The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050173	Escherichia coli strain STB20-1 chromosome, complete genome	4695656	1055547	1068730	4695656		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1055547_1056309_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1056302_1056929_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1057068_1058208_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1058270_1059263_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1059356_1060721_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1060809_1061586_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1061590_1062229_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1062225_1063488_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1063484_1064393_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|1064588_1065356_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1065406_1066063_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_085438572.1|1066168_1068730_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	7.8e-31
>prophage 2
NZ_CP050173	Escherichia coli strain STB20-1 chromosome, complete genome	4695656	1149771	1250235	4695656	transposase,portal,terminase,tRNA,capsid,head,tail,holin,integrase	Cronobacter_phage(44.68%)	103	1169371:1169387	1239083:1239099
WP_089566769.1|1149771_1150933_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000795662.1|1151300_1151507_+	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	6.5e-05
WP_000151178.1|1151527_1151827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572958.1|1152075_1152351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414984.1|1152892_1153456_-	hypothetical protein	NA	M1PL54	Cellulophaga_phage	44.9	1.8e-36
WP_000614786.1|1156199_1157096_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_021570915.1|1157092_1157989_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_021570914.1|1157978_1159535_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.3	1.1e-19
WP_088895425.1|1159627_1160855_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001384082.1|1161153_1162383_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.3	2.7e-207
WP_000162574.1|1163126_1163609_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600189.1|1163740_1164217_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1164206_1164497_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1164558_1164900_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|1165048_1166710_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1166795_1167674_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1167796_1168390_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|1168444_1169731_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
1169371:1169387	attL	GGTACAGCGCGGCAATG	NA	NA	NA	NA
WP_001338897.1|1169751_1170543_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1170709_1172071_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1172319_1172568_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1172586_1173135_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1173165_1173933_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1173974_1174322_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589847.1|1174397_1174880_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969032.1|1174895_1176122_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1176111_1176630_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|1176779_1177145_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168037.1|1177354_1178425_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225229.1|1178435_1179557_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200120.1|1179599_1180760_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010723158.1|1180858_1180906_-	phe operon leader peptide	NA	NA	NA	NA	NA
WP_077629794.1|1181069_1182089_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	57.2	5.9e-107
WP_000089404.1|1182128_1182428_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	54.2	5.9e-23
WP_000662537.1|1182536_1182818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000853270.1|1182844_1183180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681788.1|1183189_1183759_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	50.5	7.2e-46
WP_071988497.1|1183761_1183980_+	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	45.2	2.4e-05
WP_032292416.1|1184019_1186677_+	toprim domain protein	NA	A0A077K8T2	Ralstonia_phage	46.5	1.8e-240
WP_000909748.1|1186745_1187465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100224585.1|1187604_1187880_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	61.4	1.7e-24
WP_000746492.1|1187933_1188953_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	69.1	9.3e-137
WP_064670487.1|1188949_1190731_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	70.3	2.9e-250
WP_064670488.1|1190874_1191714_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	48.0	1.2e-44
WP_032295604.1|1191748_1192777_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.9	2.2e-133
WP_032292413.1|1192787_1193501_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	54.3	3.9e-65
WP_064670486.1|1193502_1193694_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	55.2	7.3e-11
WP_032292411.1|1193748_1194240_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	62.0	9.6e-47
WP_032292410.1|1194236_1194719_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	5.2e-37
WP_032292409.1|1194715_1195420_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	60.3	4.0e-70
WP_151140365.1|1195416_1196544_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.5	8.1e-174
WP_089587597.1|1196540_1196996_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.3e-58
WP_032292406.1|1197008_1197305_+|holin	holin	holin	C7BGD7	Burkholderia_phage	50.6	2.4e-16
WP_032292405.1|1197301_1197643_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	85.1	8.1e-45
