The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050171	Serratia fonticola strain CPSE11 chromosome, complete genome	5488891	392523	426692	5488891	head,terminase,lysis,plate,integrase,tail,portal,capsid	Escherichia_phage(35.29%)	41	392402:392420	425865:425883
392402:392420	attL	AAGGCCACCGAAGTGGCCT	NA	NA	NA	NA
WP_071683683.1|392523_392742_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	65.3	1.8e-21
WP_166732800.1|392813_393995_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	74.0	8.2e-161
WP_166732801.1|393991_394477_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	67.5	5.7e-52
WP_166732802.1|394492_396940_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	47.2	1.0e-181
WP_166732803.1|396932_397052_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	79.5	3.1e-12
WP_166732804.1|397084_397381_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	78.2	1.4e-29
WP_071680397.1|397443_397965_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	76.7	1.0e-75
WP_166732805.1|397979_399149_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	82.1	4.6e-188
WP_166732806.1|399428_399854_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	49.2	6.2e-26
WP_166732807.1|399855_402231_-	hypothetical protein	NA	Q858V4	Yersinia_virus	55.5	8.2e-59
WP_074030996.1|402243_402771_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	73.6	2.8e-76
WP_166732808.1|402763_403672_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	76.8	9.5e-125
WP_166732809.1|403677_404025_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	71.1	5.6e-41
WP_166732810.1|404021_404663_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	73.2	2.3e-85
WP_166732811.1|404815_406486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166732812.1|406668_407121_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	71.1	2.9e-50
WP_166732813.1|407113_407581_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.8	1.6e-62
WP_166732814.1|407661_408102_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	47.4	1.3e-21
WP_166732815.1|408098_408608_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	73.1	2.2e-62
WP_166732816.1|408591_408801_-	hypothetical protein	NA	B6SD15	Bacteriophage	46.4	6.6e-05
WP_166732817.1|408803_409007_-|tail	phage tail protein	tail	Q858W3	Yersinia_virus	68.7	9.2e-20
WP_166732818.1|409006_409513_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	72.0	4.9e-62
WP_166732819.1|409605_410352_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	63.2	1.0e-68
WP_166732820.1|410355_411507_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	76.9	3.6e-153
WP_071680414.1|411569_412415_-|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	70.5	7.5e-108
WP_166732821.1|412579_414352_+|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	82.7	3.3e-291
WP_166732822.1|414348_415380_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	80.7	9.1e-164
WP_166732823.1|415503_416625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166732824.1|416888_417647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166732825.1|418243_419959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166732826.1|420064_422161_-	replication endonuclease	NA	A0A0F7LA09	Escherichia_phage	62.6	1.1e-251
WP_166735056.1|422157_422442_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	61.1	2.0e-25
WP_166732827.1|422441_422657_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	59.2	7.7e-17
WP_166732828.1|422644_422983_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_166732829.1|422975_423230_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_166732830.1|423293_423794_-	replication protein B	NA	M1SV55	Escherichia_phage	71.1	7.2e-66
WP_166732831.1|423790_423961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166732832.1|423966_424260_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	70.0	8.0e-33
WP_166732833.1|424385_424685_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	2.9e-38
WP_166732834.1|424772_425780_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	62.4	9.3e-121
WP_021180979.1|425903_426692_-	phosphate starvation-inducible protein PhoH	NA	A0A1B2ICF6	Erwinia_phage	75.5	1.0e-90
425865:425883	attR	AAGGCCACCGAAGTGGCCT	NA	NA	NA	NA
>prophage 2
NZ_CP050171	Serratia fonticola strain CPSE11 chromosome, complete genome	5488891	1874887	1912577	5488891	head,terminase,lysis,plate,integrase,tRNA,tail,portal,capsid	Erwinia_phage(48.65%)	47	1881154:1881173	1913600:1913619
WP_021806880.1|1874887_1875901_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	7.4e-110
WP_001144069.1|1876225_1876441_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_166733421.1|1876578_1878327_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.6	3.0e-74
WP_166733422.1|1878484_1880323_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_074031204.1|1880372_1880861_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
1881154:1881173	attL	AGTGGCGATAAAGTGGCGGT	NA	NA	NA	NA
WP_071784412.1|1881230_1881449_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	75.0	3.7e-27
WP_166733423.1|1881539_1882694_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	65.5	1.0e-139
WP_166733424.1|1882690_1883164_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	66.9	8.4e-48
