195
WP_150546922.1|3670183_3671032_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	83.2	4.7e-126
WP_150546921.1|3671070_3672348_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	84.0	4.8e-207
WP_150546920.1|3672347_3674090_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.7	1.6e-136
WP_150546919.1|3674043_3674508_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	60.8	2.4e-47
WP_125340034.1|3674628_3674970_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.0	5.1e-47
WP_125340035.1|3674979_3675216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125340036.1|3675273_3675651_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	61.4	3.4e-36
WP_125340037.1|3675695_3676265_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	67.7	5.0e-55
WP_150546918.1|3676261_3676744_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	72.0	6.3e-67
WP_044266859.1|3676757_3677105_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	72.9	2.8e-40
WP_150546996.1|3677293_3678175_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	66.1	3.6e-36
WP_150546917.1|3678445_3678850_-	antitermination protein	NA	A0A088CD47	Shigella_phage	68.0	3.9e-46
WP_150546916.1|3678842_3679484_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	67.5	1.4e-82
WP_150546915.1|3679480_3680125_-	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	60.0	5.3e-45
WP_150546914.1|3680094_3681066_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	61.7	7.1e-110
WP_150546913.1|3681062_3682592_-	DEAD/DEAH box helicase family protein	NA	A0A286N2P9	Klebsiella_phage	66.7	1.9e-202
WP_125338901.1|3682584_3682860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125338903.1|3683020_3683299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150546912.1|3683334_3683805_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	76.3	5.0e-61
WP_125338907.1|3683821_3684277_-	hypothetical protein	NA	K7PKM9	Enterobacterial_phage	51.3	1.9e-36
WP_109740703.1|3684355_3684550_-	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	75.8	3.3e-19
WP_125338909.1|3684657_3685368_+	LexA family transcriptional regulator	NA	K7P8B2	Enterobacteria_phage	66.8	2.3e-86
WP_150546911.1|3685464_3685689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150546910.1|3685796_3686072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150546909.1|3686716_3686908_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_164566080.1|3687080_3687233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150546908.1|3687245_3687605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150546907.1|3687647_3688460_+	DUF2303 family protein	NA	NA	NA	NA	NA
WP_166444238.1|3688535_3689345_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	55.5	1.2e-73
WP_109740697.1|3689341_3689467_+	sodium:solute symporter	NA	NA	NA	NA	NA
WP_096846328.1|3689463_3689688_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	48.6	3.9e-11
WP_046401719.1|3689684_3689954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164566084.1|3691009_3691183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150547055.1|3691186_3691702_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	40.4	1.9e-13
WP_150547056.1|3692031_3692589_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	67.9	3.7e-71
WP_150547057.1|3692609_3692795_+	DNA-binding protein	NA	A0A2R2Z2X2	Escherichia_phage	61.4	8.1e-15
WP_150547058.1|3692778_3693948_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	83.3	1.0e-195
3694144:3694162	attR	GTCCCCTTAGTTAAATGGA	NA	NA	NA	NA
>prophage 8
NZ_CP050009	Citrobacter sp. Y3 chromosome, complete genome	5246113	3907507	3972958	5246113	protease,capsid,tail,transposase,tRNA,holin,portal,terminase,head,integrase	Salmonella_phage(33.87%)	86	3895901:3895917	3970540:3970556
3895901:3895917	attL	TTGTTCCGGCGTCAGTG	NA	NA	NA	NA
WP_072011051.1|3907507_3908026_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	30.4	5.6e-05
WP_042999789.1|3908069_3908705_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_042999788.1|3908708_3910073_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_109740524.1|3910075_3910978_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_042999786.1|3911094_3911943_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042999785.1|3911998_3912259_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.7e-18
WP_042999784.1|3912255_3912636_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_042999783.1|3912635_3913367_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_043001853.1|3913383_3914094_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_042999782.1|3914123_3915029_-	GTPase Era	NA	NA	NA	NA	NA
WP_042291512.1|3915025_3915706_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.7	7.4e-21
WP_042999781.1|3915979_3916954_-	signal peptidase I	NA	NA	NA	NA	NA
WP_042999780.1|3916970_3918770_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.3	5.0e-24
WP_152402863.1|3918924_3919314_-	LexA family transcriptional regulator	NA	K7P6F7	Enterobacteria_phage	64.1	3.7e-41
WP_125340022.1|3919392_3919632_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	84.8	2.1e-31
WP_166444308.1|3919909_3920548_-|tail	tail fiber domain-containing protein	tail	A0A0A7RT02	Enterobacteria_phage	42.2	4.2e-34
WP_110129298.1|3921558_3922787_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.4	1.3e-145
WP_166444243.1|3922862_3923510_-	hypothetical protein	NA	I6S634	Salmonella_phage	60.9	3.3e-63
WP_166444236.1|3923517_3926229_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	84.1	0.0e+00