WP_032292404.1|1197642_1197975_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	65.5	3.3e-35
WP_032292402.1|1198121_1198379_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	62.2	2.8e-21
WP_154205233.1|1198429_1198570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151140366.1|1198566_1200534_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.7	7.5e-268
WP_032292401.1|1200530_1200860_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	71.4	2.1e-37
WP_032292400.1|1200856_1202041_+	phage protein	NA	F1BUK6	Cronobacter_phage	78.9	3.3e-178
WP_032292399.1|1202033_1202621_+	protein phage	NA	F1BUK5	Cronobacter_phage	86.2	6.6e-95
WP_032292398.1|1202630_1204208_+|tail	tail protein	tail	F1BUK3	Cronobacter_phage	80.7	2.7e-135
WP_064670485.1|1204207_1204795_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	56.0	3.6e-56
WP_064670484.1|1204784_1205510_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	51.9	3.6e-58
WP_032292395.1|1205481_1206027_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	1.6e-63
WP_032292425.1|1206029_1207730_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	79.3	3.7e-223
WP_162756338.1|1208761_1209865_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_000178456.1|1210092_1210434_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1210704_1211442_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079100.1|1211576_1212557_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040169.1|1212553_1213285_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_064670483.1|1213414_1215988_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.0e-127
WP_000841103.1|1221842_1223141_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|1223137_1223461_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1223506_1224862_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000083005.1|1224975_1227636_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001300438.1|1227667_1228366_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1228434_1228854_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1229060_1230098_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|1230145_1230835_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|1231139_1231523_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|1231578_1232166_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_053286107.1|1232268_1233150_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|1233358_1234693_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001295363.1|1234824_1235562_+|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
WP_001094491.1|1235546_1237169_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001303621.1|1237424_1237580_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001295364.1|1237576_1238152_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168459.1|1238184_1238835_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812053.1|1238834_1239791_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
1239083:1239099	attR	GGTACAGCGCGGCAATG	NA	NA	NA	NA
WP_000589068.1|1239787_1240267_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790168.1|1240464_1242264_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002541.1|1242279_1243254_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|1243525_1244206_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000020749.1|1244202_1245108_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399404.1|1245119_1245848_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_001297412.1|1245859_1246591_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986023.1|1246590_1246971_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000128776.1|1247391_1247472_+	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_001196283.1|1247665_1247926_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
WP_001013779.1|1247981_1248830_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190655.1|1249038_1249674_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001295367.1|1249698_1250235_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP050173	Escherichia coli strain STB20-1 chromosome, complete genome	4695656	1462813	1474838	4695656	plate,integrase	Enterobacteria_phage(57.14%)	15	1459705:1459721	1476848:1476864
1459705:1459721	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_151140423.1|1462813_1463332_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	64.8	1.7e-54
WP_089519078.1|1463375_1463954_-	HNH endonuclease	NA	K7PHS8	Enterobacteria_phage	99.0	1.2e-109
WP_001614322.1|1463940_1464117_-	DUF2737 family protein	NA	K7PL43	Enterobacteria_phage	100.0	3.7e-25
WP_000753555.1|1464133_1464448_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_000041317.1|1464459_1464942_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.8	1.4e-79
WP_064670570.1|1465221_1466301_+	hypothetical protein	NA	Q8SBG7	Shigella_phage	99.2	2.9e-205
WP_001259084.1|1466300_1466849_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_000424747.1|1466848_1467274_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	2.0e-80
WP_064670569.1|1467260_1468319_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	99.7	3.0e-202
WP_064670568.1|1468309_1468894_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	1.2e-112
WP_001349560.1|1469912_1470329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062896641.1|1470583_1471711_-	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	31.1	3.8e-30
WP_064670333.1|1472040_1472430_+	hypothetical protein	NA	K7P6F7	Enterobacteria_phage	87.5	4.6e-60
WP_064670332.1|1472436_1473594_-|integrase	prophage integrase IntS	integrase	Q716F9	Shigella_phage	98.2	1.0e-219
WP_000368140.1|1473905_1474838_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
1476848:1476864	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP050173	Escherichia coli strain STB20-1 chromosome, complete genome	4695656	1714922	1724363	4695656		Enterobacteria_phage(85.71%)	10	NA	NA
