The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044352	Xylella fastidiosa strain ATCC 35879 chromosome, complete genome	2565504	419978	468667	2565504	capsid,protease,tail,integrase,portal,plate	Xylella_phage(23.81%)	55	450563:450577	475930:475944
WP_004089328.1|419978_421313_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_004089326.1|421339_422524_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_004089324.1|422526_423381_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011097592.1|423377_424145_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	34.8	9.5e-17
WP_004089320.1|424147_424705_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_004089318.1|425458_426802_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_004089316.1|427033_427714_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004089314.1|427832_428153_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_011097594.1|429033_429258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004089310.1|429365_430097_-	UMP kinase	NA	NA	NA	NA	NA
WP_155115092.1|430407_430551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004089308.1|430571_430796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004089306.1|431498_432158_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_038232799.1|432270_434163_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011097597.1|434303_435023_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_004089300.1|435019_436033_-	glucokinase	NA	NA	NA	NA	NA
WP_004089298.1|436029_437463_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.4	2.6e-68
WP_011097599.1|437791_438886_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.4	5.5e-26
WP_004089294.1|439030_439834_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011097601.1|440148_440367_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_004089288.1|440424_440820_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004089286.1|440816_441200_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_004089284.1|441207_442998_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_004089282.1|443018_443804_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004089280.1|443924_444173_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_011097604.1|444195_444576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004089276.1|444601_445843_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004089270.1|445835_446558_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	37.2	7.3e-35
WP_038231910.1|446905_449383_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	34.3	1.4e-05
WP_004085189.1|449367_450030_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_004089267.1|450034_450472_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_004089264.1|450489_452238_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	29.4	3.9e-50
450563:450577	attL	TTGTTGCTGCATGTG	NA	NA	NA	NA
WP_004089261.1|452234_453254_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_159241593.1|454279_455251_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	47.5	1.8e-65
WP_011097610.1|455258_455816_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.4	1.1e-51
WP_011097611.1|455808_456702_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	46.4	1.9e-69
WP_004090694.1|456701_457040_-|plate	phage baseplate protein	plate	A0A088FV58	Escherichia_phage	61.3	5.4e-33
WP_004090695.1|457237_457519_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	46.2	2.5e-15
WP_004085172.1|457529_457805_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_004090696.1|457892_458195_+	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_004090697.1|458197_458599_+	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_011097612.1|458667_459255_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_011097613.1|459251_459794_-	hypothetical protein	NA	A0A1W6JT55	Escherichia_phage	41.6	2.9e-36
WP_011097614.1|459769_460291_-	hypothetical protein	NA	D5LGZ7	Escherichia_phage	34.3	3.7e-12
WP_011097935.1|460287_460611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159241635.1|460588_460870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038232803.1|460887_462762_-|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	47.5	2.1e-158