WP_166733425.1|1883176_1885861_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	46.1	9.6e-149
WP_071784415.1|1885853_1885985_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	73.8	4.5e-12
WP_024528260.1|1886005_1886290_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	69.8	1.9e-26
WP_166733426.1|1886344_1886854_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	73.0	2.1e-68
WP_166733427.1|1886868_1888038_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	81.4	4.7e-185
WP_166733428.1|1888398_1888626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166733429.1|1888597_1889254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166733430.1|1889572_1890055_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.8	1.3e-24
WP_166735112.1|1889999_1891985_-	hypothetical protein	NA	V9M0B7	Vibrio_phage	25.6	1.2e-10
WP_166733431.1|1892748_1893276_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	70.1	3.4e-74
WP_166733432.1|1893268_1894177_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	78.1	4.6e-127
WP_166733433.1|1894181_1894532_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	62.9	3.2e-36
WP_166733434.1|1894528_1895161_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	67.3	1.7e-72
WP_166733435.1|1895316_1896024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166733436.1|1896032_1896488_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	57.8	4.4e-38
WP_166733437.1|1896474_1896948_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	71.7	3.6e-59
WP_166733438.1|1897043_1897475_-|lysis	LysB family phage lysis regulatory protein	lysis	NA	NA	NA	NA
WP_166733439.1|1897471_1897981_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	67.7	8.7e-59
WP_024528243.1|1897964_1898174_-	hypothetical protein	NA	B6SD15	Bacteriophage	44.6	1.3e-05
WP_166733440.1|1898178_1898382_-|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	62.7	1.7e-18
WP_166733441.1|1898381_1898876_-|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	48.5	9.7e-39
WP_166733442.1|1898967_1899627_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	68.5	7.5e-79
WP_166733443.1|1899630_1900719_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	76.1	7.6e-153
WP_166733444.1|1900754_1901597_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	53.7	1.5e-71
WP_166733445.1|1901735_1903508_+|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	81.5	8.5e-287
WP_166733446.1|1903507_1904530_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	79.2	2.0e-163
WP_166733447.1|1904580_1904925_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_166733448.1|1904927_1905890_-	hypothetical protein	NA	A4PE73	Ralstonia_virus	44.2	1.7e-55
WP_166733449.1|1906192_1906417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024528233.1|1906438_1906633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166733450.1|1906708_1908922_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	58.1	3.4e-240
WP_166733451.1|1909027_1909252_-	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	55.7	3.2e-13
WP_166733452.1|1909251_1909488_-	DUF2732 family protein	NA	F1BUS3	Erwinia_phage	56.1	2.2e-09
WP_024528229.1|1909554_1909857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166733453.1|1909868_1910048_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	50.0	1.3e-06
WP_166733454.1|1910058_1910568_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	53.0	9.3e-45
WP_166733455.1|1910598_1910862_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	88.4	4.3e-38
WP_166733456.1|1910997_1911585_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	59.9	1.8e-63
WP_166733457.1|1911584_1912577_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	93.0	4.2e-182
1913600:1913619	attR	AGTGGCGATAAAGTGGCGGT	NA	NA	NA	NA
>prophage 3
NZ_CP050171	Serratia fonticola strain CPSE11 chromosome, complete genome	5488891	2212005	2223062	5488891		environmental_Halophage(16.67%)	9	NA	NA
WP_166733570.1|2212005_2214081_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	70.5	1.7e-52
WP_024482717.1|2214112_2215330_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.0	4.1e-30
WP_021181676.1|2215424_2216000_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	63.7	9.5e-70
WP_037376694.1|2216216_2216576_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_021181678.1|2216559_2216883_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_166733571.1|2216920_2218750_-	hypothetical protein	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.8	6.0e-09
WP_166733572.1|2218757_2220284_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.6	7.1e-80
WP_021181680.1|2220651_2221377_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_021807483.1|2221376_2223062_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	72.1	3.5e-221
>prophage 4
NZ_CP050171	Serratia fonticola strain CPSE11 chromosome, complete genome	5488891	2715448	2777641	5488891	tRNA,plate,transposase,integrase	Enterobacteria_phage(20.0%)	51	2721874:2721888	2780949:2780963
WP_166733767.1|2715448_2716840_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_166733768.1|2716836_2718678_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.2	7.6e-12
WP_021181331.1|2718889_2720428_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_166733769.1|2720473_2721718_-	MFS transporter	NA	NA	NA	NA	NA