WP_064670440.1|1714922_1715849_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	31.1	2.2e-23
WP_000783120.1|1715853_1716585_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1716565_1716673_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1716732_1717464_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1717685_1719371_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1719367_1720087_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1720133_1720604_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1720643_1721105_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001402348.1|1721229_1723230_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_064670439.1|1723226_1724363_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	9.4e-162
>prophage 5
NZ_CP050173	Escherichia coli strain STB20-1 chromosome, complete genome	4695656	1816594	1824561	4695656		Klebsiella_phage(16.67%)	8	NA	NA
WP_064670358.1|1816594_1817989_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
WP_000999466.1|1818146_1819142_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_000183034.1|1819384_1820278_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	2.3e-46
WP_000699411.1|1820649_1821735_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	8.8e-101
WP_000676086.1|1821734_1822598_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	68.1	2.0e-111
WP_001025599.1|1822601_1822997_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_000971201.1|1822993_1823461_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000564888.1|1823457_1824561_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.1	8.0e-41
>prophage 6
NZ_CP050173	Escherichia coli strain STB20-1 chromosome, complete genome	4695656	1848700	1886316	4695656	terminase,portal,protease,head,lysis,holin,integrase,coat	Enterobacteria_phage(66.67%)	54	1842912:1842927	1868060:1868075
1842912:1842927	attL	ATTTGTAATGAACTGG	NA	NA	NA	NA
WP_151044111.1|1848700_1849879_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P7J2	Enterobacteria_phage	99.5	3.4e-231
WP_000132739.1|1849859_1850051_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_032320906.1|1850081_1850249_-	hypothetical protein	NA	K7P728	Enterobacteria_phage	94.5	1.4e-26
WP_122991675.1|1850321_1850606_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	98.9	4.1e-50
WP_151044108.1|1850598_1850817_-	hypothetical protein	NA	K7PKY3	Enterobacterial_phage	97.1	1.6e-33
WP_001276453.1|1850813_1850999_-	hypothetical protein	NA	K7PJY8	Enterobacterial_phage	100.0	4.6e-26
WP_151044106.1|1851001_1851772_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	66.7	4.2e-89
WP_032341732.1|1852144_1852369_-	hypothetical protein	NA	B8K1D2	Salmonella_phage	74.1	7.3e-18
WP_001214456.1|1852680_1852845_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_001111298.1|1852855_1853149_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	99.0	1.9e-50
WP_000168274.1|1853162_1853669_-	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	100.0	2.3e-80
WP_053880671.1|1853669_1854377_-	recombinase	NA	K7PKU3	Enterobacteria_phage	99.1	5.0e-137
WP_000050554.1|1854385_1854556_-	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_001243353.1|1854631_1854784_-	host cell division inhibitory peptide Kil	NA	K7P837	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|1854768_1854900_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_000005785.1|1854924_1855893_-	hypothetical protein	NA	G5DA88	Enterobacteria_phage	100.0	7.7e-56
WP_000392415.1|1856081_1856447_-	hypothetical protein	NA	A0A192Y658	Salmonella_phage	99.2	1.1e-58
WP_000394305.1|1856506_1856758_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	98.8	1.4e-41
WP_151140369.1|1856766_1857072_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	89.7	4.9e-25
WP_000233125.1|1857439_1857808_-	hypothetical protein	NA	K7P6G1	Enterobacteria_phage	99.2	1.3e-56
WP_000428318.1|1857825_1858542_-	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_000620665.1|1858648_1858843_+	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_000251073.1|1858951_1859245_+	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_000166956.1|1859277_1859439_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	98.1	1.7e-21
WP_151140370.1|1859425_1860316_+	DNA replication protein	NA	G5DA89	Enterobacteria_phage	99.3	6.4e-158
WP_151140371.1|1860305_1862771_+	helicase DnaB	NA	K7PGR8	Enterobacteria_phage	58.1	4.4e-233
WP_151140372.1|1862847_1863288_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.3	1.7e-79
WP_000984218.1|1863284_1863458_+	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000113772.1|1863424_1863601_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001363895.1|1863603_1863963_+	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	74.2	2.6e-41
WP_000950963.1|1863955_1864132_+	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_000144614.1|1864731_1864938_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_078204257.1|1864915_1865587_+	serine/threonine protein phosphatase	NA	K7P7K6	Enterobacteria_phage	98.2	7.3e-130
WP_000512808.1|1865577_1866096_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	98.8	4.5e-95
WP_015966862.1|1866693_1867017_+|holin	phage holin, lambda family	holin	K7PH31	Enterobacteria_phage	100.0	2.2e-52
WP_000229392.1|1867000_1867477_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_151140374.1|1867473_1867911_+|lysis	lysis protein	lysis	K7P7F7	Enterobacteria_phage	96.6	1.1e-70
WP_001139680.1|1867898_1868051_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_089583698.1|1868256_1868781_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.8	1.2e-87
1868060:1868075	attR	CCAGTTCATTACAAAT	NA	NA	NA	NA
WP_000807780.1|1869081_1869324_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	78.8	7.6e-29
WP_040090634.1|1869326_1869770_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	93.1	3.5e-64