WP_044257088.1|3926228_3926627_-	hypothetical protein	NA	S4TR39	Salmonella_phage	81.8	2.1e-60
WP_166444244.1|3926633_3927218_-	hypothetical protein	NA	S4TND4	Salmonella_phage	88.7	1.9e-97
WP_125368498.1|3927217_3927811_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	87.8	5.7e-102
WP_166444245.1|3927969_3928257_+	hypothetical protein	NA	I6S632	Salmonella_phage	72.6	9.3e-34
WP_166444309.1|3928261_3928492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166444246.1|3928551_3931881_-|tail	phage tail tape measure protein	tail	S4TTF9	Salmonella_phage	69.7	0.0e+00
WP_044257077.1|3931939_3932353_-	lipoprotein	NA	G8C7Q7	Escherichia_phage	49.6	5.4e-35
WP_044257075.1|3932407_3932686_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	88.0	7.8e-38
WP_166444247.1|3932709_3933081_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	77.2	9.8e-52
WP_166444248.1|3933112_3933817_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	73.1	2.4e-91
WP_166444249.1|3933874_3934222_-	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	76.5	9.8e-46
WP_166444250.1|3934218_3934668_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	84.6	1.2e-64
WP_016150482.1|3934664_3935003_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	3.0e-39
WP_016150483.1|3935011_3935332_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	45.1	1.7e-15
WP_016150484.1|3935328_3935541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016150485.1|3935579_3936788_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	82.9	6.2e-188
WP_016150486.1|3936801_3937455_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	85.5	2.3e-104
WP_016240220.1|3937441_3938671_-|portal	phage portal protein	portal	U5P411	Shigella_phage	82.9	3.3e-205
WP_088731911.1|3938670_3938856_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	57.6	4.9e-12
WP_016150488.1|3938866_3940624_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	89.2	0.0e+00
WP_003841734.1|3940623_3941121_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	73.9	9.7e-63
WP_166444251.1|3941276_3941627_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.7	7.8e-51
WP_155849118.1|3941614_3941830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016150492.1|3942261_3942570_-	hypothetical protein	NA	Q5QF73	Pseudomonas_virus	56.4	4.2e-16
WP_016150493.1|3942666_3942864_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	93.8	1.5e-27
WP_166444252.1|3942893_3943424_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	47.9	1.2e-13
WP_043001125.1|3943420_3943870_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	79.2	1.0e-63
WP_046401839.1|3943853_3944177_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	83.8	6.1e-42
WP_166444253.1|3944320_3945373_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	82.7	2.3e-175
WP_166444254.1|3945523_3945715_-	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_166444255.1|3945914_3946712_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	94.0	8.1e-144
WP_166444256.1|3946708_3946849_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	88.9	9.4e-16
WP_166444257.1|3946845_3947202_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	88.1	1.8e-58
WP_166444258.1|3947198_3947495_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.8	4.6e-36
WP_061069733.1|3947703_3948306_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	93.0	1.2e-104
WP_152951849.1|3948718_3948952_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	83.1	6.0e-31
WP_114647604.1|3949304_3949511_-	hypothetical protein	NA	A0A2D1GLS1	Escherichia_phage	91.0	2.0e-30
WP_166444259.1|3949513_3949738_-	hypothetical protein	NA	A0A220NQV0	Salmonella_phage	89.5	4.2e-34
WP_166444260.1|3949740_3950544_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	84.8	4.7e-59
WP_166444261.1|3950540_3951152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166444262.1|3951148_3951382_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.0	5.6e-13
WP_044266830.1|3951378_3951585_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	63.1	1.5e-14
WP_166444263.1|3951581_3952295_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	22.8	1.8e-06
WP_090050880.1|3952310_3953060_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	93.2	1.3e-132
WP_109740555.1|3953062_3953965_-	DNA-binding protein	NA	V5URT9	Shigella_phage	46.7	1.1e-83
WP_166444264.1|3954366_3954909_-	regulator	NA	K7PJT7	Enterobacteria_phage	59.8	1.1e-46
WP_166444265.1|3954911_3955145_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	46.8	2.7e-15
WP_166444266.1|3955251_3955674_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_086512832.1|3955860_3956085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042999725.1|3956209_3956407_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_042999724.1|3956416_3956581_+	DNA breaking-rejoining protein	NA	K7P7H7	Enterobacteria_phage	78.4	7.6e-17
WP_000407050.1|3956666_3956954_+	hypothetical protein	NA	K7P7B3	Enterobacteria_phage	100.0	1.0e-48
WP_166444267.1|3957081_3960090_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	62.1	0.0e+00
WP_166444268.1|3960100_3961183_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	52.0	1.3e-99
WP_042997814.1|3961224_3961464_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	79.2	4.4e-29
WP_061069717.1|3961510_3961795_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	78.7	5.6e-39
WP_166444269.1|3961772_3963002_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.9	6.2e-236