2721874:2721888	attL	GCTGCGCCCCCCTGA	NA	NA	NA	NA
WP_166733770.1|2722072_2723065_+	acyltransferase	NA	NA	NA	NA	NA
WP_166733771.1|2723061_2723979_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_166733772.1|2723981_2724533_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_166733773.1|2724688_2726140_-	xylulokinase	NA	NA	NA	NA	NA
WP_166733774.1|2726191_2727508_-	xylose isomerase	NA	NA	NA	NA	NA
WP_166735129.1|2730371_2731550_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_166733775.1|2731665_2733012_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_166733776.1|2733273_2733963_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166733777.1|2734086_2736405_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_166733778.1|2736485_2737838_+	amino acid permease	NA	NA	NA	NA	NA
WP_021181316.1|2737931_2738516_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_166733779.1|2738960_2740139_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.4	2.8e-161
WP_074030892.1|2740142_2740961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074030893.1|2741092_2741368_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_071784886.1|2741410_2741602_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_021807316.1|2741737_2741914_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_166733780.1|2741906_2742251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021807318.1|2742295_2742577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074030897.1|2742573_2742930_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_166733781.1|2742940_2745628_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	31.8	7.6e-61
WP_166733782.1|2746052_2746823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166733783.1|2746826_2747066_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	57.7	4.0e-14
WP_166733784.1|2747483_2748719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166733785.1|2748715_2749831_+	DUF262 domain-containing protein	NA	A0A0M4RT01	Citrobacter_phage	26.9	1.5e-07
WP_166733786.1|2749832_2750576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059199184.1|2750898_2751525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059199183.1|2752420_2752813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166733787.1|2753109_2753394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039996075.1|2753597_2753990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141234366.1|2753982_2754294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071925976.1|2754521_2754713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166733788.1|2754742_2755141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166733789.1|2755143_2757045_-	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.1	1.8e-32
WP_166733790.1|2757288_2758440_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	4.4e-42
WP_166732628.1|2759731_2760040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166733791.1|2760186_2760513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166733792.1|2760831_2761239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166733793.1|2761241_2766263_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	40.2	1.1e-33
WP_166733794.1|2766273_2767059_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_166733795.1|2767172_2769467_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_166733796.1|2769487_2771233_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059199175.1|2771251_2772280_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_166733797.1|2772276_2774019_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_166733798.1|2774043_2775504_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_059199172.1|2775594_2775858_-	PAAR domain-containing protein	NA	E5E3Y0	Burkholderia_phage	47.7	7.0e-12
WP_021807336.1|2776305_2776779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039996142.1|2777047_2777641_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	50.5	8.3e-53
2780949:2780963	attR	TCAGGGGGGCGCAGC	NA	NA	NA	NA
>prophage 5
NZ_CP050171	Serratia fonticola strain CPSE11 chromosome, complete genome	5488891	3599691	3654312	5488891	tRNA,tail,integrase,transposase	uncultured_Mediterranean_phage(28.57%)	56	3610514:3610537	3653081:3653104
WP_166734129.1|3599691_3600738_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_166734130.1|3601129_3601855_+	fimbrial protein	NA	NA	NA	NA	NA
WP_166734131.1|3601937_3602435_+	fimbrial protein	NA	NA	NA	NA	NA
WP_166735143.1|3602557_3605215_+	fimbrial protein	NA	NA	NA	NA	NA
WP_166734132.1|3605225_3606410_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_059199807.1|3606705_3607467_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.8	4.5e-67
WP_024484091.1|3607460_3608087_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.0	8.2e-35
WP_166734133.1|3608354_3609338_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	36.4	1.5e-06
WP_024484093.1|3609392_3610391_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	4.7e-32
3610514:3610537	attL	GCCCTCACCCCAACCCTCTCCCAC	NA	NA	NA	NA
WP_166734134.1|3610868_3613424_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	5.6e-29