WP_151140375.1|1869766_1871245_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	66.8	1.2e-180
WP_085455940.1|1871246_1873445_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.3	0.0e+00
WP_151140376.1|1873535_1874429_+	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	97.6	2.0e-127
WP_063119632.1|1874447_1875701_+|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	98.6	4.5e-234
WP_001389518.1|1875742_1875931_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_151140377.1|1875911_1876373_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	99.3	1.6e-83
WP_151140378.1|1876382_1877801_+	hypothetical protein	NA	Q716G7	Shigella_phage	98.7	3.0e-274
WP_142436681.1|1877800_1878649_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	1.9e-103
WP_151140379.1|1878648_1879104_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.0	4.4e-86
WP_137455329.1|1879106_1879799_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.1	3.9e-110
WP_069936398.1|1879808_1881215_+	phage DNA ejection protein	NA	I6RSG0	Salmonella_phage	55.8	1.4e-127
WP_151140380.1|1881214_1883056_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	74.1	1.3e-245
WP_104726698.1|1885284_1886316_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	29.9	9.1e-23
>prophage 7
NZ_CP050173	Escherichia coli strain STB20-1 chromosome, complete genome	4695656	1932037	1941958	4695656	transposase	Burkholderia_phage(33.33%)	10	NA	NA
WP_088895425.1|1932037_1933266_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_072134966.1|1933354_1934164_-	porin	NA	Q1MVN1	Enterobacteria_phage	50.3	8.1e-67
WP_001313057.1|1934729_1935095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365561.1|1935134_1935830_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001157230.1|1935896_1937315_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.7	3.0e-101
WP_000786004.1|1937295_1937766_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001507517.1|1937754_1938675_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|1938847_1939765_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009306.1|1939843_1940026_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001564714.1|1940263_1941958_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
>prophage 8
NZ_CP050173	Escherichia coli strain STB20-1 chromosome, complete genome	4695656	2316912	2332717	4695656	lysis	Salmonella_phage(25.0%)	15	NA	NA
WP_000041681.1|2316912_2319339_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	4.5e-214
WP_001300836.1|2319537_2319843_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2319950_2320661_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2320663_2321224_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2321258_2321600_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2321734_2322061_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2322266_2323481_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|2323492_2324512_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|2324569_2324698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876986.1|2324699_2325980_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_000005552.1|2326014_2326266_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_021570798.1|2326338_2328810_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	4.2e-58
WP_001083297.1|2328902_2329094_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2329090_2329279_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000527809.1|2331256_2332717_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
>prophage 9
NZ_CP050173	Escherichia coli strain STB20-1 chromosome, complete genome	4695656	3557968	3714009	4695656	transposase,portal,terminase,protease,capsid,head,tail,holin,plate,lysis,integrase	Shigella_phage(32.26%)	174	3586693:3586752	3699492:3700259
WP_088895425.1|3557968_3559197_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000983410.1|3559347_3560019_+	LysE family transporter	NA	NA	NA	NA	NA
WP_000290616.1|3560035_3560281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301260.1|3560693_3561509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000692754.1|3561751_3562801_-	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
WP_000665120.1|3563177_3564560_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_000661619.1|3564569_3565520_-	carbamate kinase family protein	NA	NA	NA	NA	NA
WP_001295687.1|3565595_3565892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000083429.1|3565941_3567360_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000111836.1|3567359_3568907_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_001310582.1|3568896_3569760_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_064670549.1|3569799_3570405_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001013892.1|3570662_3571160_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001084399.1|3571251_3572184_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301264.1|3572225_3573314_-	DNA-binding transcriptional activator/c-di-GMP phosphodiesterase PdeL	NA	NA	NA	NA	NA
WP_120795374.1|3574585_3574660_-	protein YahV	NA	NA	NA	NA	NA
WP_000131044.1|3574965_3576999_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3577127_3577715_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3577728_3579201_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3579214_3580885_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3581097_3581766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3582008_3582704_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_064670551.1|3582696_3584124_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3584134_3584854_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3585380_3586235_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
3586693:3586752	attL	GGTAGTGACTCCAACTTACTGATAGTGTTTTATGTTCAGATAATGCCCGATGACCTTGTC	NA	NA	NA	NA
