The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	315647	366832	5615389	tail,capsid,integrase,head,holin,tRNA,terminase	Stx2-converting_phage(38.6%)	61	352746:352761	367429:367444
WP_106485580.1|315647_315770_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_000458584.1|316005_316578_+	SocA family protein	NA	NA	NA	NA	NA
WP_014640052.1|316607_316994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390073.1|317033_317207_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	94.7	6.4e-22
WP_001093919.1|317254_317536_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.2e-43
WP_001061338.1|317572_318145_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	98.4	5.1e-108
WP_000628776.1|318144_318711_-	DUF551 domain-containing protein	NA	G9L6G3	Escherichia_phage	92.5	4.0e-97
WP_000192143.1|319224_319773_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	95.1	8.5e-60
WP_001450018.1|319769_319979_-	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	100.0	8.8e-34
WP_001242710.1|319990_320602_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	74.7	5.7e-57
WP_000008177.1|320592_321129_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.3	9.0e-99
WP_000775327.1|321219_322137_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	37.9	3.0e-49
WP_000981537.1|322577_323231_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_001231956.1|323326_323524_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000514174.1|323551_324136_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_167582530.1|324132_325284_+	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	86.2	3.7e-182
WP_000620696.1|325280_325505_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_167582533.1|325501_326494_+	hypothetical protein	NA	U5P0A0	Shigella_phage	97.0	3.6e-93
WP_167582536.1|326490_326985_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	5.2e-85
WP_001343335.1|326984_327638_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	9.6e-127
WP_000210155.1|327634_327961_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_021574731.1|327957_328347_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	3.5e-68
WP_001061444.1|328366_329176_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001433852.1|329183_330173_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.9e-195
WP_001047110.1|330186_330939_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_000917724.1|331192_331396_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_167582539.1|331546_332596_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	89.6	2.3e-186
WP_021503123.1|332973_333402_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	98.5	8.9e-65
WP_053890177.1|333987_335838_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_024180155.1|336276_336492_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_167582988.1|336496_336841_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	1.4e-57
WP_032343426.1|336891_337425_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	7.4e-101
WP_001056806.1|337695_338265_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|338264_338411_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|338638_338824_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|339248_339476_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|339517_339883_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958380.1|340173_340737_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_052925445.1|340733_342395_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_167582541.1|342458_344396_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.2	0.0e+00
WP_001063025.1|344440_344662_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|347188_347515_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|347525_347876_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|347872_348319_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|348315_348660_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275471.1|348725_349442_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_001030063.1|349447_349822_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|349917_350127_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212821.1|350178_353421_+|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	98.0	0.0e+00
352746:352761	attL	GGATGCGCAGCGTGCG	NA	NA	NA	NA
WP_000807964.1|353413_353755_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_167582544.1|353754_354453_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.0	7.6e-130
WP_167582548.1|354463_355207_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	96.4	6.1e-146
WP_123007876.1|355152_355785_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.9	2.6e-97
WP_167582551.1|356023_359500_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.4	0.0e+00
WP_024184441.1|359568_360192_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.8	2.7e-70
WP_000279017.1|360256_361570_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001023380.1|361571_361841_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
WP_000938125.1|362295_363657_-	hypothetical protein	NA	Q9MBM1	Phage_Gifsy-1	30.1	4.5e-54
WP_001217539.1|364298_364547_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000332258.1|364608_365706_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	8.1e-211
WP_072127977.1|365794_366832_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
367429:367444	attR	CGCACGCTGCGCATCC	NA	NA	NA	NA
>prophage 2
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	448848	519682	5615389	integrase,transposase,tRNA	Escherichia_phage(20.0%)	57	496087:496101	522429:522443
WP_085949012.1|448848_449542_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
WP_000398619.1|449792_450089_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_001173343.1|450116_450290_+	type V toxin-antitoxin system toxin GhoT	NA	NA	NA	NA	NA
WP_096317672.1|450408_451926_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856834.1|452162_453620_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	1.8e-48
WP_085949012.1|455480_456174_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
WP_000092909.1|456679_458014_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187182.1|458379_459918_-	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_096071306.1|460769_461931_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	5.2e-51
WP_000491535.1|462041_462620_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	78.1	8.6e-79
WP_106505230.1|462825_463644_-	YjiK family protein	NA	NA	NA	NA	NA
WP_000606968.1|463790_464936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001365456.1|466143_466515_+	type III secretion system LEE master regulator Ler	NA	NA	NA	NA	NA
WP_000628726.1|466529_466748_+	YscE family type III secretion system co-chaperone EscE	NA	NA	NA	NA	NA
WP_000084152.1|466760_467075_+	type III secretion system filament chaperone	NA	NA	NA	NA	NA
WP_000153999.1|467071_467671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000780744.1|467657_468311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299990.1|468315_468969_+	type III secretion system LEE export apparatus protein EscR	NA	NA	NA	NA	NA
WP_000447503.1|468968_469238_+	type III secretion system LEE export apparatus protein EscS	NA	NA	NA	NA	NA
WP_001002808.1|469237_470014_+	type III secretion system LEE export apparatus protein EscT	NA	NA	NA	NA	NA
WP_001291687.1|470006_471044_+	type III secretion system LEE export apparatus switch protein EscU	NA	NA	NA	NA	NA
WP_001342442.1|471040_471499_-	type III secretion system LEE muramidase EtgA	NA	NA	NA	NA	NA
WP_000605359.1|471695_472052_+	nucleoside transporter	NA	NA	NA	NA	NA
WP_167582557.1|472126_472540_+	type III secretion system LEE transcriptional regulator GrlA	NA	NA	NA	NA	NA
WP_000087469.1|472924_473380_-	SycD/LcrH family type III secretion system chaperone CesD	NA	NA	NA	NA	NA
WP_000723928.1|473393_474932_-	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	28.9	2.0e-10
WP_001063688.1|474931_475387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233824.1|475392_475965_-	type III secretion system LEE inner membrane ring protein EscJ	NA	NA	NA	NA	NA
WP_001059795.1|475966_476344_-	type III secretion system inner rod subunit SctI	NA	NA	NA	NA	NA
WP_096245887.1|476427_476730_-	type III secretion system protein SepZ	NA	NA	NA	NA	NA
WP_001050414.1|476913_477267_+	type III secretion system LEE chaperone CesL	NA	NA	NA	NA	NA
WP_001037820.1|477263_479291_+	type III secretion system LEE export apparatus protein EscV	NA	NA	NA	NA	NA
WP_000599711.1|479274_480615_+	type III secretion system LEE ATPase EscN	NA	NA	NA	NA	NA
WP_001062953.1|480674_480995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001443671.1|480987_481404_+	DUF1106 domain-containing protein	NA	NA	NA	NA	NA
WP_001050796.1|481366_482284_+	type III secretion system protein SepQ	NA	NA	NA	NA	NA
WP_001360071.1|482314_482830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005230.1|483048_483408_-	Tir chaperone family protein	NA	NA	NA	NA	NA
WP_000492643.1|483658_484270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121330.1|484716_486333_+	type III secretion system LEE translocated intimin receptor Tir	NA	NA	NA	NA	NA
WP_000098786.1|486466_486937_+	type III secretion system LEE chaperone CesT	NA	NA	NA	NA	NA
WP_024226406.1|486997_489817_+	intimin type beta	NA	NA	NA	NA	NA
WP_000953242.1|490031_491252_-	type III secretion system LEE inner membrane ring protein EscD	NA	NA	NA	NA	NA
WP_167582560.1|491394_492450_+	type III secretion system LEE gatekeeper SepL	NA	NA	NA	NA	NA
WP_000381555.1|492507_493086_+	type III secretion system LEE translocon filament protein EspA	NA	NA	NA	NA	NA
WP_000935768.1|493098_494241_+	type III secretion system translocon subunit SctE	NA	NA	NA	NA	NA
WP_001092012.1|494261_495206_+	type III secretion system LEE translocon pore-forming subunit EspB	NA	NA	NA	NA	NA
WP_000228587.1|495212_495620_+	LcrR family type III secretion system chaperone CesD2	NA	NA	NA	NA	NA
WP_001053840.1|495656_495878_+	type III secretion system LEE needle filament protein EscF	NA	NA	NA	NA	NA
WP_000245867.1|495883_496162_+	EscG/YscG/SsaH family type III secretion system needle protein co-chaperone	NA	NA	NA	NA	NA
496087:496101	attL	TATGGATGATGAGAC	NA	NA	NA	NA
WP_001443729.1|496377_497001_+	type III secretion system LEE effector EspF	NA	NA	NA	NA	NA
WP_106485591.1|497931_507603_-	lymphostatin Efa1/LifA	NA	NA	NA	NA	NA
WP_000953025.1|510203_511193_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	6.3e-98
WP_096306362.1|511800_513450_-	type III secretion system effector EspL2	NA	NA	NA	NA	NA
WP_001375513.1|515112_516732_+|transposase	ISL3-like element ISEc38 family transposase	transposase	NA	NA	NA	NA
WP_000704132.1|516728_518300_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	5.8e-295
WP_106505214.1|518416_519682_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	3.0e-76
522429:522443	attR	TATGGATGATGAGAC	NA	NA	NA	NA
>prophage 3
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	556703	653487	5615389	tail,capsid,integrase,protease,portal,plate,head,holin,transposase,tRNA,terminase	Enterobacteria_phage(74.07%)	113	566605:566640	651361:651396
WP_001280349.1|556703_557654_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|557739_558048_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|558125_559406_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|559491_560751_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|560753_561758_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|561839_562037_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|562140_563439_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|563643_564069_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|564107_566549_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
566605:566640	attL	ATGCCGGATGCGGCGTGAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_001293282.1|566728_567460_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|567586_567988_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|568006_568705_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012553.1|568755_569415_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|569432_569831_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|569840_570479_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943991.1|570481_571645_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_096317517.1|571728_573354_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|573470_573746_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254642.1|573894_574224_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569731.1|574405_575155_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|575151_575907_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|576014_577079_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001300695.1|577433_578831_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218360.1|578846_579152_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|579161_579626_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|579639_580290_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|580299_581154_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_167582565.1|581153_581840_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|581968_582244_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|582570_582966_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|582972_583287_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|583291_583519_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|583560_584010_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001350063.1|584080_584875_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_072097616.1|585314_585929_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	1.8e-42
WP_167582568.1|585936_587145_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	1.1e-208
WP_001119478.1|587279_587918_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|588136_588757_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228344.1|589065_590469_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_001062220.1|590735_591170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345317.1|591268_592336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000331456.1|592582_593245_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001296686.1|593352_594318_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560553.1|594425_595286_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|595374_595755_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589460.1|595883_597827_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|598016_598757_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|598746_599304_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|599628_599835_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|599896_601240_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|601562_602201_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|602406_604140_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060925.1|604136_607916_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|607918_608260_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000288983.1|608435_608678_+	hypothetical protein	NA	A0A0A7NPW2	Enterobacteria_phage	100.0	2.5e-40