WP_166734135.1|3613502_3613703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166734136.1|3613865_3614639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166734137.1|3614944_3615580_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_166734138.1|3616228_3616855_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_166734139.1|3617672_3618239_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_166734140.1|3618648_3619140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166734141.1|3619069_3619222_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_166734142.1|3619325_3619820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166734143.1|3619803_3620586_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_166734144.1|3621162_3621654_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_166734145.1|3621719_3622247_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_166734146.1|3622331_3624848_+	outer membrane usher protein	NA	NA	NA	NA	NA
WP_166735144.1|3624961_3625738_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_166734147.1|3625780_3626383_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_166734148.1|3626391_3626904_+	MrfE protein	NA	NA	NA	NA	NA
WP_166734149.1|3626918_3627413_+	fimbrial protein	NA	NA	NA	NA	NA
WP_166734150.1|3627426_3627924_+	fimbrial protein	NA	NA	NA	NA	NA
WP_166734151.1|3627920_3628439_+	fimbrial protein	NA	NA	NA	NA	NA
WP_166734152.1|3628454_3628988_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_166734153.1|3629033_3629888_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_166734154.1|3630029_3630950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166732741.1|3631318_3632473_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_166734155.1|3632623_3633100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166734156.1|3633096_3633891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166734157.1|3634285_3634957_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166734158.1|3635115_3635658_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_166735145.1|3635773_3636277_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_166734159.1|3636294_3638829_+	outer membrane usher protein	NA	NA	NA	NA	NA
WP_166734160.1|3638842_3639598_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_166734161.1|3639621_3640107_+	fimbrial protein	NA	NA	NA	NA	NA
WP_166735146.1|3640139_3640604_+	fimbrial protein	NA	NA	NA	NA	NA
WP_166734162.1|3640613_3641144_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_166734163.1|3641210_3642014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166734164.1|3642603_3643275_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	54.0	1.8e-48
WP_071682398.1|3643680_3644229_+	fimbrial protein	NA	NA	NA	NA	NA
WP_166734165.1|3644307_3644850_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_071682396.1|3644960_3645644_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_166734166.1|3645726_3648366_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_166734167.1|3648388_3648916_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_137751119.1|3648937_3649438_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_071682393.1|3649451_3650369_+	fimbrial protein	NA	NA	NA	NA	NA
WP_166734168.1|3650435_3651101_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_166734169.1|3651097_3651712_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_071682390.1|3651823_3652399_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.4	1.3e-47
WP_024530435.1|3652829_3653081_+	DinI-like family protein	NA	NA	NA	NA	NA
WP_166733867.1|3653157_3654312_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
3653081:3653104	attR	GCCCTCACCCCAACCCTCTCCCAC	NA	NA	NA	NA
>prophage 6
NZ_CP050171	Serratia fonticola strain CPSE11 chromosome, complete genome	5488891	4017992	4060518	5488891	head,terminase,tRNA,tail,holin	Salmonella_phage(40.48%)	59	NA	NA
WP_166734325.1|4017992_4018214_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	47.3	4.1e-13
WP_166734326.1|4018210_4018414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166734327.1|4018432_4018795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166735155.1|4018791_4019163_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_166734328.1|4019192_4019939_-	ORF6N domain-containing protein	NA	A0A1B0V7F1	Salmonella_phage	61.1	1.0e-23
WP_166734329.1|4019950_4020448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166734330.1|4020444_4020753_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166734331.1|4020749_4021220_-	hypothetical protein	NA	A0A1B0VMJ8	Pseudomonas_phage	33.1	8.1e-11
WP_166734332.1|4021219_4021588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166734333.1|4021698_4022010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166734334.1|4022009_4022231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166734335.1|4022227_4022413_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_166734336.1|4022456_4022834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166734337.1|4022973_4023630_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	60.8	7.0e-69
WP_166734338.1|4023735_4023957_+	helix-turn-helix transcriptional regulator	NA	A0A220NRR8	Escherichia_phage	55.1	7.4e-15
WP_166734339.1|4023949_4024282_+	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	50.5	4.0e-20
WP_115158648.1|4024604_4025099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166734340.1|4025091_4026597_+	DEAD/DEAH box helicase family protein	NA	A0A286N2P9	Klebsiella_phage	65.3	5.9e-204