WP_000474084.1|3588670_3588907_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3588918_3589512_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|3590101_3590953_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000662258.1|3595079_3595181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3595544_3595808_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3595807_3595948_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3595982_3596210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3597033_3597576_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3597650_3598238_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3598295_3598964_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|3598989_3601515_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|3601504_3603148_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3603116_3603827_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3604139_3604469_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3604716_3605331_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|3605748_3606438_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3606434_3607391_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_053286015.1|3607387_3609586_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	26.1	1.9e-38
WP_000121359.1|3609595_3610552_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3610530_3610941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064670530.1|3611509_3612526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064670529.1|3612986_3614219_+	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	99.3	4.3e-237
WP_064670528.1|3614347_3614932_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	4.3e-102
WP_151140399.1|3614931_3618282_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000453558.1|3618854_3619400_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_000025003.1|3619737_3620058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085438473.1|3620438_3620882_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	82.8	7.3e-62
WP_000186784.1|3621402_3622083_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.7	2.3e-131
WP_072126246.1|3622079_3622262_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_000548531.1|3622234_3622426_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|3622436_3622718_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_085438467.1|3622816_3623035_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	97.2	1.4e-34
WP_000488407.1|3623082_3623361_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_053271768.1|3623559_3624723_+|integrase	site-specific integrase	integrase	S5FNS2	Shigella_phage	99.7	9.1e-229
WP_085438561.1|3625225_3625378_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	86.2	3.9e-07
WP_085438563.1|3625973_3627056_+	acyltransferase	NA	W6MVL2	Pseudomonas_phage	22.9	4.0e-05
WP_021548946.1|3627101_3627266_-	hypothetical protein	NA	A0A077KCA4	Edwardsiella_phage	64.5	2.1e-06
WP_136710480.1|3627276_3627693_-|tail	tail assembly chaperone	tail	A0A077KAY3	Edwardsiella_phage	55.3	4.5e-13
WP_064670553.1|3628695_3629034_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	93.4	3.6e-53
WP_000774473.1|3629030_3629321_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.1e-47
WP_000211034.1|3629313_3629484_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_064670554.1|3629483_3629939_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.8e-60
WP_072097297.1|3629935_3630037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074400827.1|3630131_3630914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064670555.1|3631088_3631412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709067.1|3631523_3633050_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	7.9e-31
WP_001301135.1|3633107_3633257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|3633305_3633638_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3633705_3634008_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788886.1|3634004_3634706_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	99.6	9.9e-130
WP_064670557.1|3634702_3635632_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	1.6e-111
WP_064670556.1|3635718_3636258_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	5.8e-61
WP_000184665.1|3636288_3636516_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001295669.1|3636626_3637319_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000380252.1|3637399_3638461_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|3638438_3638816_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000233576.1|3639291_3639498_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_033561765.1|3639573_3639870_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_074400828.1|3639875_3640703_+	phage recombination protein Bet	NA	A0A0P0ZDB4	Stx2-converting_phage	87.6	4.0e-114
WP_024220864.1|3641480_3642275_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000218773.1|3642356_3642710_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_029380176.1|3642993_3643275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071840188.1|3644225_3644483_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_000470135.1|3644537_3646283_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_000926290.1|3646251_3646500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082070.1|3646471_3647452_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_000784327.1|3648144_3649284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072161528.1|3649837_3651052_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_094304446.1|3651086_3652520_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	49.9	5.4e-106
WP_000355484.1|3652923_3653697_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_151140400.1|3653757_3654312_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.7	5.3e-86