WP_071533696.1|608670_608904_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_000078920.1|609033_609174_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_167582571.1|609365_609626_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132818.1|609668_610769_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	100.0	1.2e-206
WP_000005431.1|610926_612111_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
WP_000290450.1|612110_612623_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665314.1|612677_613043_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333494.1|613051_613207_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000853388.1|613193_616001_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.8	0.0e+00
WP_000979954.1|616013_616502_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_001525166.1|616528_617128_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.8	9.8e-86
WP_131419410.1|617555_617996_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	2.0e-51
WP_131419412.1|617967_618570_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	2.3e-98
WP_167582574.1|618569_619904_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	69.0	2.1e-181
WP_000071724.1|619900_620509_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_052893181.1|620501_621398_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	96.6	1.1e-152
WP_000213447.1|621401_621752_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_167582577.1|621748_622330_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	7.3e-102
WP_052893183.1|622326_622962_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_000920593.1|622954_623422_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_032083488.1|623559_623967_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	2.0e-66
WP_000072327.1|623963_624356_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|624352_624676_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|624678_624879_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063082.1|624878_625373_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_112924774.1|625475_626276_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	90.2	2.1e-128
WP_113287016.1|626321_627374_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	1.9e-193
WP_020218747.1|627397_628234_-	hypothetical protein	NA	A0A0A7NRY7	Enterobacteria_phage	98.6	3.3e-148
WP_167582580.1|628388_630140_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.5	0.0e+00
WP_000087812.1|630139_631186_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001390707.1|631673_631943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211267.1|632307_632619_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_001525150.1|632623_633583_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	2.4e-179
WP_000599398.1|636489_636855_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	99.2	4.6e-62
WP_157895439.1|636851_637472_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	41.0	1.7e-11
WP_001603062.1|637525_638356_-|protease	serine protease	protease	A0A0A7NPW9	Enterobacteria_phage	100.0	8.7e-133
WP_001036809.1|638352_638556_-	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	100.0	4.8e-29
WP_046788693.1|638552_638867_-	ead/Ea22-like family protein	NA	A0A0A7NRX6	Enterobacteria_phage	100.0	5.4e-51
WP_000153676.1|638863_639109_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	100.0	6.7e-41
WP_001560998.1|639105_639309_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	100.0	4.0e-31
WP_000021656.1|639395_639509_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000514277.1|639505_639748_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159895.1|639759_640038_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	100.0	1.2e-43
WP_167582583.1|640048_640399_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	99.1	2.7e-59
WP_001158283.1|640436_640862_-	regulatory protein	NA	A0A0A7NPS5	Enterobacteria_phage	100.0	9.1e-78
WP_021580386.1|640970_641270_+	helix-turn-helix transcriptional regulator	NA	A0A0A7NPW3	Enterobacteria_phage	100.0	1.2e-44
WP_001372721.1|641336_642332_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7NQ69	Enterobacteria_phage	100.0	2.4e-193
WP_096317499.1|642622_642874_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|642867_643218_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|643297_643828_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265933.1|644137_645094_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_167582586.1|645233_646736_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001296689.1|646749_647772_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|647758_648754_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|648786_649785_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_106505212.1|649960_651334_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166267.1|651489_652041_-	ribosome-associated protein	NA	NA	NA	NA	NA
651361:651396	attR	GTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCAT	NA	NA	NA	NA
WP_096245411.1|652134_653487_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 4
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	692780	700351	5615389	transposase	Enterobacteria_phage(57.14%)	9	NA	NA
WP_001084853.1|692780_693041_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	4.6e-24
WP_000761643.1|693037_693586_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.8	5.9e-29
WP_001014979.1|693585_693810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000842358.1|693806_694130_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_096317502.1|694144_696478_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.7	0.0e+00
WP_000594911.1|697383_698208_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000227281.1|698256_698829_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000747102.1|698929_699280_+|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_001254876.1|699199_700351_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
>prophage 5
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	704421	709740	5615389	transposase	Stx2-converting_phage(50.0%)	9	NA	NA
WP_000839179.1|704421_704826_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_106485702.1|704822_705170_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	7.5e-62
WP_000099160.1|705218_706757_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_096317830.1|706753_707194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001119729.1|707272_707506_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234620.1|707605_708424_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_000849588.1|708478_708964_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001186774.1|708979_709456_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|709518_709740_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 6
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	1439693	1526438	5615389	tail,capsid,integrase,protease,lysis,portal,head,transposase,tRNA,terminase	Enterobacteria_phage(54.24%)	92	1449854:1449900	1496772:1496818
WP_096245584.1|1439693_1441079_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|1441114_1441636_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1441743_1441956_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|1441957_1442824_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_096245583.1|1443304_1443847_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|1444066_1444759_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_096245582.1|1444789_1447399_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|1447377_1448418_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_106485595.1|1448428_1448944_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|1448946_1449579_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1449854:1449900	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|1449913_1451077_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000488407.1|1451275_1451554_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763390.1|1451601_1451820_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_001443983.1|1451918_1452200_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|1452210_1452402_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|1452374_1452557_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|1452553_1453234_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|1453230_1454016_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|1454021_1454318_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_001309317.1|1454393_1454684_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	83.8	5.0e-27
WP_096317570.1|1455150_1455471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066829.1|1455606_1455870_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_000259990.1|1455951_1456707_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_001067458.1|1456745_1456976_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182773.1|1457045_1457585_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000788789.1|1458574_1459276_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
WP_000152742.1|1459480_1459828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096245851.1|1460580_1461189_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	66.3	4.4e-33
WP_001038620.1|1461488_1461905_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000520500.1|1461883_1462285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097617.1|1462408_1462510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053023.1|1462506_1462962_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_000224914.1|1462961_1463132_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774477.1|1463124_1463415_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_001099712.1|1463411_1463774_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971074.1|1463770_1463911_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|1463996_1464380_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737278.1|1464568_1465651_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_000839596.1|1466239_1466455_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135274.1|1466454_1466952_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_001228695.1|1467168_1467351_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|1467441_1467735_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001427981.1|1468094_1468289_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_096245730.1|1468677_1469223_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	8.9e-94
WP_167582609.1|1469197_1471123_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|1471119_1471326_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001444138.1|1471322_1472924_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	8.5e-310
WP_000123322.1|1472904_1474224_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	9.6e-235
WP_001345004.1|1474233_1474566_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063244.1|1474621_1475647_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_000158868.1|1475688_1476084_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752961.1|1476095_1476470_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000985132.1|1476460_1477039_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683110.1|1477035_1477431_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_001342267.1|1477438_1478179_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|1478194_1478617_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|1478598_1479033_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_096317572.1|1479025_1481587_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.4	0.0e+00
WP_000847413.1|1481583_1481913_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_167582612.1|1481912_1482611_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	9.5e-133
WP_097412220.1|1482616_1483360_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.5e-147
WP_000090884.1|1483296_1483929_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_167582615.1|1483989_1487403_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
WP_001230523.1|1487473_1488073_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_096245676.1|1488137_1491098_+	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
WP_000885574.1|1491097_1491682_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.2e-101
WP_000239881.1|1491736_1492405_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_096317713.1|1492461_1492701_+|tail	tail assembly chaperone	tail	K7PMH7	Enterobacteria_phage	74.5	2.0e-10
WP_085949012.1|1492736_1493430_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
WP_096317603.1|1493724_1495209_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|1495395_1496349_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177453.1|1496861_1497623_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1496772:1496818	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|1497802_1498693_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001375368.1|1498693_1501666_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_096317602.1|1501652_1503890_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420938.1|1504158_1505295_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_096245664.1|1507363_1507825_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_000103161.1|1507852_1509754_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	3.9e-27
WP_000253805.1|1510490_1511939_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
WP_000770953.1|1511928_1512612_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000074256.1|1512768_1514142_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709879.1|1514299_1514632_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717121.1|1514647_1515871_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000573943.1|1515882_1519026_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.2	5.7e-60
WP_000786320.1|1519127_1520504_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_096245865.1|1520571_1521819_-	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000351464.1|1521926_1522580_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360951.1|1522673_1523042_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682517.1|1523106_1523355_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001130618.1|1523420_1524539_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000956455.1|1524980_1525133_+	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001300563.1|1525325_1526438_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	1717266	1776375	5615389	tail,capsid,integrase,protease,lysis,portal,head,holin,transposase,terminase	Enterobacteria_phage(47.95%)	82	1711862:1711878	1763890:1763906