WP_166734341.1|4026593_4027574_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	57.5	3.1e-105
WP_161739636.1|4027573_4027762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115158652.1|4027754_4028186_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	70.0	9.6e-43
WP_166734342.1|4029486_4029834_+|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	60.7	6.0e-27
WP_166734343.1|4029820_4030216_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	71.5	5.2e-51
WP_166734344.1|4030212_4030572_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_166735156.1|4030591_4030768_+	lytic transglycosylase	NA	Q776X1	Haemophilus_phage	55.1	9.7e-10
WP_166734345.1|4030867_4031164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166734346.1|4031532_4032144_+|terminase	terminase small subunit	terminase	A0A2R3UAN5	Myoviridae_environmental_samples	45.9	1.0e-37
WP_166734347.1|4032364_4033987_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	93.9	6.1e-308
WP_166734348.1|4033986_4035453_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	86.7	2.5e-244
WP_166734349.1|4035523_4036057_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	57.0	5.5e-48
WP_166734350.1|4036318_4037551_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	84.6	6.1e-191
WP_166734351.1|4037555_4038053_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	82.4	2.3e-72
WP_166734352.1|4038064_4039006_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	93.3	1.5e-168
WP_166734353.1|4039047_4039446_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	51.7	3.2e-16
WP_166734354.1|4039426_4039840_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	72.4	7.8e-50
WP_166734355.1|4039836_4040343_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	38.9	3.2e-21
WP_166734356.1|4040342_4040729_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	77.4	5.2e-48
WP_166734357.1|4040706_4041264_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	55.2	1.3e-52
WP_166734358.1|4041266_4042748_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	53.3	1.2e-137
WP_166734359.1|4042757_4043201_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	67.6	3.4e-51
WP_166734360.1|4043211_4043655_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	44.9	1.8e-23
WP_166734361.1|4043832_4045866_+	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	46.2	3.5e-167
WP_115158671.1|4045865_4046459_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	55.6	7.0e-52
WP_166734362.1|4046448_4046760_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	47.4	1.3e-17
WP_166734363.1|4046791_4047739_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	42.4	1.0e-73
WP_166734364.1|4047735_4048491_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	53.0	1.6e-61
WP_166734365.1|4048487_4048841_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	65.0	1.2e-38
WP_166735157.1|4048837_4050031_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	57.1	7.1e-120
WP_115158676.1|4050027_4050702_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	48.8	4.2e-53
WP_166734366.1|4050694_4051660_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	48.9	3.3e-14
WP_166734367.1|4051700_4052723_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	30.6	1.6e-19
WP_166734368.1|4052831_4054190_+	hypothetical protein	NA	A0A1S6KUV1	Providencia_phage	38.4	9.2e-39
WP_166735158.1|4054245_4054587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166734369.1|4054667_4055144_-	SocA family protein	NA	D0UIM3	Aggregatibacter_phage	39.9	3.9e-21
WP_166735159.1|4055350_4055587_-	DinI-like family protein	NA	H6WRY5	Salmonella_phage	48.7	7.4e-13
WP_166734370.1|4055607_4055850_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	74.7	9.2e-27
WP_021805445.1|4056152_4056632_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_166734371.1|4056853_4057657_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_166734372.1|4057806_4060518_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.6	8.1e-111
>prophage 7
NZ_CP050171	Serratia fonticola strain CPSE11 chromosome, complete genome	5488891	4563103	4578155	5488891		Enterobacteria_phage(50.0%)	13	NA	NA
WP_166735173.1|4563103_4564528_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.2	6.4e-59
WP_166734604.1|4564542_4565910_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	4.7e-35
WP_166734605.1|4567022_4568087_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.6	4.6e-102
WP_021805026.1|4568106_4568976_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	2.2e-110
WP_021805025.1|4568977_4569514_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	62.6	1.6e-63
WP_021805024.1|4569510_4570371_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	40.0	4.6e-44
WP_166734606.1|4570576_4571590_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.3	2.6e-78
WP_021805022.1|4571816_4572881_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	4.6e-102
WP_021805021.1|4572895_4573765_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	69.1	3.6e-113
WP_021805020.1|4573766_4574303_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	63.1	6.1e-63
WP_115159854.1|4574299_4575166_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	42.7	1.3e-43