WP_001008234.1|3654771_3655215_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_151140401.1|3655186_3655789_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	92.5	1.7e-101
WP_151140402.1|3655788_3656511_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	93.5	1.6e-50
WP_063073499.1|3656514_3657099_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	2.0e-112
WP_028125900.1|3657089_3658148_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.9	1.2e-200
WP_000424744.1|3658134_3658560_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	3.9e-81
WP_052921837.1|3658559_3659108_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	2.5e-96
WP_063073500.1|3659107_3660187_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.2	3.4e-206
WP_063073501.1|3660183_3661512_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_040072272.1|3661565_3662243_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	45.6	6.6e-46
WP_063073503.1|3662324_3664106_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	91.8	9.8e-275
WP_001314907.1|3664098_3664281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661054.1|3664247_3664517_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090998.1|3664516_3664873_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_151140403.1|3664872_3666369_-|tail	phage tail protein	tail	U5P0H3	Shigella_phage	98.4	1.4e-274
WP_063073505.1|3666352_3666523_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	7.9e-25
WP_000779292.1|3666531_3667092_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000224836.1|3667088_3667595_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702401.1|3667569_3667980_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.9	8.0e-71
WP_000927711.1|3667976_3668300_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|3668302_3668503_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_063073507.1|3668552_3669758_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	1.3e-222
WP_001193640.1|3669772_3670423_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	5.6e-119
WP_000466255.1|3670400_3671642_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605605.1|3671641_3671824_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
WP_072011717.1|3671835_3673332_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_063073508.1|3673570_3674056_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	98.8	1.4e-85
WP_001135220.1|3674181_3674532_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	95.7	1.2e-62
WP_000738423.1|3675056_3675350_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_123010240.1|3675440_3675623_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	95.0	2.1e-15
WP_001197766.1|3675839_3676316_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120496.1|3676319_3676646_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_001532221.1|3676964_3678062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021552536.1|3678072_3678495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073510.1|3678487_3679123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021552535.1|3679098_3679485_-	hypothetical protein	NA	A5LH77	Enterobacteria_phage	90.0	6.8e-56
WP_021552534.1|3679503_3680493_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	6.2e-194
WP_001061445.1|3680500_3681310_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	4.0e-151
WP_000767103.1|3681329_3681719_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_061356387.1|3681715_3682042_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	2.9e-52
WP_074149693.1|3682041_3682536_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	8.1e-86
WP_061356389.1|3682532_3683474_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.4	5.0e-153
WP_001250269.1|3683463_3683643_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_063073513.1|3683818_3684376_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	2.6e-96
WP_000649477.1|3684419_3684620_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|3684710_3685385_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000549626.1|3685619_3685826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|3685797_3686232_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000008236.1|3686776_3687313_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242749.1|3687303_3687666_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|3687665_3687971_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|3688197_3689361_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893278.1|3689565_3690819_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|3690830_3691934_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3692221_3693277_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_000174677.1|3693315_3693717_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|3693774_3695019_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3695110_3695569_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293003.1|3695829_3697287_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001353768.1|3697343_3697901_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001321003.1|3697812_3698079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059847.1|3698312_3698765_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263493.1|3699551_3699950_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|3699952_3700246_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|3700297_3701353_-	DNA polymerase IV	NA	NA	NA	NA	NA
3699492:3700259	attR	GACAAGGTCATCGGGCATTATCTGAACATAAAACACTATCAGTAAGTTGGAGTCACTACCTCAAAAACGCATGCGAAACGCTTCTGCCATTTTCCCAATTTTATGCATTTGGTTGTTATCTCGAGCCTGTTTATGAGGTTCAGGTTTCAGAATGGCAATGAGCAACCATGCTTGCTCATCAAACGCACCCTGACAATATACCAAATGCGCTTCGTCATTCGTTCTGCTGAATTGGCGCAACTGTGGCGGAAATGGATTATTCACATTTGCCAGATGAATATGAGCAACTCGCTCAAATTTGATTAATGGCCAGGTAAACGAGTCGTCGTAGAGTGCATCGCGACCAAATATATCTGGCAAAACACCGTCACGCTTATAGGAAATAAAATCCGCCGTTAACGCATCAAGTTCCTCTGCTGTAAGTTGCAGGCGAATAAGTTTTGTTTTGAATACCCGCATCCTTATTCCTTAAAGTCATTGAAATCATCATCCGTCATATCATTAAGATATTTTTCAGCTCGGCGTGTAATTTCCTCTAATCTTGCAGCACTTGGACGGAAGCGCGCCTTTATGGGCTTTTTCTCCTCTTGTTCAGCAAGCATGTCCATTAACGCTTCGAATGCGCTGGCACTTAAGAGATATCCTGCGGGGCGATTATTAGAAAGAACCGCAACCGGTTGATCAATAAAGTATTTAGCTGGGTTTTTACGTAACTCAGTAATATTGACCGATTTTTCAGCGAGAATTCGATGCATGCAGTGATCCCCT	NA	NA	NA	NA