WP_038232805.1|462745_463390_-|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	51.1	1.6e-46
WP_080502611.1|463344_463905_+	hypothetical protein	NA	C8CLG0	Xylella_phage	91.7	1.5e-91
WP_011097620.1|463901_464180_+	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	98.9	1.0e-45
WP_011097621.1|464181_464490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011097622.1|464574_465993_+	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	99.8	4.4e-278
WP_011097623.1|465989_466244_+	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	81.2	2.2e-31
WP_011097624.1|466233_467253_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	90.6	6.2e-173
WP_011097625.1|468025_468667_+	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	39.7	9.1e-13
475930:475944	attR	TTGTTGCTGCATGTG	NA	NA	NA	NA
>prophage 2
NZ_CP044352	Xylella fastidiosa strain ATCC 35879 chromosome, complete genome	2565504	764001	778123	2565504	integrase	Xylella_phage(76.92%)	15	756357:756371	768739:768753
756357:756371	attL	AGTCGCGTTGGTGGG	NA	NA	NA	NA
WP_038232855.1|764001_766944_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.5	3.2e-262
WP_004090681.1|767507_768569_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	56.9	3.0e-101
WP_004090683.1|768580_768817_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	54.4	6.5e-09
768739:768753	attR	AGTCGCGTTGGTGGG	NA	NA	NA	NA
WP_167405106.1|768813_770208_-	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	98.3	3.5e-267
WP_167405107.1|770292_770688_+	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_011097962.1|770689_770968_-	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	100.0	1.6e-46
WP_011097961.1|770964_773145_-	DNA polymerase	NA	C8CLG0	Xylella_phage	99.9	0.0e+00
WP_012382638.1|773146_774754_-	hypothetical protein	NA	C8CLG1	Xylella_phage	71.0	1.2e-186
WP_004090881.1|774744_775311_-	DUF2815 family protein	NA	C8CLG2	Xylella_phage	97.3	8.3e-103
WP_012382637.1|775310_776588_-	DUF2800 domain-containing protein	NA	C8CLG3	Xylella_phage	94.6	6.7e-233
WP_038232209.1|776584_777103_-	hypothetical protein	NA	C8CLG4	Xylella_phage	71.5	4.7e-36
WP_004090711.1|777089_777287_-	hypothetical protein	NA	C8CLG5	Xylella_phage	92.2	7.0e-25
WP_012382635.1|777318_777510_-	hypothetical protein	NA	C8CLG6	Xylella_phage	78.1	8.1e-18
WP_004087232.1|777533_777725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004087234.1|777721_778123_-	hypothetical protein	NA	C8CLG7	Xylella_phage	95.5	5.2e-67
>prophage 3
NZ_CP044352	Xylella fastidiosa strain ATCC 35879 chromosome, complete genome	2565504	1223913	1229744	2565504		Xylella_phage(33.33%)	10	NA	NA
WP_080513037.1|1223913_1224213_+	hypothetical protein	NA	C8CLG1	Xylella_phage	80.8	1.3e-41
WP_012382665.1|1224209_1225316_+	YdaU family protein	NA	A0A0R6PKK6	Moraxella_phage	48.4	1.2e-17
WP_011098061.1|1225296_1225986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004090687.1|1226033_1226444_+	hypothetical protein	NA	A0A088F6Y8	Sulfitobacter_phage	43.9	8.4e-12
WP_011098059.1|1226572_1227271_+	hypothetical protein	NA	C8CLH7	Xylella_phage	79.6	5.8e-98
WP_004089517.1|1227323_1227578_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_004085025.1|1227574_1227910_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_004089519.1|1228089_1228389_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	45.9	1.1e-13
WP_011098058.1|1228398_1228680_-	excinuclease ABC subunit A	NA	NA	NA	NA	NA
WP_011098057.1|1229030_1229744_+	site-specific DNA-methyltransferase	NA	A0A2P1CGF5	Mycobacterium_phage	52.3	7.9e-58
>prophage 4
NZ_CP044352	Xylella fastidiosa strain ATCC 35879 chromosome, complete genome	2565504	1406556	1415265	2565504	integrase	Xylella_phage(75.0%)	9	1402500:1402513	1412757:1412770
1402500:1402513	attL	ACCAGTGGCCGAAG	NA	NA	NA	NA
WP_038233183.1|1406556_1408938_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	29.1	3.2e-10
WP_004088646.1|1409099_1411037_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.3	1.2e-68
WP_011097994.1|1411103_1412123_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	92.3	3.7e-178
WP_011097965.1|1412112_1412370_-	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	87.1	4.7e-37