1711862:1711878	attL	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
WP_000533654.1|1717266_1718337_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
WP_162829242.1|1718499_1719712_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_106505301.1|1719687_1719846_-	hypothetical protein	NA	K7PKU2	Enterobacteria_phage	91.2	3.0e-10
WP_001281774.1|1719952_1720297_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_000545733.1|1720325_1720493_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000002107.1|1720565_1720850_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_012817743.1|1720842_1721145_-	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_000104414.1|1721141_1721759_-	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
WP_106505300.1|1721742_1722318_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.7e-45
WP_000812206.1|1722314_1722872_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_001214436.1|1722868_1723033_-	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_001111278.1|1723043_1723337_-	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_000951334.1|1723360_1723744_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_000031370.1|1723743_1724349_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_000010964.1|1724450_1724609_-	hypothetical protein	NA	A0A088CPT7	Enterobacteria_phage	100.0	3.1e-23
WP_001243354.1|1724605_1724758_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000638547.1|1724742_1724874_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001341800.1|1724898_1725759_-	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
WP_000073663.1|1726122_1726662_+	superinfection exclusion protein B	NA	A0A192Y7Z0	Salmonella_phage	44.9	8.1e-39
WP_000088201.1|1726685_1726958_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
WP_000193240.1|1727564_1727927_-	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	51.4	6.2e-19
WP_000428099.1|1728195_1728900_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	99.6	4.3e-133
WP_000064149.1|1729013_1729247_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	98.7	2.3e-35
WP_000438538.1|1729385_1729685_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	4.8e-49
WP_032167977.1|1729717_1730656_+	replication protein	NA	C1JJ53	Enterobacteria_phage	99.7	4.8e-172
WP_000788878.1|1730652_1731354_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000145926.1|1731350_1731641_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_096245823.1|1731937_1732294_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	96.5	1.0e-58
WP_000814611.1|1732265_1732676_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_001254255.1|1732672_1732849_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|1732851_1733253_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001341811.1|1733212_1733422_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
WP_001003989.1|1733414_1734137_+	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_000002261.1|1734136_1734427_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001008193.1|1734423_1734786_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000994516.1|1734782_1734971_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000750155.1|1735182_1736142_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|1736480_1736603_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|1736617_1737307_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001342988.1|1737518_1737995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1738320_1738479_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_167582626.1|1738777_1740628_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_024164617.1|1741066_1741282_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075132.1|1741281_1741779_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|1741775_1742213_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000881326.1|1742362_1742980_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|1743167_1743362_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000235451.1|1743757_1744267_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_009442816.1|1744238_1746167_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000259002.1|1746150_1746357_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001432013.1|1746353_1747946_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.2e-184
WP_021533011.1|1748251_1748593_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	2.2e-58
WP_106485702.1|1748589_1748937_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	7.5e-62
WP_167582629.1|1748985_1750524_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.6	1.9e-295
WP_000256818.1|1751938_1752286_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_167582632.1|1752343_1753372_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	7.8e-115
WP_167582635.1|1753423_1753798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204544.1|1753790_1754144_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000975037.1|1754158_1754734_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_000683071.1|1754730_1755126_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_001143013.1|1755133_1755886_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000479083.1|1755899_1756331_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_096306555.1|1756357_1756771_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	7.1e-43
WP_167582638.1|1756751_1759331_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.1	0.0e+00
WP_000847304.1|1759327_1759657_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_106505295.1|1759656_1760355_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.3	4.0e-131
WP_001505235.1|1760365_1761109_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	100.0	6.3e-151
WP_130069576.1|1761054_1761687_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.9	2.6e-97
WP_162829242.1|1761905_1763118_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_167582641.1|1763246_1766726_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	88.7	0.0e+00
1763890:1763906	attR	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
WP_001230435.1|1766793_1767393_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	8.2e-109
WP_153781557.1|1767457_1768672_+|tail	phage tail protein	tail	A0A0P0ZDE7	Stx2-converting_phage	98.8	1.9e-80
WP_001023459.1|1768673_1768943_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|1769048_1769930_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_000652081.1|1770153_1770981_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
WP_021351651.1|1771104_1771476_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_001448642.1|1771919_1772495_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
WP_001002868.1|1772695_1773076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354291.1|1773159_1773381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096245855.1|1773393_1774047_-	EspJ family T3SS effector ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_000767389.1|1774550_1775027_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001307065.1|1775085_1776375_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 8
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	1984998	2046620	5615389	tail,capsid,integrase,protease,portal,head,holin,terminase	Escherichia_phage(42.0%)	78	2000079:2000138	2041883:2041947
WP_000156528.1|1984998_1986759_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1986944_1987397_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1987471_1988512_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1988868_1989378_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|1989596_1990226_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1990188_1992351_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1992360_1992807_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_167582990.1|1992929_1994984_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_032280666.1|1995015_1995474_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1995569_1996232_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1996404_1996818_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1996862_1997180_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116302.1|1997237_1998428_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048244.1|1998522_1998801_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1998797_1999127_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|1999217_1999877_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
2000079:2000138	attL	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAA	NA	NA	NA	NA
WP_024227504.1|2000284_2001304_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.7e-85
WP_000273158.1|2001272_2001524_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_106505231.1|2001590_2004071_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	64.1	9.8e-63
WP_000449200.1|2004350_2004539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123003437.1|2004936_2005104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2005097_2005331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394520.1|2005308_2005716_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	40.9	1.0e-09
WP_059225152.1|2005738_2005957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072248456.1|2006116_2006272_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_032322368.1|2006683_2007085_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	53.0	1.3e-12
WP_024227557.1|2007194_2007467_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	46.3	1.1e-12
WP_023307884.1|2007450_2007876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059225150.1|2007897_2008863_+	hypothetical protein	NA	U5P0A0	Shigella_phage	64.9	2.1e-53
WP_106505292.1|2008903_2009329_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.6	1.5e-64
WP_021527610.1|2009382_2009739_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.4e-58
WP_000935424.1|2009785_2009998_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	95.7	2.8e-35
WP_000209148.1|2010030_2010249_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_000208016.1|2010523_2011393_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	79.2	8.5e-123
WP_001278454.1|2011508_2011613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102204098.1|2011802_2012015_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	57.1	8.7e-13
WP_001219082.1|2012259_2012619_+	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	50.9	7.1e-23
WP_000284536.1|2012621_2013098_+	ImmA/IrrE family metallo-endopeptidase	NA	L7THB5	Pseudomonas_virus	33.3	1.7e-16
WP_001429486.1|2013530_2013809_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	4.3e-12
WP_106505257.1|2013810_2014866_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	4.4e-89
WP_102204096.1|2014866_2015247_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.5	1.1e-37
WP_025237241.1|2015243_2016065_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	60.8	4.1e-82
WP_000839572.1|2016807_2017023_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_097430261.1|2017027_2017342_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	96.2	7.7e-50
WP_001274714.1|2017397_2017931_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	99.4	5.1e-102
WP_001228685.1|2018147_2018333_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_097430260.1|2018550_2018817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097430259.1|2018822_2019362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111090.1|2019500_2019851_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	4.3e-65
WP_096924490.1|2020000_2020483_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.8	3.0e-85
WP_106485614.1|2020482_2022240_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_048949147.1|2022251_2022434_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_097409095.1|2022433_2023675_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.0	4.2e-240
WP_001193633.1|2023652_2024303_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	7.3e-119
WP_106485615.1|2024317_2025523_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	98.8	2.9e-222
WP_000601355.1|2025573_2025762_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_050939781.1|2025773_2026079_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	92.1	1.6e-39
WP_106485616.1|2026087_2026426_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	96.4	1.1e-54
WP_000968644.1|2026422_2026872_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001406801.1|2026868_2027213_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	98.2	3.6e-56
WP_000097530.1|2027272_2027977_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	95.7	2.5e-117
WP_000164661.1|2027991_2028363_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000978931.1|2028386_2028665_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	98.9	1.6e-43
WP_106505254.1|2028711_2031951_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	96.6	0.0e+00
WP_096924496.1|2031943_2032285_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	65.5	3.5e-40
WP_054632287.1|2032284_2032983_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.4	2.4e-131
WP_096924497.1|2032987_2033731_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_096924498.1|2033628_2034276_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	2.8e-110
WP_167582647.1|2034336_2037819_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.1	0.0e+00
WP_106485729.1|2037886_2038486_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	96.0	8.5e-106
WP_000279018.1|2038550_2039864_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
WP_001023380.1|2039865_2040135_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
WP_106485569.1|2040276_2041152_+	secretion protein EspS	NA	A0A0P0ZCT1	Stx2-converting_phage	93.5	8.0e-153
WP_162540430.1|2041390_2041561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058323.1|2042401_2043520_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
2041883:2041947	attR	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_096317440.1|2043516_2045310_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_167582650.1|2045328_2046036_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|2046032_2046620_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 9
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	2108670	2164057	5615389	transposase,protease	Stx2-converting_phage(29.41%)	57	NA	NA
WP_000998025.1|2108670_2110203_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	7.1e-298