WP_109740565.1|3963530_3964010_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_042999715.1|3964006_3964963_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_042999714.1|3964962_3965613_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|3965643_3966219_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_044253156.1|3966642_3968265_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_044253159.1|3968249_3968987_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_042999711.1|3969118_3970453_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	2.1e-43
WP_044253162.1|3970497_3970881_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	75.0	1.0e-32
3970540:3970556	attR	TTGTTCCGGCGTCAGTG	NA	NA	NA	NA
WP_042999709.1|3971198_3971888_+	uracil-DNA glycosylase	NA	A0A2D1AFC0	Eptesicus_fuscus_gammaherpesvirus	50.5	4.6e-55
WP_166444270.1|3971920_3972958_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP050009	Citrobacter sp. Y3 chromosome, complete genome	5246113	4949669	5006752	5246113	protease,capsid,tail,holin,plate,portal,terminase,head,integrase	Enterobacteria_phage(39.53%)	67	4971972:4972013	5003966:5004007
WP_044257469.1|4949669_4950200_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_044257468.1|4950209_4951541_+	HslU--HslV peptidase ATPase subunit	NA	A0A173GE36	Erwinia_phage	30.3	4.9e-45
WP_166444278.1|4951607_4952534_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_042998924.1|4952626_4953112_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_090050665.1|4953333_4953579_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_042998923.1|4953967_4954813_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.4	4.4e-15
WP_044257467.1|4954835_4956344_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_042998921.1|4956502_4957513_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_044257466.1|4957609_4958356_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_042998919.1|4958362_4958791_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_044328380.1|4958891_4959488_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_042325562.1|4959600_4960368_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_042998917.1|4960410_4961883_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_109739655.1|4961995_4963300_-	citrate transporter	NA	NA	NA	NA	NA
WP_043001793.1|4963385_4964108_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042998913.1|4964170_4965211_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_046401643.1|4965229_4966180_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_042998911.1|4966190_4967525_-	MFS transporter	NA	NA	NA	NA	NA
WP_042998910.1|4967790_4968546_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_044257458.1|4968648_4969638_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_042998908.1|4969840_4970803_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_042998907.1|4970987_4971890_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4971972:4972013	attL	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_047749528.1|4972133_4972517_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	64.6	4.2e-42
WP_064767481.1|4972642_4972891_-	hypothetical protein	NA	Q858U4	Yersinia_virus	50.0	4.0e-09
WP_047749527.1|4972930_4974067_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	75.7	2.1e-161
WP_166444279.1|4974220_4975402_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	76.5	8.5e-174
WP_021312596.1|4975402_4975918_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	64.7	7.9e-60
WP_045342178.1|4975966_4976284_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	55.1	9.9e-21
WP_032424037.1|4976289_4976445_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	2.7e-11
WP_166444280.1|4976431_4979398_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	54.5	7.1e-270
WP_014072465.1|4979412_4979901_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	74.1	2.4e-66
WP_166444281.1|4980055_4980472_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	44.8	1.1e-19
WP_166444282.1|4980475_4981591_-|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	62.3	5.5e-106
WP_166444283.1|4981580_4982195_-|tail	phage tail protein I	tail	A0A1J0I2I4	Salmonella_phage	63.7	4.7e-67
WP_166444284.1|4982187_4983084_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	68.1	3.7e-105
WP_021312601.1|4983070_4983439_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	64.3	1.3e-35
WP_166444285.1|4983435_4984017_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	68.9	4.9e-74
WP_166444286.1|4984013_4984652_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	52.7	1.3e-56
WP_166444287.1|4984644_4985115_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	68.0	6.6e-61
WP_166444288.1|4985119_4985656_-	DUF2514 domain-containing protein	NA	A0A0M4S5V1	Salmonella_phage	45.8	3.0e-25
WP_166444289.1|4985652_4986093_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	84.9	8.3e-66
WP_166444290.1|4986079_4986412_-|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	91.8	2.6e-48
WP_058651652.1|4986421_4986622_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	78.5	2.5e-22
WP_166444291.1|4986621_4987146_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	52.3	9.0e-43
WP_166444292.1|4987244_4988102_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.1	7.0e-69
WP_166444293.1|4988148_4989198_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	51.9	1.1e-103
WP_166444294.1|4989221_4990058_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	68.0	1.8e-101
WP_088544680.1|4990217_4991948_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	76.0	5.1e-268