WP_012382647.1|1412362_1412527_-	hypothetical protein	NA	C8CLF6	Xylella_phage	92.6	5.7e-20
WP_011097622.1|1412523_1413942_-	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	99.8	4.4e-278
1412757:1412770	attR	ACCAGTGGCCGAAG	NA	NA	NA	NA
WP_012382646.1|1414026_1414389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011097962.1|1414390_1414669_-	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	100.0	1.6e-46
WP_080502629.1|1414665_1415265_-	hypothetical protein	NA	C8CLG0	Xylella_phage	97.5	5.5e-113
>prophage 5
NZ_CP044352	Xylella fastidiosa strain ATCC 35879 chromosome, complete genome	2565504	1418847	1427649	2565504	tail	Aggregatibacter_phage(25.0%)	12	NA	NA
WP_160176379.1|1418847_1420242_+	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	34.6	7.8e-17
WP_004091355.1|1420300_1420582_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	51.4	8.8e-13
WP_004091353.1|1420578_1420905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004090769.1|1420962_1421733_+	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	34.8	2.9e-29
WP_011097873.1|1421732_1422050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004090766.1|1422046_1422877_+	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	51.1	2.0e-76
WP_004090764.1|1422873_1423515_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	37.3	1.1e-31
WP_011097872.1|1423511_1423865_+	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	49.6	8.2e-24
WP_011097871.1|1424002_1424242_+	antitoxin	NA	NA	NA	NA	NA
WP_004089386.1|1424250_1424559_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_014607744.1|1425840_1426401_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	26.1	8.5e-07
WP_038233088.1|1426404_1427649_+|tail	tail fiber protein	tail	A4PE46	Ralstonia_virus	32.7	1.5e-08
>prophage 6
NZ_CP044352	Xylella fastidiosa strain ATCC 35879 chromosome, complete genome	2565504	1472577	1565123	2565504	capsid,protease,tail,integrase,plate,terminase,tRNA	Xylella_phage(40.0%)	102	1470716:1470731	1482619:1482634
1470716:1470731	attL	CGTAGTGCGCGCGGCG	NA	NA	NA	NA
WP_011097966.1|1472577_1473597_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	90.3	1.8e-172
WP_011097965.1|1473586_1473844_-	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	87.1	4.7e-37
WP_012382640.1|1473836_1474001_-	hypothetical protein	NA	C8CLF6	Xylella_phage	88.9	1.1e-18
WP_038233072.1|1473997_1475416_-	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	98.7	7.8e-275
WP_012382639.1|1475500_1475947_+	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_011097962.1|1475948_1476227_-	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	100.0	1.6e-46
WP_011097961.1|1476223_1478404_-	DNA polymerase	NA	C8CLG0	Xylella_phage	99.9	0.0e+00
WP_012382638.1|1478405_1480013_-	hypothetical protein	NA	C8CLG1	Xylella_phage	71.0	1.2e-186
WP_004090881.1|1480003_1480570_-	DUF2815 family protein	NA	C8CLG2	Xylella_phage	97.3	8.3e-103
WP_012382637.1|1480569_1481847_-	DUF2800 domain-containing protein	NA	C8CLG3	Xylella_phage	94.6	6.7e-233
WP_038232209.1|1481843_1482362_-	hypothetical protein	NA	C8CLG4	Xylella_phage	71.5	4.7e-36
WP_004090711.1|1482348_1482546_-	hypothetical protein	NA	C8CLG5	Xylella_phage	92.2	7.0e-25
WP_012382635.1|1482577_1482769_-	hypothetical protein	NA	C8CLG6	Xylella_phage	78.1	8.1e-18
1482619:1482634	attR	CGTAGTGCGCGCGGCG	NA	NA	NA	NA
WP_004086365.1|1482792_1482984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128712492.1|1482980_1483382_-	hypothetical protein	NA	C8CLG7	Xylella_phage	68.4	3.0e-46
WP_072866409.1|1483381_1483843_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_128712491.1|1484968_1485208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072866408.1|1485338_1485935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085133.1|1485968_1486739_-	helix-turn-helix transcriptional regulator	NA	C8CLH0	Xylella_phage	40.7	5.6e-33
WP_057683780.1|1486812_1487013_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_004091234.1|1487009_1487315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085135.1|1487367_1487556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128712489.1|1487552_1487801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128712488.1|1487797_1488082_+	hypothetical protein	NA	C8CLH4	Xylella_phage	64.8	1.2e-22