WP_000207587.1|3701423_3702209_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|3702153_3703893_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|3704116_3704614_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_024192679.1|3704789_3705539_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000729703.1|3705748_3706009_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615983.1|3706011_3706290_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3706445_3707186_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|3707156_3707924_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3708129_3708708_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|3708947_3711392_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|3711434_3711908_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118036.1|3712061_3712832_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_032227780.1|3712872_3714009_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP050174	Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence	97366	1204	62310	97366	transposase,integrase	Escherichia_phage(30.43%)	58	NA	NA
WP_077816224.1|1204_2173_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	5.7e-184
WP_001471781.1|2339_2630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039462.1|3347_3683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515192.1|3691_3883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|5012_5768_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_161955224.1|6444_6579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160784086.1|6900_7041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|7135_7840_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000429836.1|8837_9272_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|9343_9694_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|9707_9983_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|10018_10441_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|10492_12187_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001067855.1|12459_13164_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032492336.1|13291_14521_+	macrolide efflux MFS transporter Mef(B)	NA	A0A1B0RXG2	Streptococcus_phage	39.0	2.1e-74
WP_054377175.1|14666_15530_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|15567_15813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|16283_17075_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_109023896.1|17077_17353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|18433_19138_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000845048.1|19283_20297_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001317507.1|20452_20926_+	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
WP_001067858.1|21254_21959_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_077250842.1|22038_22869_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_164538590.1|23096_23234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151140429.1|23599_24496_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_164538593.1|24506_25643_+	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_001120888.1|25981_27475_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|27505_28390_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_034167813.1|28606_29821_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.6	1.5e-19
WP_001255015.1|29848_30154_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|30972_31677_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000844627.1|32301_32544_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001493764.1|32575_33226_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_001493765.1|33331_34531_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|34562_35447_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|35584_35977_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001143760.1|36777_39783_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_000027057.1|40689_41550_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_077141251.1|41661_42156_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_136655701.1|43213_43444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025989258.1|43739_45659_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A2K5B2A5	Erysipelothrix_phage	96.4	0.0e+00
WP_001067845.1|47144_47849_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_001516695.1|48009_48666_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001067858.1|49367_50072_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000105383.1|50338_51775_+	glutathione synthase	NA	NA	NA	NA	NA
WP_053273090.1|52831_53266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000565612.1|53246_53330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203396.1|53484_54129_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	28.3	3.4e-07
WP_166690414.1|54517_55171_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.1	5.8e-07
WP_001505429.1|55389_55551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024245156.1|55575_56553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000456533.1|56549_56906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001050931.1|57532_58369_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000121743.1|59607_59859_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000220560.1|59848_60130_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	3.8e-24
WP_105278499.1|61047_61305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077783444.1|61341_62310_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	8.5e-172