WP_000612591.1|2110252_2110600_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2110596_2110977_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_162829242.1|2111415_2112629_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_028913479.1|2113681_2114287_+	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001303891.1|2114334_2114586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304211.1|2114609_2114900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000024297.1|2115585_2115945_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591995.1|2116037_2117657_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_167582656.1|2117881_2118157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886249.1|2118537_2119317_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000424145.1|2119326_2119629_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|2119637_2119958_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000065682.1|2119950_2121654_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_000966485.1|2121663_2122128_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142971.1|2122128_2122803_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021388.1|2122814_2123432_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_000803992.1|2124642_2124906_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001135715.1|2125207_2125348_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_167582659.1|2126218_2126890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000097913.1|2127909_2128083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435663.1|2129227_2129653_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000624701.1|2129649_2130000_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000088522.1|2130030_2131644_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000957249.1|2132547_2132928_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000042916.1|2132914_2133244_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001176766.1|2133504_2133972_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506898.1|2133989_2135198_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797372.1|2135208_2136165_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_167582662.1|2136164_2137244_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_001040056.1|2137245_2138019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|2138011_2139154_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001035166.1|2139163_2140222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254140.1|2140544_2141126_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001054789.1|2141125_2142283_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|2142305_2142761_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|2142783_2143824_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|2143872_2144451_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301248.1|2144519_2145095_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_001053349.1|2145520_2145907_+	protein TerF	NA	NA	NA	NA	NA
WP_001223350.1|2146420_2148511_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_000477623.1|2149963_2150182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|2150815_2151151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|2151931_2152126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299815.1|2152177_2152357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303898.1|2152445_2152718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001340489.1|2153001_2153217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958487.1|2153282_2153480_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_096245941.1|2154209_2155334_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_001301456.1|2156687_2157146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024219674.1|2157603_2158113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260386.1|2158201_2158825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124179.1|2158920_2159154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287881.1|2159206_2159398_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000590537.1|2159819_2159969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|2161206_2162358_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_162829242.1|2162844_2164057_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
>prophage 10
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	2284364	2351756	5615389	tail,capsid,integrase,head,holin,transposase,tRNA,terminase	Stx2-converting_phage(40.0%)	74	2274102:2274118	2292208:2292224
2274102:2274118	attL	GCTGTCCAGTTGGGTTC	NA	NA	NA	NA
WP_052897395.1|2284364_2285483_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	1.3e-83
WP_000003742.1|2285451_2285721_-	excisionase	NA	NA	NA	NA	NA
WP_106645230.1|2285782_2288254_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000199480.1|2288349_2288538_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|2288534_2288723_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_123004616.1|2289123_2289288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167582677.1|2289291_2289510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379557.1|2289669_2289825_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_000948452.1|2290143_2290620_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|2290744_2291068_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693916.1|2291051_2291477_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|2291499_2292462_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
2292208:2292224	attR	GAACCCAACTGGACAGC	NA	NA	NA	NA
WP_001151120.1|2292502_2292925_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.9	1.3e-63
WP_000004322.1|2292921_2293176_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	94.0	4.8e-42
WP_001002672.1|2293168_2293480_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.1e-59
WP_085949012.1|2293703_2294397_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
WP_001204666.1|2294559_2295138_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_096317682.1|2295097_2296195_-	beta family protein	NA	A0A0U2S621	Escherichia_phage	99.2	2.6e-209
WP_000882662.1|2296695_2296908_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_012817871.1|2297075_2297348_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_000140024.1|2298394_2298760_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_000640017.1|2298768_2299311_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.9	1.9e-72
WP_000917767.1|2299542_2299740_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_048250648.1|2299890_2300940_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	88.5	3.4e-182
WP_000562553.1|2301738_2301870_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000871291.1|2302150_2302486_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_167582680.1|2302745_2304599_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.1	0.0e+00
WP_000284518.1|2304748_2304964_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_024017643.1|2304968_2305313_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.4e-57
WP_000992033.1|2305363_2305897_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	8.1e-100
WP_032140280.1|2306451_2306538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|2306759_2306945_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000828072.1|2307345_2307672_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	3.4e-56
WP_000095732.1|2307803_2308004_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	95.5	3.7e-29
WP_000279801.1|2308045_2308411_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	2.3e-61
WP_000958360.1|2308702_2309266_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	99.5	6.2e-90
WP_001399867.1|2309262_2310924_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_052908978.1|2310987_2312925_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.8	0.0e+00
WP_001063025.1|2312969_2313191_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|2315717_2316044_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|2316054_2316405_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|2316401_2316848_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2316844_2317189_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275471.1|2317254_2317971_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_000099160.1|2318011_2319550_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_106485702.1|2319598_2319946_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	7.5e-62
WP_000839179.1|2319942_2320347_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001030063.1|2320438_2320813_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2320908_2321118_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_032316741.1|2321169_2324436_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	78.9	0.0e+00
WP_000807964.1|2324428_2324770_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152217.1|2324769_2325468_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	99.6	2.8e-132
WP_000194790.1|2325473_2326217_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	8.3e-151
WP_146681451.1|2326162_2326795_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	1.4e-103
WP_000514715.1|2327137_2329588_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	95.0	0.0e+00
WP_000839179.1|2329665_2330070_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_106485702.1|2330066_2330414_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	7.5e-62
WP_000099160.1|2330462_2332001_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_106485674.1|2332023_2333073_+	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	99.7	5.0e-194
WP_096939759.1|2333140_2333740_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.2e-107
WP_167582683.1|2333891_2335205_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	4.5e-75
WP_001023356.1|2335206_2335476_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_096071306.1|2337621_2338783_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	5.2e-51
WP_106409364.1|2340684_2340807_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|2340913_2341825_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|2341890_2342460_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001303943.1|2343626_2343905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2344332_2344479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2344615_2345263_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2345446_2346037_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|2347543_2348194_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_000147167.1|2348799_2349018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000891620.1|2349107_2349674_-	hydrolase	NA	NA	NA	NA	NA
WP_001258662.1|2349983_2351756_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	2393341	2481154	5615389	tail,capsid,integrase,protease,head,holin,tRNA,terminase	Escherichia_phage(36.76%)	104	2388750:2388766	2408584:2408600
2388750:2388766	attL	CATCGGGCAATCAGCAT	NA	NA	NA	NA
WP_000916763.1|2393341_2393572_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_096245560.1|2393710_2394085_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|2394088_2394961_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976492.1|2394973_2395315_+	YebY family protein	NA	NA	NA	NA	NA
WP_001189085.1|2395707_2396784_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	9.0e-98
WP_097412098.1|2396749_2397031_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.4	1.3e-11
WP_024177035.1|2397137_2397326_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	95.7	3.9e-17
WP_010989194.1|2397318_2397513_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	98.4	4.5e-32
WP_001004413.1|2397576_2398629_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	62.5	2.3e-114
WP_167582685.1|2398640_2401790_-	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	74.2	0.0e+00
WP_044805262.1|2401890_2402166_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	4.4e-41
WP_000358365.1|2402240_2402411_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	67.9	2.0e-15
WP_000560219.1|2402410_2402632_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	1.5e-36
WP_000379547.1|2403052_2403205_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000410105.1|2403511_2403931_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|2404027_2404270_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_044805260.1|2404266_2404689_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	4.5e-69
WP_153781624.1|2404766_2405561_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.2	4.4e-41
WP_054421928.1|2405567_2406314_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.7	9.9e-112
WP_096317508.1|2406336_2407107_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.8	3.9e-87
WP_044805255.1|2407122_2407545_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_000004203.1|2407541_2408015_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	76.8	1.1e-66
WP_001224676.1|2408159_2408333_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	94.7	1.2e-23
WP_000753056.1|2408334_2408511_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	91.4	3.7e-25
WP_001289349.1|2408507_2409455_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	97.1	1.2e-178
2408584:2408600	attR	CATCGGGCAATCAGCAT	NA	NA	NA	NA
WP_096317509.1|2409968_2410478_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	82.1	2.1e-49
WP_000610656.1|2410474_2410855_+	DUF551 domain-containing protein	NA	Q08J61	Stx2-converting_phage	100.0	9.6e-71
WP_000426669.1|2410854_2411250_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	98.5	4.4e-66
WP_000200358.1|2411370_2412144_-	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
WP_001585819.1|2412668_2412821_+	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_001337241.1|2413056_2413308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096317510.1|2413379_2413979_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	89.9	7.5e-102
WP_000228038.1|2413978_2414269_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_096317511.1|2414265_2414820_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.0	1.1e-70
WP_000211416.1|2415093_2415675_+	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	97.6	8.7e-63
WP_001369585.1|2415917_2416115_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.0e-27
WP_096317512.1|2416249_2416963_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001434745.1|2417414_2417843_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	98.5	2.6e-64
WP_096317514.1|2418320_2420258_+	SASA family carbohydrate esterase	NA	A0A0P0ZDW4	Stx2-converting_phage	96.3	0.0e+00
WP_000143458.1|2420395_2420575_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|2420615_2420861_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|2420938_2421154_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087714.1|2421158_2421692_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001056883.1|2421966_2422536_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000455406.1|2422535_2422685_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001208680.1|2422912_2423098_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2423623_2423938_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_096317800.1|2424019_2424244_-	YlcI/YnfO family protein	NA	A0A0P0ZCG8	Stx2-converting_phage	76.1	2.3e-19