WP_021805018.1|4575982_4576804_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_166734607.1|4576793_4578155_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.2	2.6e-09
>prophage 8
NZ_CP050171	Serratia fonticola strain CPSE11 chromosome, complete genome	5488891	4670841	4679653	5488891	tRNA	Escherichia_phage(83.33%)	6	NA	NA
WP_115159637.1|4670841_4672134_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.4	1.4e-92
WP_166734647.1|4672395_4674846_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.6	1.1e-218
WP_166734648.1|4675055_4677506_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.6	9.8e-225
WP_021804936.1|4677516_4678134_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	1.9e-76
WP_166734649.1|4678135_4678996_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	33.5	5.3e-24
WP_021804934.1|4679044_4679653_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	33.8	7.5e-25
>prophage 9
NZ_CP050171	Serratia fonticola strain CPSE11 chromosome, complete genome	5488891	4749312	4814308	5488891	protease,plate	uncultured_Caudovirales_phage(28.57%)	58	NA	NA
WP_166734675.1|4749312_4751082_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_037375184.1|4751269_4751728_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_166734676.1|4751793_4752876_-	porin OmpA	NA	NA	NA	NA	NA
WP_166734677.1|4753235_4753742_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_166734678.1|4753974_4754631_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_166734679.1|4754635_4756771_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_021804873.1|4756805_4757249_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_021804872.1|4757404_4759459_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.4	8.8e-17
WP_021804871.1|4759492_4759951_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_166734680.1|4760078_4760738_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_021182047.1|4760976_4761390_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_021182046.1|4761488_4761806_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_021804868.1|4761867_4763058_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_021181988.1|4763150_4763429_+	acylphosphatase	NA	NA	NA	NA	NA
WP_024485653.1|4763436_4763766_-	sulfurtransferase TusE	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	51.9	1.4e-22
WP_021181987.1|4763875_4764535_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.5	2.4e-48
WP_166734681.1|4765226_4766102_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_166734682.1|4766650_4767895_+	amino acid permease	NA	NA	NA	NA	NA
WP_166734683.1|4768332_4769295_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021804858.1|4769375_4770278_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021178434.1|4770274_4771069_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	24.6	4.9e-08
WP_166734684.1|4771233_4772832_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059200428.1|4773355_4774522_+	MFS transporter	NA	NA	NA	NA	NA
WP_059200429.1|4774590_4775169_+	hypothetical protein	NA	A0A223W000	Agrobacterium_phage	34.7	1.8e-23
WP_166734685.1|4775230_4776499_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_021804855.1|4776479_4777649_-	putative lipopolysaccharide heptosyltransferase III	NA	NA	NA	NA	NA
WP_166734686.1|4777929_4780074_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.5	4.5e-24
WP_166734687.1|4780245_4780698_-	hydrogenase maturation peptidase HycI	NA	NA	NA	NA	NA
WP_021804853.1|4780694_4781111_-	HycH family protein	NA	NA	NA	NA	NA
WP_115158287.1|4781100_4781886_-	NADH-quinone oxidoreductase subunit B family protein	NA	NA	NA	NA	NA
WP_166734688.1|4781887_4782433_-	hydrogenase 4 subunit H	NA	NA	NA	NA	NA
WP_166734689.1|4782443_4784180_-	hydrogenase large subunit	NA	NA	NA	NA	NA
WP_166735177.1|4784176_4785760_-	hydrogenase 4 subunit F	NA	NA	NA	NA	NA
WP_166734690.1|4785764_4786415_-	hydrogenase 4 membrane subunit	NA	NA	NA	NA	NA
WP_166734691.1|4786426_4787884_-	hydrogenase 4 subunit D	NA	NA	NA	NA	NA
WP_166734692.1|4787901_4788852_-	respiratory chain complex I subunit 1 family protein	NA	NA	NA	NA	NA
WP_166734693.1|4788864_4790880_-	hydrogenase 4 subunit B	NA	NA	NA	NA	NA
WP_166734694.1|4790882_4791503_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_059200440.1|4791534_4792077_-	electron transport protein HydN	NA	NA	NA	NA	NA
WP_166734695.1|4794036_4794381_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_059200441.1|4794396_4794690_+	HypC/HybG/HupF family hydrogenase formation chaperone	NA	NA	NA	NA	NA
WP_166734696.1|4794829_4796896_+	formate hydrogenlyase transcriptional activator FlhA	NA	NA	NA	NA	NA
WP_166734697.1|4797352_4797514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166734698.1|4797750_4798329_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166734699.1|4798382_4798883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166734700.1|4798971_4802229_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.3	3.8e-38
