The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050116	Deinococcus radiodurans strain BNK-50 chromosome 1, complete sequence	2648775	852811	862012	2648775	protease	Roseobacter_phage(16.67%)	9	NA	NA
WP_010886939.1|852811_854200_-	nicotinate phosphoribosyltransferase	NA	A0A1B0V392	Roseobacter_phage	51.1	5.0e-125
WP_010886940.1|854252_855101_-	phosphoprotein phosphatase	NA	A0A2H4PRN7	Proteus_phage	25.0	2.0e-07
WP_010886941.1|855097_855394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010886942.1|855437_856910_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_010886943.1|856985_857609_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	31.3	9.7e-20
WP_010886944.1|857608_858226_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	24.5	5.0e-08
WP_027480282.1|858308_859409_-|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	22.7	5.2e-08
WP_027480281.1|859405_859612_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
WP_027480280.1|860191_862012_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	40.5	2.2e-112
>prophage 1
NZ_CP050118	Deinococcus radiodurans strain BNK-50 plasmid pMP1, complete sequence	177356	1846	88812	177356	integrase,transposase	Bacillus_phage(20.0%)	61	45417:45442	79701:79726
WP_010884015.1|1846_2830_+|transposase	IS4-like element ISDra1 family transposase	transposase	NA	NA	NA	NA
WP_149358003.1|3118_3463_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_149358004.1|3423_4125_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.6	3.2e-35
WP_063653101.1|4200_5385_-|transposase	IS4-like element ISDra7 family transposase	transposase	NA	NA	NA	NA
WP_010884024.1|5538_6279_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_165439382.1|6286_7045_-	heme ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	4.1e-12
WP_010883993.1|7068_8133_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_081816091.1|9365_9626_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027480395.1|9626_10007_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_027480394.1|10295_11720_-	cobyric acid synthase	NA	NA	NA	NA	NA
WP_010883990.1|11727_12735_-	histidinol-phosphate aminotransferase family protein	NA	NA	NA	NA	NA
WP_034351275.1|12727_13624_-	cobalamin biosynthesis protein CobD	NA	NA	NA	NA	NA
WP_027480393.1|13620_14940_-	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_081799310.1|14935_15547_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_027480391.1|15555_16419_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010884020.1|17026_18010_-|transposase	IS4-like element ISDra1 family transposase	transposase	NA	NA	NA	NA
WP_162177818.1|18401_19997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884039.1|19989_21483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884026.1|22336_23212_-	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	42.6	1.2e-12
WP_010884025.1|23208_23985_-	ParA family protein	NA	Q8JL10	Natrialba_phage	31.1	1.8e-10
WP_027480407.1|24626_26024_+	lipoprotein	NA	NA	NA	NA	NA
WP_010884037.1|26172_27501_-	McrC family protein	NA	NA	NA	NA	NA
WP_010883985.1|27500_30410_-	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	39.8	1.5e-25
WP_162177817.1|30406_30940_-	hypothetical protein	NA	Q24LG0	Clostridium_phage	23.4	2.4e-06
WP_010884027.1|30963_31470_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_081816096.1|31509_31767_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_010884023.1|45028_46012_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
45417:45442	attL	ACGAGGTCACCCACAGGTGACCTCGT	NA	NA	NA	NA
WP_051618940.1|46318_47827_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_063653090.1|47919_49104_+|transposase	IS4-like element ISDra7 family transposase	transposase	NA	NA	NA	NA
WP_027480398.1|49615_50395_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.9	3.9e-42
WP_010883977.1|50838_52140_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_010883976.1|52136_53450_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_010883975.1|53979_54501_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010883974.1|54843_55818_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_162177813.1|55826_56738_+	SIP domain-containing protein	NA	NA	NA	NA	NA
WP_010883972.1|56734_57709_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_162177814.1|57768_58737_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_010883970.1|58733_59543_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	1.7e-16
WP_010883969.1|60838_62107_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	40.6	7.3e-38
WP_027480426.1|62390_63344_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_010884022.1|63359_64343_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_010884035.1|64707_65421_+	DUF2259 domain-containing protein	NA	NA	NA	NA	NA
WP_063653102.1|65828_67013_-|transposase	IS4-like element ISDra7 family transposase	transposase	NA	NA	NA	NA
WP_027480400.1|68511_69078_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_162177815.1|69291_71601_-	glycerophosphodiester phosphodiesterase	NA	A0A2P1N091	Streptomyces_phage	36.0	3.2e-07
WP_010884021.1|71659_71923_-	thioredoxin	NA	NA	NA	NA	NA
WP_027480401.1|71915_72911_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A142F1R6	Bacillus_phage	50.8	7.3e-86
WP_027480402.1|72967_75055_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	47.8	1.1e-189
WP_010883964.1|75039_75465_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	S5MA49	Bacillus_phage	33.3	5.1e-12
WP_162177816.1|75621_76104_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_010883962.1|76537_77572_-|integrase	tyrosine-type recombinase/integrase	integrase	W8EHC2	Mycobacterium_phage	33.3	1.3e-08
WP_063653103.1|77729_78905_-|transposase	IS4-like element ISDra7 family transposase	transposase	NA	NA	NA	NA
WP_010884020.1|79130_80114_+|transposase	IS4-like element ISDra1 family transposase	transposase	NA	NA	NA	NA
79701:79726	attR	ACGAGGTCACCCACAGGTGACCTCGT	NA	NA	NA	NA
WP_081816080.1|80537_81419_+	hypothetical protein	NA	A0A1V0SK86	Klosneuvirus	27.6	6.6e-30
WP_010884034.1|81611_82244_+	RNA ligase family protein	NA	A0A248SJ81	Salicola_phage	49.0	5.5e-55
WP_010884064.1|82240_83098_+	TIGR02452 family protein	NA	G3MBH6	Bacillus_virus	38.4	7.6e-39
WP_010884033.1|83073_84315_+	AAA family ATPase	NA	D5GVP0	Campylobacter_virus	31.4	7.2e-06
WP_034351235.1|84398_85187_-	alpha/beta fold hydrolase	NA	A0A218MNI3	uncultured_virus	40.8	4.9e-61
WP_010884031.1|85356_85695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165439381.1|85734_86127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162150140.1|87780_88812_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.0	1.2e-14