WP_000279796.1|2424285_2424651_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958380.1|2424941_2425505_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_052925445.1|2425501_2427163_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_167582541.1|2427226_2429164_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.2	0.0e+00
WP_001063025.1|2429208_2429430_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|2431956_2432283_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|2432293_2432644_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|2432640_2433087_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2433083_2433428_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275471.1|2433493_2434210_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_001030063.1|2434215_2434590_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2434685_2434895_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212821.1|2434946_2438189_+|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	98.0	0.0e+00
WP_000807964.1|2438181_2438523_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_096954638.1|2438522_2439221_+|tail	phage minor tail protein L	tail	A0A0P0ZD82	Stx2-converting_phage	99.1	2.8e-132
WP_167582548.1|2439231_2439975_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	96.4	6.1e-146
WP_123007876.1|2439920_2440553_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.9	2.6e-97
WP_167582688.1|2440791_2444268_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.0	0.0e+00
WP_167582691.1|2444336_2444960_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	1.3e-69
WP_167582694.1|2445024_2446338_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	98.6	3.1e-76
WP_053921583.1|2446339_2446609_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	9.3e-44
WP_122988840.1|2446719_2446797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993102.1|2447011_2448025_+	peptidase M85	NA	NA	NA	NA	NA
WP_167582697.1|2448757_2449414_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	1.0e-56
WP_001296140.1|2449414_2449606_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|2449710_2449947_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_096317597.1|2450064_2451504_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001299674.1|2451583_2454217_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207284.1|2454185_2455469_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|2455598_2456096_+	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_000431370.1|2456192_2456891_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001315679.1|2456910_2458959_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|2459150_2460032_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127210.1|2460077_2461451_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262174.1|2461627_2462419_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211011.1|2462561_2462801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|2462959_2463103_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006866.1|2463177_2463465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295496.1|2464133_2464277_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|2464289_2464499_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010107.1|2464664_2465474_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_033551495.1|2465470_2466037_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000156255.1|2466465_2466924_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|2466978_2467830_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_096854310.1|2467842_2468643_-	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150551.1|2468705_2469677_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000394983.1|2470139_2471696_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_001295494.1|2471699_2473298_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000624298.1|2473428_2474793_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000456725.1|2474976_2475555_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000854972.1|2475558_2476920_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|2476993_2477173_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|2477292_2477652_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|2478014_2478359_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|2478490_2480401_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001221003.1|2480458_2481154_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	2649597	2783611	5615389	tail,capsid,integrase,protease,portal,head,holin,transposase,tRNA,terminase	Enterobacteria_phage(29.33%)	147	2715349:2715365	2731228:2731244
WP_001295400.1|2649597_2650872_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_000789751.1|2650933_2651794_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_000765749.1|2651837_2652443_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100931.1|2652548_2654051_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030346.1|2654661_2655297_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289657.1|2655296_2655992_-	electron transport complex subunit RsxE	NA	NA	NA	NA	NA
WP_000920784.1|2655995_2656616_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000231922.1|2656619_2657678_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000915761.1|2657678_2659901_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991805.1|2659893_2660472_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133188.1|2660471_2661053_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_096317375.1|2661129_2661570_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217950.1|2661655_2661871_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001300888.1|2662143_2662269_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_001282516.1|2662511_2663552_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000567490.1|2663586_2664588_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459381.1|2664691_2665864_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125607.1|2665873_2667466_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_016239542.1|2667640_2668669_+	mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483353.1|2668780_2669548_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_001342191.1|2669768_2670359_+	DNA-binding transcriptional regulator UidR	NA	NA	NA	NA	NA
WP_000945880.1|2670747_2672559_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
WP_001075858.1|2672555_2673929_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_032331778.1|2673967_2675233_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_001043342.1|2675277_2676786_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170683.1|2676886_2678062_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066628.1|2678260_2679907_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001099108.1|2680049_2681453_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000135186.1|2681449_2682379_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_167582714.1|2682454_2683756_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
WP_001092519.1|2683759_2684479_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524868.1|2684607_2684943_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000513673.1|2684939_2685662_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412379.1|2685698_2687081_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|2687266_2688211_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001295398.1|2688734_2690267_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|2690277_2691666_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_033809557.1|2692772_2694002_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_000953271.1|2694376_2694565_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_000190566.1|2695060_2695240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047377376.1|2695424_2695625_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001488088.1|2695614_2695854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001737184.1|2695846_2696068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204996.1|2696069_2696303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|2696308_2696608_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_167582717.1|2696604_2698359_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.0	7.1e-92
WP_000557476.1|2698647_2698926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024215644.1|2698922_2699333_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233299.1|2699343_2699616_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132080.1|2699740_2699965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137346.1|2700256_2701414_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.6	4.8e-137
WP_000504051.1|2701453_2702026_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	64.1	5.5e-62
WP_000267615.1|2702027_2703239_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.7	8.7e-190
WP_001020670.1|2703235_2703574_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	53.6	1.7e-31
WP_000134114.1|2703570_2703867_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	2.4e-32
WP_001145904.1|2703866_2704307_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	1.9e-62
WP_000174068.1|2704290_2704473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|2704595_2704952_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001560954.1|2704935_2706597_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.7	8.9e-278
WP_000133423.1|2706610_2706892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276149.1|2708166_2708532_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|2708518_2708848_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260840.1|2708886_2709708_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2709807_2709891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|2709983_2710319_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2710715_2711969_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019545.1|2712075_2712969_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2713103_2714324_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|2714448_2715144_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2715096_2716389_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2715349:2715365	attL	CAACATGCCAATGGCAA	NA	NA	NA	NA
WP_000148710.1|2716547_2717162_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|2717204_2718059_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2718060_2718678_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001342196.1|2718688_2721112_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_001307224.1|2723796_2724102_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2724209_2724920_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2724922_2725483_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2725517_2725859_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2725993_2726320_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2726525_2727740_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|2727751_2728771_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_072095801.1|2728828_2728939_+	transporter	NA	NA	NA	NA	NA
WP_167582720.1|2728958_2730254_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	61.8	1.6e-154
WP_000005551.1|2730273_2730525_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_162829242.1|2731855_2733069_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
2731228:2731244	attR	TTGCCATTGGCATGTTG	NA	NA	NA	NA
WP_000449175.1|2734633_2734822_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2735385_2735595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2735595_2736234_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000379563.1|2736245_2736398_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_001003379.1|2736587_2736995_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476986.1|2737072_2737300_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_159120643.1|2737283_2737835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020570.1|2737806_2738847_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.8e-90
WP_157837342.1|2738758_2739301_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_024224419.1|2739335_2740106_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	65.6	4.2e-81
WP_001118160.1|2740121_2740517_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_106505297.1|2740574_2740931_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	1.1e-55
WP_000063625.1|2740979_2741192_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000555106.1|2741392_2742106_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.2e-34
WP_001278450.1|2742221_2742326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2742514_2742727_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_077625879.1|2742944_2743205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032156506.1|2743274_2743553_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.3e-11
WP_167582723.1|2743554_2744604_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	2.5e-108
WP_096317734.1|2744616_2744976_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	1.4e-34
WP_001064906.1|2744972_2745662_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	5.5e-56
WP_000917733.1|2745874_2746072_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_000483509.1|2746224_2747283_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_032362312.1|2747926_2749780_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_000284516.1|2749929_2750145_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_096317795.1|2750148_2750706_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	82.1	1.2e-50
WP_052915455.1|2750742_2751276_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	8.7e-102
WP_072095843.1|2751432_2751615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280927.1|2751627_2751759_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	76.7	9.7e-07
WP_071974579.1|2751981_2752188_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	63.2	4.6e-11
WP_000735655.1|2752252_2752477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032211162.1|2752964_2753471_+	DNA-packaging protein	NA	O64316	Escherichia_phage	49.4	1.9e-34
WP_106485649.1|2753442_2755371_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.0e-261
WP_000259002.1|2755354_2755561_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_106485648.1|2755557_2757150_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	1.2e-183
WP_024226418.1|2757139_2758645_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	2.7e-100
WP_000256818.1|2758681_2759029_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522623.1|2759086_2760115_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|2760166_2760550_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204558.1|2760542_2760896_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.9e-41
WP_106505273.1|2760910_2761489_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	3.5e-80