WP_167405112.1|1488078_1488723_+	hypothetical protein	NA	C8CLH4	Xylella_phage	53.1	2.5e-47
WP_128712481.1|1489102_1489489_+	phage antirepressor protein	NA	C8CLH4	Xylella_phage	78.7	1.2e-49
WP_128712493.1|1489485_1490094_+	hypothetical protein	NA	C8CLH5	Xylella_phage	54.9	7.0e-47
WP_072866400.1|1490229_1492776_+	DNA primase	NA	C8CLH6	Xylella_phage	97.6	0.0e+00
WP_128712495.1|1493074_1493278_+	hypothetical protein	NA	C8CLH6	Xylella_phage	77.4	7.8e-19
WP_038233051.1|1493562_1494180_+	hypothetical protein	NA	V5YTF6	Pseudomonas_phage	52.2	4.0e-26
WP_072866401.1|1494146_1494641_+	lysozyme	NA	I2GUG4	Acinetobacter_phage	52.1	1.1e-26
WP_011097940.1|1494651_1494963_+	hypothetical protein	NA	A0A172PZR6	Pseudomonas_phage	44.0	7.0e-19
WP_038233047.1|1494952_1495414_+	hypothetical protein	NA	A0A0S0N8C8	Pseudomonas_phage	32.6	3.0e-10
WP_167405113.1|1495415_1495640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050765457.1|1495811_1496345_+	DNA-packaging protein	NA	A0A193GYK5	Enterobacter_phage	58.6	4.0e-46
WP_128712497.1|1496337_1498290_+|terminase	phage terminase large subunit family protein	terminase	A0A088FQV3	Escherichia_phage	66.5	3.5e-249
WP_038233040.1|1498293_1498845_+	hypothetical protein	NA	V5YTG8	Pseudomonas_phage	51.7	1.7e-39
WP_038232803.1|1500422_1502297_+|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	47.5	2.1e-158
WP_159241635.1|1502314_1502596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011097935.1|1502573_1502897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011097614.1|1502893_1503415_+	hypothetical protein	NA	D5LGZ7	Escherichia_phage	34.3	3.7e-12
WP_011097613.1|1503390_1503933_+	hypothetical protein	NA	A0A1W6JT55	Escherichia_phage	41.6	2.9e-36
WP_167405114.1|1503929_1504517_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_004087025.1|1504521_1504821_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	49.4	1.2e-15
WP_004087027.1|1504832_1505114_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_004087029.1|1505115_1505430_-	hypothetical protein	NA	O64357	Escherichia_phage	30.4	1.6e-07
WP_004088650.1|1505563_1505902_+|plate	phage baseplate protein	plate	A0A088FV58	Escherichia_phage	61.3	2.4e-33
WP_011097610.1|1506786_1507344_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.4	1.1e-51
WP_011097931.1|1509007_1510186_+|tail	phage tail sheath family protein	tail	A0A088FVH5	Escherichia_phage	56.1	8.3e-137
WP_004086986.1|1510185_1510695_+|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	52.7	5.3e-48
WP_011097930.1|1510697_1510985_+|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	44.6	3.1e-13
WP_011097928.1|1513326_1513809_+|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	46.8	2.6e-28
WP_004088371.1|1513805_1514024_+|tail	tail protein	tail	A0A1W6JT40	Escherichia_phage	51.4	2.1e-14
WP_038233030.1|1514014_1515097_+	phage late control D family protein	NA	A0A088FRU7	Escherichia_phage	47.2	4.8e-91
WP_004089237.1|1515392_1515734_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_004089235.1|1515733_1516342_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_004083794.1|1516347_1518345_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011097726.1|1518338_1519298_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004083792.1|1519766_1520768_-	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_004089231.1|1521018_1521513_+	single-stranded DNA-binding protein	NA	A0A0U1VYM4	Pseudomonas_phage	62.6	1.0e-32
WP_014607674.1|1521788_1521953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004089229.1|1523161_1524073_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024749296.1|1524385_1525582_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_004089226.1|1525742_1526270_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_011097727.1|1527846_1529574_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_004089222.1|1529634_1529904_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_004083781.1|1529896_1530289_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_004089221.1|1530661_1531534_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	33.0	7.0e-08