WP_166734701.1|4802246_4802897_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_166734702.1|4803275_4804025_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_166734703.1|4804102_4804513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021178406.1|4804563_4805082_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_166734704.1|4805842_4806340_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_166734705.1|4806367_4807849_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_021178403.1|4807855_4808296_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_021804825.1|4808295_4810110_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_021804824.1|4810073_4811126_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_166734706.1|4811151_4812456_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_021178399.1|4812452_4812959_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_024486774.1|4812961_4814308_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
NZ_CP050172	Serratia fonticola strain CPSE11 plasmid plas1, complete sequence	122261	3408	66117	122261	integrase,transposase	Escherichia_phage(26.67%)	53	2126:2139	23777:23790
2126:2139	attL	TTCGCCAGCGGCAC	NA	NA	NA	NA
WP_166735280.1|3408_4212_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	57.9	1.0e-29
WP_166735209.1|4278_4626_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_161713053.1|4609_4879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166735210.1|5037_5244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166735211.1|5431_5530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037376617.1|5847_6135_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	60.6	3.2e-26
WP_004966044.1|6124_6367_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	51.2	1.4e-14
WP_166735281.1|6683_7877_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	78.5	1.5e-181
WP_166735212.1|7885_8857_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	51.4	1.5e-80
WP_166735213.1|9923_10475_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.4	2.7e-50
WP_166735214.1|10452_10767_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_166735215.1|10830_12864_+	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	26.4	1.8e-06
WP_166735216.1|12903_13350_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_166735217.1|13346_14069_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_166735282.1|14071_14386_+	theronine dehydrogenase	NA	I3UM57	Rhodobacter_phage	36.9	8.9e-14
WP_166735218.1|14428_14695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166735219.1|15362_15818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166735220.1|15865_16216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166735221.1|16306_16453_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_166735222.1|16498_17302_+	SAM-dependent DNA methyltransferase	NA	H7BVT3	unidentified_phage	39.9	2.2e-16
WP_166735223.1|18926_19382_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_166735224.1|19803_20199_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_166735225.1|20435_21215_-	response regulator	NA	NA	NA	NA	NA
WP_074423335.1|21474_21669_+	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_083196351.1|21859_22246_+	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_166735226.1|22310_22661_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_065684418.1|22810_23116_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_166735227.1|23130_23697_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_166735228.1|23683_24427_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
23777:23790	attR	GTGCCGCTGGCGAA	NA	NA	NA	NA
WP_166735229.1|24413_25808_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_166735230.1|26266_27292_+	DUF3472 domain-containing protein	NA	NA	NA	NA	NA
WP_166735231.1|27662_28277_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.0	3.6e-35
WP_166735232.1|28436_31466_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_166735233.1|32245_32482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166735234.1|33494_35432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166735235.1|35682_36306_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	30.7	3.8e-08
WP_036419632.1|39397_39565_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_166735283.1|39600_42888_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_166735236.1|42889_43627_+	type-F conjugative transfer system pilin acetylase TraX	NA	NA	NA	NA	NA
WP_166735237.1|43695_44412_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_166735238.1|45126_45378_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_166735284.1|45809_46748_+	Replication protein	NA	NA	NA	NA	NA
WP_074032256.1|47735_47954_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_166735239.1|47955_48261_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_166735240.1|49905_52926_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L0UZX3	Agrobacterium_phage	26.6	3.8e-08
WP_166735285.1|53538_54762_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_166735241.1|54941_55346_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_166735242.1|56335_57217_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166735243.1|58161_58857_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.1	6.1e-39
WP_166735244.1|59090_61742_-	peptidase M66	NA	NA	NA	NA	NA
WP_166735245.1|62153_63203_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_166735246.1|65122_65818_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.1	8.0e-39
WP_166735286.1|65778_66117_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	45.1	3.7e-05