WP_000683137.1|2761485_2761881_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235101.1|2761888_2762641_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.8	3.2e-134
WP_000479045.1|2762654_2763077_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|2763103_2763517_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_024017784.1|2763497_2766110_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.2	0.0e+00
WP_000847298.1|2766106_2766436_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001365123.1|2766435_2767134_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.7	1.8e-131
WP_103951720.1|2767144_2767888_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.2	5.4e-150
WP_063075060.1|2767833_2768463_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.0	7.8e-110
WP_167582726.1|2768703_2772180_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.5	0.0e+00
WP_096317465.1|2772247_2772847_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	95.5	3.2e-105
WP_167582729.1|2772911_2774225_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.6e-78
WP_001023406.1|2774226_2774496_+|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_024017371.1|2774607_2775180_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	48.7	2.7e-40
WP_024017370.1|2775397_2776096_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_085949012.1|2776939_2777634_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
WP_167582732.1|2778435_2778696_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	98.8	1.5e-43
WP_001121225.1|2778920_2779571_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_096317642.1|2780165_2780480_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	80.6	5.0e-25
WP_096317640.1|2781911_2783372_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	6.2e-41
WP_000214712.1|2783407_2783611_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 13
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	2919535	3032244	5615389	tail,capsid,portal,head,holin,transposase,tRNA,terminase	Escherichia_phage(47.69%)	113	NA	NA
WP_061301788.1|2919535_2920744_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	2.0e-207
WP_001261013.1|2921270_2921939_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|2922241_2922835_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001341359.1|2922831_2923824_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234054.1|2923947_2924928_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_000140877.1|2924922_2925459_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2925521_2925746_-	YdcH family protein	NA	NA	NA	NA	NA
WP_065180205.1|2925885_2927541_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013783.1|2927765_2929109_-	VOC family protein	NA	NA	NA	NA	NA
WP_096245445.1|2929325_2930249_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098531.1|2930286_2931927_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|2932325_2932475_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2932546_2932720_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|2932964_2933495_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048647.1|2933683_2934685_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115944.1|2934726_2936166_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|2936362_2937163_-	YdcF family protein	NA	NA	NA	NA	NA
WP_096317555.1|2937434_2941337_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|2941537_2942143_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_096245443.1|2943498_2945256_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890909.1|2945271_2946168_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177525.1|2946167_2946773_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000477179.1|2946943_2949250_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097801.1|2949313_2950174_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123454.1|2950404_2950995_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000041176.1|2950976_2951927_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632286.1|2952027_2953341_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206190.1|2953367_2954573_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2954572_2954995_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973362.1|2954984_2956412_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969777.1|2956413_2957202_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|2957201_2957969_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206377.1|2957965_2959036_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189197.1|2959043_2959541_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072831.1|2959555_2960302_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2960310_2960598_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191073.1|2960609_2961539_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186481.1|2961823_2963869_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_096317557.1|2964116_2966390_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_106505224.1|2966447_2967947_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067509.1|2968182_2969088_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001345059.1|2969259_2969589_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|2969593_2969779_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900974.1|2969775_2972415_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|2972622_2973612_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001295716.1|2973722_2974145_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2974141_2974408_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_096245442.1|2974681_2978206_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_047643691.1|2978572_2979706_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	6.3e-118
WP_001295593.1|2979846_2980281_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2980861_2981503_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2981584_2982214_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2982286_2982862_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_096317558.1|2982974_2983244_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	96.6	2.1e-43
WP_167582744.1|2983245_2984559_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.4	5.3e-76
WP_106508758.1|2984623_2985223_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	1.7e-109
WP_167582747.1|2985293_2988788_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	98.2	0.0e+00
WP_130069576.1|2989034_2989667_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.9	2.6e-97
WP_001505235.1|2989612_2990356_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	100.0	6.3e-151
WP_106505295.1|2990366_2991065_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.3	4.0e-131
WP_000847304.1|2991064_2991394_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_106645277.1|2991390_2993970_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.0	0.0e+00
WP_096245985.1|2993950_2994364_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_000479105.1|2994390_2994822_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_096939693.1|2994835_2995588_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	3.5e-133
WP_047089877.1|2995595_2995991_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_052907129.1|2995987_2996563_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.3	1.1e-49
WP_001204549.1|2996578_2996932_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	8.7e-42
WP_000201523.1|2996924_2997299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522630.1|2997350_2998379_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000256818.1|2998436_2998784_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001254038.1|2998820_3000326_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_001430223.1|3000315_3001908_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_000258991.1|3001904_3002111_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_106485645.1|3002094_3004023_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.0e-261
WP_000235436.1|3003994_3004504_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_064763377.1|3004898_3005123_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|3005204_3005519_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|3006046_3006232_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|3006453_3006567_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|3006787_3007321_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|3007480_3007753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167582750.1|3008001_3008214_-|holin	holin	holin	O48430	Enterobacteria_phage	98.5	1.7e-29
WP_167582753.1|3008661_3010512_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000466957.1|3011096_3011528_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|3012089_3012644_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_096245935.1|3012640_3012931_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	86.5	6.3e-46
WP_000940343.1|3012930_3013530_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	5.9e-107
WP_000687430.1|3013589_3013763_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	72.2	1.6e-17
WP_001013636.1|3013982_3014195_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001278454.1|3014383_3014488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208016.1|3014603_3015473_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	79.2	8.5e-123
WP_000209148.1|3015747_3015966_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_000935424.1|3015998_3016211_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	95.7	2.8e-35
WP_001141110.1|3016316_3016739_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_001370676.1|3016754_3017516_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	2.0e-120
WP_096245387.1|3017537_3018284_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	1.4e-113
WP_000899743.1|3018290_3019148_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	94.4	4.0e-80
WP_000702023.1|3019160_3019583_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_096245386.1|3019566_3019842_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	97.6	2.2e-40
WP_000753628.1|3019949_3020411_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	100.0	3.4e-78
WP_047085833.1|3020664_3020817_+	DUF1391 family protein	NA	NA	NA	NA	NA
WP_000887681.1|3021228_3022077_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_000560226.1|3022123_3022345_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_000245528.1|3022338_3022515_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	93.1	9.7e-26
WP_096306341.1|3022964_3025655_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	91.1	4.0e-163
WP_000166317.1|3025647_3026457_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_096245389.1|3026513_3026708_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	90.6	2.7e-29
WP_001302840.1|3026700_3026889_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|3026988_3027204_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_162829242.1|3027451_3028665_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_001157382.1|3029806_3030742_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
WP_000123745.1|3030870_3032244_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
>prophage 14
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	3111731	3175598	5615389	tail,capsid,integrase,protease,head,holin,terminase	Stx2-converting_phage(29.79%)	72	3125510:3125537	3175735:3175762
WP_000422045.1|3111731_3112781_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559281.1|3113000_3113759_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_001278906.1|3113755_3114346_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291220.1|3114385_3115258_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|3115358_3115979_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|3115975_3116857_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|3116994_3117039_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194584.1|3117130_3118693_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|3118692_3120288_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|3120291_3121650_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|3121661_3122855_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|3122854_3123661_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807649.1|3124041_3124221_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|3124306_3124807_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|3124852_3125359_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
3125510:3125537	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_085562200.1|3127190_3130577_+	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	99.3	0.0e+00
WP_123057446.1|3130754_3131324_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.3	2.0e-56
WP_001023379.1|3131437_3131707_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_000279017.1|3131708_3133022_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_024184441.1|3133086_3133710_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.8	2.7e-70
WP_167582762.1|3133778_3137255_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.5	0.0e+00
WP_072148784.1|3137491_3138124_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	2.9e-104
WP_167582765.1|3138069_3138813_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	1.1e-147
WP_001448747.1|3138818_3139517_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	99.1	1.6e-132
WP_000807964.1|3139516_3139858_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_167582768.1|3139850_3143093_-|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	97.5	0.0e+00
WP_001453698.1|3143144_3143354_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3143449_3143824_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3143829_3144546_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133391.1|3144604_3144949_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573374.1|3144945_3145392_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3145388_3145739_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|3145748_3146075_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001063025.1|3148277_3148499_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173037.1|3148543_3150481_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.4	0.0e+00
WP_001372135.1|3150544_3152206_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	100.0	0.0e+00
WP_000958420.1|3152202_3152766_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	99.5	1.8e-89
WP_000829192.1|3153054_3153420_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_001428130.1|3153461_3153647_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	92.3	1.3e-20
WP_000347013.1|3153776_3153917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3154273_3154498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3154562_3154769_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3154996_3155143_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_167582771.1|3155142_3155712_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	98.9	5.8e-104