WP_004083779.1|1531530_1532481_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_004083778.1|1532746_1533064_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_004089220.1|1533154_1534543_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004089219.1|1534584_1535307_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.2	2.8e-26
WP_004089217.1|1535306_1535837_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_004089215.1|1535814_1536384_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_004089213.1|1536380_1536929_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011097728.1|1536946_1537948_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	35.3	2.8e-37
WP_004089208.1|1538009_1538237_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004089202.1|1538306_1539584_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_011097729.1|1539580_1539883_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_004089198.1|1539892_1540468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012382514.1|1540723_1541608_+	acetyltransferase	NA	NA	NA	NA	NA
WP_012382515.1|1541609_1541981_+	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	56.4	1.0e-08
WP_004089192.1|1542084_1542324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011097732.1|1542324_1546293_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	55.5	2.5e-121
WP_011097733.1|1546489_1547278_-	DsbC family protein	NA	NA	NA	NA	NA
WP_004089178.1|1547409_1548384_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	1.5e-30
WP_004089176.1|1548641_1549535_-	ion transporter	NA	NA	NA	NA	NA
WP_004089174.1|1549602_1550838_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	24.6	1.2e-21
WP_004089170.1|1551236_1552601_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011097734.1|1552820_1553432_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_027699997.1|1554062_1554296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038232892.1|1554391_1555327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004089161.1|1556178_1556826_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_004089159.1|1556917_1557700_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_012382517.1|1557715_1558486_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_004089149.1|1558593_1559208_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_011097736.1|1559204_1560344_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004083752.1|1560340_1560799_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004083751.1|1560978_1561299_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.0	4.2e-11
WP_004089140.1|1561431_1563708_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.8	1.1e-169
WP_004083749.1|1564056_1564275_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004089137.1|1564391_1565123_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP044352	Xylella fastidiosa strain ATCC 35879 chromosome, complete genome	2565504	1870139	1876196	2565504		Stenotrophomonas_phage(50.0%)	9	NA	NA
WP_041581123.1|1870139_1871315_+	replication initiation factor	NA	S0F3F7	Stenotrophomonas_phage	45.8	8.7e-78
WP_011097842.1|1871359_1871671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038232929.1|1871682_1871886_+	hypothetical protein	NA	S0F2M5	Stenotrophomonas_phage	61.7	2.1e-16
WP_011097854.1|1871882_1872128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038232932.1|1872186_1873713_+	hypothetical protein	NA	A0A1W6DXV5	Xanthomonas_phage	48.7	2.5e-45
WP_011097845.1|1873718_1874090_+	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	45.0	6.8e-21
WP_038232934.1|1874094_1875249_+	filamentous phage Cf1c related protein	NA	S0F3F8	Stenotrophomonas_phage	56.7	2.4e-112
WP_011097847.1|1875477_1875789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011097848.1|1875848_1876196_-	hypothetical protein	NA	Q38057	Xanthomonas_phage	46.9	2.6e-06
>prophage 8
NZ_CP044352	Xylella fastidiosa strain ATCC 35879 chromosome, complete genome	2565504	1903205	1943915	2565504	terminase,tail,integrase,head	Xylella_phage(17.5%)	64	1893423:1893450	1946564:1946591
1893423:1893450	attL	TCAGAAAACGGAAAATAAAGCACGCTAA	NA	NA	NA	NA
WP_038232954.1|1903205_1904369_-|tail	tail fiber protein	tail	A4PE46	Ralstonia_virus	32.7	1.4e-08