WP_166444295.1|4991947_4993006_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.2	8.5e-141
WP_045900639.1|4993457_4994102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166444296.1|4994105_4995104_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_166444297.1|4995311_4996010_-	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	75.1	5.5e-96
WP_166444298.1|4996209_4998606_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	83.6	0.0e+00
WP_166444299.1|4998602_4999637_-	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	62.2	2.8e-128
WP_166444312.1|4999647_5000646_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	80.8	2.7e-141
WP_060707431.1|5000654_5000903_-	hypothetical protein	NA	A0A248SL63	Klebsiella_phage	80.8	1.5e-27
WP_063144349.1|5000918_5001131_-	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	67.1	2.8e-19
WP_047749498.1|5001217_5001448_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	96.1	1.2e-36
WP_032654192.1|5001437_5001641_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	98.5	1.8e-31
WP_166444300.1|5001642_5001885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016246742.1|5001892_5002096_-	hypothetical protein	NA	A0A0M3ULI0	Salmonella_phage	98.5	1.5e-30
WP_021312625.1|5002106_5002388_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	97.8	2.0e-49
WP_063144345.1|5002505_5002808_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	57.1	4.5e-23
WP_063144344.1|5002874_5003855_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	97.9	5.2e-185
WP_043001792.1|5004032_5004533_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
5003966:5004007	attR	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_001033731.1|5004683_5005382_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_044257455.1|5005378_5006752_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	3.8e-16
>prophage 1
NZ_CP050011	Citrobacter sp. Y3 plasmid unnamed2, complete sequence	89705	32581	81417	89705	integrase,transposase	Shigella_phage(28.57%)	42	53801:53817	81245:81261
WP_061549454.1|32581_33358_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.2	7.0e-52
WP_013087127.1|33376_33907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042948507.1|33971_34283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061549453.1|34968_35964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166444356.1|35967_36900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061549451.1|37161_38037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061549450.1|38100_38286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061549449.1|38440_38839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061549448.1|39806_40037_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_061549447.1|40033_40450_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_071789783.1|40639_40966_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_024553479.1|41472_41703_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024553480.1|41699_42116_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_085949497.1|42300_43448_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_166444370.1|43521_45486_+	AAA family ATPase	NA	A0A2H4J1E0	uncultured_Caudovirales_phage	32.7	3.1e-27
WP_166444357.1|45851_46082_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_166444358.1|46078_46495_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_061549446.1|46682_47585_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061549445.1|47708_49100_+	MFS transporter	NA	NA	NA	NA	NA
WP_166444359.1|49360_51982_+	histidinol-phosphatase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	22.3	2.3e-17
WP_004213565.1|52247_53222_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_110129298.1|53616_54845_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.4	1.3e-145
53801:53817	attL	TTCATCGTTTTCACGAA	NA	NA	NA	NA
WP_001372261.1|55194_56103_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_166444360.1|56490_56841_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	58.0	2.4e-20
WP_045409016.1|56984_57416_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_064148682.1|57666_59142_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000697969.1|59134_59815_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_047067158.1|60004_61390_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_166444361.1|61418_61772_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_049016439.1|61885_63178_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_000574021.1|63188_66335_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.6	8.0e-62
WP_002436620.1|66421_66862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166444362.1|66959_69431_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	34.8	1.3e-83
WP_000843494.1|69471_69669_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287501.1|69702_70440_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
WP_001023257.1|70728_71178_-	copper resistance protein	NA	NA	NA	NA	NA
WP_110129298.1|71465_72693_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.4	1.3e-145
WP_166444371.1|74045_75269_-	OprD family porin	NA	NA	NA	NA	NA
WP_041413283.1|75670_76120_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_109867410.1|77461_78613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013087234.1|78845_79823_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	39.7	1.7e-47
WP_094487604.1|80210_81417_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
81245:81261	attR	TTCGTGAAAACGATGAA	NA	NA	NA	NA