WP_032343426.1|3155982_3156516_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	7.4e-101
WP_000731221.1|3156566_3156911_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|3156915_3157131_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_167582774.1|3157280_3159134_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_000216649.1|3159448_3159616_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	70.6	5.4e-10
WP_096317757.1|3160657_3161347_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	5.3e-59
WP_000140002.1|3161343_3161709_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001265290.1|3161709_3162765_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
WP_010917803.1|3162766_3163045_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3163114_3163372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|3163592_3163805_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_096245793.1|3164091_3164841_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_129935530.1|3165539_3165704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157825328.1|3166467_3167010_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3166921_3167962_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705622.1|3167933_3168485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3168468_3168696_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3168772_3169180_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3169444_3169744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3169816_3170035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3170057_3170465_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3170442_3170676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342117.1|3170669_3170837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449172.1|3171236_3171425_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|3171421_3171610_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048478.1|3171705_3174177_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|3174241_3174490_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3174467_3175598_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
3175735:3175762	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 15
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	3259111	3353579	5615389	tail,capsid,integrase,head,holin,transposase,tRNA,terminase	Escherichia_phage(35.29%)	111	3320235:3320250	3346459:3346474
WP_085949012.1|3259111_3259806_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
WP_000807626.1|3260809_3261271_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284276.1|3261347_3262007_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001297679.1|3262078_3262372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162540431.1|3262376_3262538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695218.1|3262608_3263010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056864.1|3263112_3263481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3264000_3264696_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3264719_3265532_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3265535_3265802_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001131446.1|3266552_3266672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001325743.1|3266632_3266818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|3266918_3267092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304448.1|3267153_3267438_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_000979977.1|3267441_3267777_+	YmgD family protein	NA	NA	NA	NA	NA
WP_167582777.1|3267833_3270155_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.0	3.0e-90
WP_001297677.1|3270271_3270481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299921.1|3270880_3271099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001246500.1|3271230_3272754_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_001065752.1|3273085_3273334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888772.1|3273446_3273713_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000857995.1|3273741_3274014_-	two-component-system connector protein YmgA	NA	NA	NA	NA	NA
WP_000554144.1|3274056_3274293_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_001299269.1|3274606_3275818_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000332303.1|3276022_3276754_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|3276974_3277379_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032141808.1|3277431_3277542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001307134.1|3278074_3278398_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_085949012.1|3278453_3279148_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
WP_000444487.1|3279274_3280525_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248691.1|3280696_3281350_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3281359_3281821_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|3281874_3282981_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|3283016_3283658_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_096245660.1|3283661_3285032_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.1e-108
WP_001265481.1|3285199_3285871_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|3285870_3287331_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|3287406_3288528_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359438.1|3288673_3289903_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|3290152_3291289_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799402.1|3291272_3292136_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001435497.1|3292368_3292533_-|tail	tail fiber assembly domain protein	tail	K7PMH7	Enterobacteria_phage	87.5	2.2e-16
WP_001132151.1|3292749_3293340_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144080.1|3293523_3294174_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001299273.1|3294248_3295307_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_089613097.1|3295434_3296070_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_096245963.1|3296142_3296724_-	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	54.8	1.0e-47
WP_001131642.1|3297014_3297590_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_053921583.1|3297702_3297972_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	9.3e-44
WP_167582694.1|3297973_3299287_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	98.6	3.1e-76
WP_167582691.1|3299351_3299975_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	1.3e-69
WP_167582996.1|3300043_3302479_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	93.6	0.0e+00
WP_162829242.1|3302480_3303693_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_072148784.1|3305084_3305717_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	2.9e-104
WP_167582780.1|3305662_3306406_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	7.3e-147
WP_001448747.1|3306411_3307110_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	99.1	1.6e-132
WP_000807964.1|3307109_3307451_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_167582768.1|3307443_3310686_-|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	97.5	0.0e+00
WP_001453698.1|3310737_3310947_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3311042_3311417_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3311422_3312139_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133391.1|3312197_3312542_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573374.1|3312538_3312985_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3312981_3313332_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|3313341_3313668_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001063025.1|3315870_3316092_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173037.1|3316136_3318074_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.4	0.0e+00
WP_001372135.1|3318137_3319799_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	100.0	0.0e+00
WP_000958416.1|3319795_3320359_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
3320235:3320250	attL	TTTGCCAGCTGCGAGC	NA	NA	NA	NA
WP_000279796.1|3320649_3321015_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_096317800.1|3321056_3321281_+	YlcI/YnfO family protein	NA	A0A0P0ZCG8	Stx2-converting_phage	76.1	2.3e-19
WP_001302717.1|3321362_3321677_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085949012.1|3321970_3322665_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
WP_012816791.1|3322977_3323163_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000455406.1|3323390_3323540_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_167582783.1|3323539_3324106_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	96.8	2.7e-101
WP_032343426.1|3324376_3324910_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	7.4e-101
WP_000731221.1|3324960_3325305_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|3325309_3325525_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_167582786.1|3325674_3327528_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_000466957.1|3328113_3328545_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000576620.1|3329086_3330031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762843.1|3330167_3330983_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	84.1	5.9e-118
WP_001258397.1|3330982_3331840_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	92.3	1.6e-150
WP_000844629.1|3331839_3332808_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	99.4	5.5e-187
WP_106485625.1|3332809_3334468_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	95.7	0.0e+00
WP_021501352.1|3334579_3334942_-	hypothetical protein	NA	A0A1B5FPB1	Escherichia_phage	96.7	9.5e-60
WP_000402986.1|3335953_3336409_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000930864.1|3336521_3336965_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	45.6	1.6e-08
WP_096317488.1|3336966_3337158_+	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	93.7	9.5e-27
WP_096317487.1|3337154_3337346_+	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	93.7	3.3e-27
WP_021501354.1|3337530_3337896_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	69.8	9.0e-34
WP_021501355.1|3337888_3338104_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	59.2	3.6e-14
WP_160392285.1|3338171_3338294_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	82.5	1.6e-11
WP_000566775.1|3338290_3338683_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	57.1	2.3e-35
WP_000734576.1|3338928_3339756_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	97.8	9.0e-130
WP_021501357.1|3339799_3340549_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	83.1	1.3e-116
WP_021501358.1|3340545_3341115_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	40.0	2.8e-29
WP_000457723.1|3341238_3341481_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_032240805.1|3341484_3341631_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	2.4e-22
WP_000528718.1|3341639_3341876_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_096317486.1|3341931_3343245_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	95.2	4.6e-245
WP_096317485.1|3343223_3343997_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.7e-72
WP_000252979.1|3344049_3344445_+	membrane protein	NA	NA	NA	NA	NA
WP_000019588.1|3344485_3345229_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564746.1|3345225_3346197_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176770.1|3346361_3348791_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
3346459:3346474	attR	TTTGCCAGCTGCGAGC	NA	NA	NA	NA
WP_001214304.1|3348815_3349916_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185741.1|3350303_3351050_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001300190.1|3351063_3351630_-	VOC family protein	NA	NA	NA	NA	NA
WP_096245663.1|3351845_3353579_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 16
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	3521534	3527841	5615389		Enterobacteria_phage(33.33%)	6	NA	NA
WP_001556101.1|3521534_3522083_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.6	1.2e-50
WP_000857502.1|3522087_3522966_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	5.1e-107
WP_032151758.1|3523023_3523923_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	4.4e-29
WP_033560781.1|3523922_3525008_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.8e-101
WP_000183060.1|3525378_3526272_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_040079813.1|3526446_3527841_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	8.3e-19
>prophage 17
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	3578469	3679664	5615389	tail,capsid,integrase,head,holin,tRNA,terminase	Enterobacteria_phage(35.0%)	112	3626459:3626479	3677170:3677190
WP_000476011.1|3578469_3579831_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_000716757.1|3580160_3580478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|3580892_3581792_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|3581873_3582653_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|3582752_3583793_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|3583840_3585196_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823272.1|3585199_3585484_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182914.1|3585514_3585967_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853886.1|3585976_3587239_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000289788.1|3587267_3588122_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|3588432_3589485_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858498.1|3589741_3591019_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846217.1|3591015_3592020_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011957.1|3592016_3592982_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|3592955_3593702_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297420.1|3593753_3594572_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000822274.1|3594636_3595437_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195587.1|3595433_3596222_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|3596444_3596717_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_096245479.1|3596837_3597662_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|3597880_3598219_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001026152.1|3598300_3599335_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_096245480.1|3599348_3601829_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677395.1|3601844_3602519_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|3602599_3603142_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|3603433_3603715_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|3603977_3605087_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|3605218_3607252_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_106485504.1|3607392_3610881_+	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000356831.1|3610890_3614523_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636917.1|3614584_3614902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096245940.1|3616141_3617230_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_096317407.1|3617240_3619520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001292774.1|3619512_3620649_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_032345200.1|3620645_3622646_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|3622770_3623232_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950404.1|3623271_3623742_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000598641.1|3623788_3624508_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_167582815.1|3624504_3626190_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