WP_014607744.1|1904372_1904933_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	26.1	8.5e-07
WP_004089252.1|1906163_1906460_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	58.1	3.3e-26
WP_004089254.1|1906463_1906769_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.6	1.1e-11
WP_011097986.1|1906779_1907133_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	49.6	8.2e-24
WP_004090764.1|1907129_1907771_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	37.3	1.1e-31
WP_004090766.1|1907767_1908598_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	51.1	2.0e-76
WP_011097873.1|1908594_1908912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004090769.1|1908911_1909682_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	34.8	2.9e-29
WP_004091377.1|1909792_1910020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011097988.1|1910003_1910270_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SB46	Streptococcus_phage	43.9	3.4e-14
WP_011097989.1|1910280_1912170_-	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	27.7	7.5e-23
WP_162849007.1|1912126_1912291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012382587.1|1912317_1912740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038232978.1|1913182_1914679_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	48.0	2.7e-124
WP_012382589.1|1914679_1915156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004090296.1|1915136_1915505_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	39.3	7.5e-20
WP_004090295.1|1915491_1915971_-	hypothetical protein	NA	M4SN98	Psychrobacter_phage	28.7	3.5e-09
WP_004090294.1|1915967_1916336_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	38.1	2.2e-11
WP_011097882.1|1916335_1916689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004090291.1|1916752_1917736_-	DUF2184 domain-containing protein	NA	A0A2R3UA82	Siphoviridae_environmental_samples	39.1	1.1e-49
WP_004090290.1|1917745_1918228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004090289.1|1918237_1919446_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	41.7	2.5e-40
WP_004090288.1|1919445_1920291_-|head	phage head morphogenesis protein	head	Q7Y5U5	Haemophilus_phage	34.2	1.7e-30
WP_011097884.1|1920359_1920698_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004090283.1|1920694_1920976_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	45.2	6.8e-13
WP_072866383.1|1921024_1922329_-	DUF1073 domain-containing protein	NA	A0A291LBE2	Klebsiella_phage	36.1	2.1e-64
WP_004090279.1|1922409_1923960_-|terminase	phage terminase large subunit	terminase	H9C0C7	Vibrio_phage	44.7	2.4e-112
WP_004090276.1|1923949_1924309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038233055.1|1924400_1924637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011097892.1|1924614_1925076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011097893.1|1925065_1925395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004089579.1|1925387_1925885_-	lysozyme	NA	A0A2P9FI97	Pseudomonas_phage	60.3	1.6e-28
WP_004089578.1|1926088_1926427_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	54.9	1.0e-07
WP_004089577.1|1926413_1926680_-	hypothetical protein	NA	K4NX81	Burkholderia_phage	40.7	1.8e-07
WP_011097895.1|1926868_1927567_-	hypothetical protein	NA	C8CLH7	Xylella_phage	80.0	2.0e-98
WP_004090687.1|1927695_1928106_-	hypothetical protein	NA	A0A088F6Y8	Sulfitobacter_phage	43.9	8.4e-12
WP_011098061.1|1928153_1928843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012382597.1|1928823_1929711_-	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	44.0	2.0e-18
WP_011097897.1|1929707_1930496_-	hypothetical protein	NA	C8CLG1	Xylella_phage	84.1	3.7e-117
WP_004088094.1|1930492_1931125_-	phage antirepressor	NA	Q8HA44	Vibrio_phage	48.1	7.6e-20
WP_004088096.1|1931121_1931406_-	hypothetical protein	NA	C8CLH4	Xylella_phage	65.9	4.3e-23
WP_011097898.1|1931402_1931651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004088102.1|1931647_1931836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004088104.1|1931863_1932055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004088108.1|1932313_1932559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004088110.1|1932643_1933318_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	33.0	1.2e-18
WP_004088112.1|1933368_1933980_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_004088114.1|1933976_1934165_-	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_038233020.1|1934556_1935093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004088056.1|1935089_1935503_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_004088054.1|1935499_1935901_+	hypothetical protein	NA	C8CLG7	Xylella_phage	97.7	3.6e-68
WP_012382602.1|1935897_1936047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004088050.1|1936132_1936411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012382603.1|1936433_1936625_+	hypothetical protein	NA	C8CLG6	Xylella_phage	75.0	1.2e-16
WP_004088346.1|1936645_1936990_+	hypothetical protein	NA	U5P4J6	Shigella_phage	46.5	6.1e-16
WP_004088345.1|1937029_1937851_+	DUF2303 family protein	NA	K7ZMK3	Xanthomonas_citri_phage	43.1	2.3e-53
WP_004088344.1|1937866_1938793_+	phage recombination protein Bet	NA	U6C6J0	Ralstonia_phage	48.1	5.1e-57
WP_004088343.1|1938789_1940442_+	hypothetical protein	NA	U6C712	Ralstonia_phage	39.3	7.4e-91
WP_011097903.1|1940470_1941235_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_004088341.1|1941495_1942116_+	phage antirepressor	NA	A4PE61	Ralstonia_virus	44.6	1.8e-18
WP_004088340.1|1942182_1942629_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	52.3	7.2e-33
WP_011097904.1|1942647_1942896_+	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	91.5	3.5e-37
WP_011097905.1|1942895_1943915_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	97.3	4.7e-189
1946564:1946591	attR	TCAGAAAACGGAAAATAAAGCACGCTAA	NA	NA	NA	NA
>prophage 9
NZ_CP044352	Xylella fastidiosa strain ATCC 35879 chromosome, complete genome	2565504	2002132	2062352	2565504	capsid,tail,integrase,portal,plate	Xylella_phage(40.0%)	71	1994168:1994183	2068698:2068713
1994168:1994183	attL	CAACACCAACGCCGAT	NA	NA	NA	NA
WP_011097922.1|2002132_2003326_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.4	5.1e-118
WP_011097923.1|2003325_2003598_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	51.7	2.2e-08
WP_012382613.1|2004041_2004200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004087359.1|2004666_2005209_-	pilin	NA	NA	NA	NA	NA
WP_004087360.1|2005619_2005832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004087362.1|2006237_2007023_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004087363.1|2007059_2009666_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.5	4.8e-28
WP_012382616.1|2010098_2010830_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_004087365.1|2010909_2011770_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_014607779.1|2011923_2012793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004084923.1|2013565_2013910_-	RidA family protein	NA	NA	NA	NA	NA
WP_004088648.1|2014112_2014445_-	DNA-binding transcriptional regulator	NA	A0A0P0IRJ4	Acinetobacter_phage	39.8	5.4e-17
WP_014607781.1|2014636_2015719_-	phage late control D family protein	NA	A0A088FRU7	Escherichia_phage	45.3	1.3e-91
WP_004088371.1|2015709_2015928_-|tail	tail protein	tail	A0A1W6JT40	Escherichia_phage	51.4	2.1e-14
WP_011097928.1|2015924_2016407_-|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	46.8	2.6e-28
WP_128723197.1|2016403_2018623_-|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	45.7	4.7e-101
WP_011097930.1|2018749_2019037_-|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	44.6	3.1e-13
WP_004086986.1|2019039_2019549_-|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	52.7	5.3e-48
WP_128734780.1|2019548_2020727_-|tail	phage tail sheath family protein	tail	A0A088FVH5	Escherichia_phage	55.9	1.4e-136
WP_159241645.1|2020791_2022384_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	36.2	7.1e-83
WP_004086970.1|2022391_2022949_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.4	6.6e-52
WP_011097611.1|2022941_2023835_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	46.4	1.9e-69
WP_004090907.1|2024320_2024584_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_004090909.1|2024570_2024852_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_004086970.1|2026651_2027209_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.4	6.6e-52
WP_011097611.1|2027201_2028095_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	46.4	1.9e-69
WP_004090694.1|2028094_2028433_-|plate	phage baseplate protein	plate	A0A088FV58	Escherichia_phage	61.3	5.4e-33
WP_004090907.1|2028582_2028846_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_004090909.1|2028832_2029114_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_011097613.1|2029739_2030282_-	hypothetical protein	NA	A0A1W6JT55	Escherichia_phage	41.6	2.9e-36
WP_011097614.1|2030257_2030779_-	hypothetical protein	NA	D5LGZ7	Escherichia_phage	34.3	3.7e-12
WP_011097935.1|2030775_2031099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038232801.1|2031098_2031359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038232803.1|2031376_2033251_-|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	47.5	2.1e-158
WP_167405116.1|2033234_2034833_-|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	50.9	1.6e-130
WP_160176388.1|2038032_2038257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011097939.1|2038258_2038720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011097940.1|2038709_2039021_-	hypothetical protein	NA	A0A172PZR6	Pseudomonas_phage	44.0	7.0e-19
WP_011097941.1|2039031_2039526_-	lysozyme	NA	A0A2I7RLY1	Vibrio_phage	50.3	1.7e-27
WP_014607783.1|2039492_2040110_-	hypothetical protein	NA	V5YTF6	Pseudomonas_phage	52.2	4.0e-26
WP_128712484.1|2040523_2043052_-	DNA primase	NA	C8CLH6	Xylella_phage	75.2	0.0e+00
WP_128712483.1|2043187_2043781_-	hypothetical protein	NA	C8CLH5	Xylella_phage	56.9	3.6e-48
WP_128712482.1|2043777_2044167_-	phage antirepressor protein	NA	C8CLH4	Xylella_phage	68.0	2.7e-28
WP_061278107.1|2044163_2044547_-	hypothetical protein	NA	C8CLH4	Xylella_phage	89.7	2.0e-60
WP_128712485.1|2044543_2044825_-	hypothetical protein	NA	C8CLH4	Xylella_phage	70.7	6.7e-29
WP_081370384.1|2044923_2045310_-	phage antirepressor protein	NA	C8CLH4	Xylella_phage	69.3	9.5e-42
WP_128712480.1|2045891_2046140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085135.1|2046136_2046325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012382631.1|2047006_2047267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011097952.1|2047352_2048111_+	helix-turn-helix transcriptional regulator	NA	C8CLH0	Xylella_phage	40.0	2.2e-34
WP_011097953.1|2048271_2048811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012382632.1|2048833_2049043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012382633.1|2049096_2049480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071869852.1|2049710_2050244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071869851.1|2050240_2050756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072866385.1|2050752_2051214_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_004088357.1|2051273_2051756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012382634.1|2052055_2052247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038233160.1|2052270_2052462_+	hypothetical protein	NA	C8CLG6	Xylella_phage	76.6	3.1e-17
WP_004086187.1|2052493_2052688_+	hypothetical protein	NA	C8CLG5	Xylella_phage	98.4	1.6e-26
WP_167405117.1|2052677_2053175_+	hypothetical protein	NA	C8CLG4	Xylella_phage	87.2	2.0e-47
WP_012382637.1|2053171_2054449_+	DUF2800 domain-containing protein	NA	C8CLG3	Xylella_phage	94.6	6.7e-233
WP_004090881.1|2054448_2055015_+	DUF2815 family protein	NA	C8CLG2	Xylella_phage	97.3	8.3e-103
WP_012382638.1|2055005_2056613_+	hypothetical protein	NA	C8CLG1	Xylella_phage	71.0	1.2e-186
WP_011097961.1|2056614_2058795_+	DNA polymerase	NA	C8CLG0	Xylella_phage	99.9	0.0e+00
WP_011097962.1|2058791_2059070_+	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	100.0	1.6e-46
WP_011098229.1|2059071_2059356_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_011098230.1|2059440_2060859_+	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	99.8	7.6e-278
WP_011098231.1|2060855_2061095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004089706.1|2061081_2061405_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042466509.1|2061776_2062352_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2068698:2068713	attR	CAACACCAACGCCGAT	NA	NA	NA	NA