3626459:3626479	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261972.1|3626704_3626953_+	DinI-like family protein	NA	H6WZN4	Escherichia_phage	97.6	4.5e-37
WP_001371770.1|3627157_3628366_+	hypothetical protein	NA	H6WZN3	Escherichia_phage	99.3	8.5e-230
WP_167582818.1|3628811_3629705_+	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_106485502.1|3629830_3630100_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	94.4	1.0e-42
WP_159120681.1|3630101_3631415_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	3.0e-79
WP_167582821.1|3631479_3632079_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	95.0	5.0e-106
WP_167582824.1|3632145_3635622_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.5	0.0e+00
WP_000649829.1|3635755_3636283_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_153069652.1|3636473_3637106_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	2.9e-104
WP_167582780.1|3637051_3637795_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	7.3e-147
WP_001448747.1|3637800_3638499_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	99.1	1.6e-132
WP_000807964.1|3638498_3638840_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_167582768.1|3638832_3642075_-|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	97.5	0.0e+00
WP_001453698.1|3642126_3642336_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3642431_3642806_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3642811_3643528_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133391.1|3643586_3643931_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573374.1|3643927_3644374_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3644370_3644721_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|3644730_3645057_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001063025.1|3647583_3647805_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173037.1|3647849_3649787_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.4	0.0e+00
WP_001372135.1|3649850_3651512_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	100.0	0.0e+00
WP_000958420.1|3651508_3652072_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	99.5	1.8e-89
WP_000829192.1|3652360_3652726_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|3652767_3652968_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|3653099_3653426_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012816791.1|3653826_3654012_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001280923.1|3654234_3654366_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661712.1|3654460_3655156_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_032254249.1|3655429_3655963_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	1.8e-99
WP_000731237.1|3656013_3656358_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	2.9e-58
WP_001299338.1|3656362_3656578_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	5.9e-33
WP_167582827.1|3656728_3658582_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_000466957.1|3659167_3659599_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_001204862.1|3660442_3660877_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	99.3	1.8e-81
WP_000144764.1|3660869_3661064_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_167582830.1|3661060_3661666_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	99.5	9.6e-97
WP_001004008.1|3661665_3662388_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
WP_096245860.1|3662462_3663140_-	phage antirepressor Ant	NA	A0A0P0ZC44	Stx2-converting_phage	98.2	1.3e-126
WP_001254256.1|3663415_3663598_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153269.1|3663594_3664122_-	phage N-6-adenine-methyltransferase	NA	H6WZI7	Escherichia_phage	99.4	1.2e-100
WP_000814576.1|3664118_3664565_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|3664521_3664758_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103674.1|3664768_3664984_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	98.6	2.2e-32
WP_016242498.1|3665070_3666447_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	9.7e-254
WP_096317692.1|3666443_3667331_-	replication protein	NA	A5VW95	Enterobacteria_phage	99.0	4.0e-144
WP_001244625.1|3667393_3667666_-	hypothetical protein	NA	G9L679	Escherichia_phage	98.9	7.9e-43
WP_000438534.1|3667688_3667985_-	hypothetical protein	NA	G9L678	Escherichia_phage	98.0	2.0e-47
WP_000437872.1|3668091_3668292_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	98.5	5.6e-30
WP_096317693.1|3668392_3669106_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	95.4	2.1e-127
WP_159181587.1|3669323_3669686_+	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	51.4	8.1e-19
WP_123004627.1|3670285_3670627_+	hypothetical protein	NA	F1C5C1	Cronobacter_phage	67.3	1.8e-31
WP_000387877.1|3670630_3670954_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	98.1	2.5e-59
WP_000394579.1|3670991_3671282_+	hypothetical protein	NA	K7PH98	Enterobacteria_phage	76.8	4.6e-33
WP_000972063.1|3671623_3671758_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243354.1|3671742_3671895_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000010964.1|3671891_3672050_+	hypothetical protein	NA	A0A088CPT7	Enterobacteria_phage	100.0	3.1e-23
WP_000031370.1|3672151_3672757_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_000951334.1|3672756_3673140_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_001111278.1|3673163_3673457_+	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_096246019.1|3673467_3673632_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	7.1e-23
WP_096317426.1|3673628_3674192_+	hypothetical protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	81.5	2.4e-41
WP_053879252.1|3674193_3674385_+	hypothetical protein	NA	G9L660	Escherichia_phage	92.1	1.2e-24
WP_096245603.1|3674387_3675071_+	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	50.6	2.5e-61
WP_000457728.1|3675158_3675401_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|3675404_3675539_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|3675557_3675812_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|3675845_3677132_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_029208472.1|3677152_3677854_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.9e-102
3677170:3677190	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216961.1|3677913_3678021_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3678001_3678733_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569327.1|3678737_3679664_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 18
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	3765465	3842210	5615389	tail,capsid,integrase,protease,portal,lysis,head,holin,transposase,terminase	Enterobacteria_phage(42.03%)	82	3777865:3777900	3844429:3844464
WP_000849214.1|3765465_3765954_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758074.1|3766102_3767749_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422230.1|3767966_3769610_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|3769685_3770336_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|3770335_3771400_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|3771473_3772529_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|3772640_3773732_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249127.1|3774470_3777143_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|3777159_3777810_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
3777865:3777900	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
WP_000876014.1|3778009_3780859_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001225855.1|3781133_3781910_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|3781914_3783564_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_129935148.1|3783564_3787959_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025664.1|3788760_3790083_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
WP_102384962.1|3790845_3792073_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_032321283.1|3792112_3792760_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.3	1.4e-37
WP_001023380.1|3792969_3793239_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
WP_167582833.1|3793240_3794431_-|tail	phage tail protein	tail	A0A0P0ZDE7	Stx2-converting_phage	96.6	2.7e-79
WP_001228241.1|3794495_3795095_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_167582836.1|3795162_3798642_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	90.1	0.0e+00
WP_000090884.1|3798702_3799335_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_097412220.1|3799271_3800015_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.5e-147
WP_167582612.1|3800020_3800719_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	9.5e-133
WP_000847413.1|3800718_3801048_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_096961651.1|3801044_3803606_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.7	0.0e+00
WP_000533431.1|3803586_3804000_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|3804026_3804458_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_159181577.1|3804471_3805224_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	4.9e-127
WP_001429674.1|3806534_3806891_-	hypothetical protein	NA	A0A2R9YJI2	Escherichia_phage	87.7	4.1e-47
WP_000975037.1|3806887_3807463_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|3807477_3807831_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|3807823_3808198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167582839.1|3808249_3809134_-|capsid	major capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	54.4	2.9e-94
WP_000256818.1|3809191_3809539_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001254038.1|3809575_3811081_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_001430223.1|3811070_3812663_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_000258991.1|3812659_3812866_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_106485645.1|3812849_3814778_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.0e-261
WP_000235436.1|3814749_3815259_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001427981.1|3815653_3815848_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000738423.1|3816207_3816501_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|3816591_3816774_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000075153.1|3816990_3817488_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
WP_000284524.1|3817487_3817703_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3817845_3818244_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3818324_3818483_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3818568_3819312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001028854.1|3820184_3820850_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223927.1|3820846_3821449_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001108084.1|3821423_3821990_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001429269.1|3822483_3824319_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001254228.1|3824822_3825005_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_000153270.1|3825001_3825529_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000810176.1|3825525_3825972_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000229807.1|3825979_3826186_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000145926.1|3826258_3826549_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788878.1|3826545_3827247_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_167582842.1|3827243_3827774_-	hypothetical protein	NA	C1JJ53	Enterobacteria_phage	99.3	3.6e-84
WP_000276885.1|3827883_3828069_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_001095982.1|3828149_3828800_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000256573.1|3829114_3829420_+	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_000930321.1|3829422_3829761_+	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000167595.1|3829894_3830365_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065385.1|3830514_3830883_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_001198860.1|3830955_3831120_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372926.1|3831088_3831253_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
WP_000995439.1|3831307_3831604_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_096317335.1|3831609_3832395_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	4.1e-148
WP_000186740.1|3832391_3833069_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|3833068_3833251_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|3833223_3833415_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|3833425_3833707_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763358.1|3833805_3834027_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_001289868.1|3834023_3834629_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	96.9	1.7e-45
WP_001345188.1|3834625_3834976_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
WP_000457736.1|3835050_3835293_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
WP_096317333.1|3835411_3835756_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	1.2e-59
WP_001444001.1|3835861_3836080_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|3836057_3837128_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215757.1|3837122_3837749_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012296.1|3837745_3839434_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_072668323.1|3839582_3842210_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.6	2.1e-92
3844429:3844464	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
>prophage 19
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	3963948	4003695	5615389	integrase,protease,lysis,portal,holin,transposase,terminase	Enterobacteria_phage(41.51%)	54	3960679:3960695	4008999:4009015
3960679:3960695	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_167583002.1|3963948_3965106_+|integrase	prophage integrase IntS	integrase	K7P7E1	Enterobacteria_phage	98.7	5.3e-221
WP_167582851.1|3965519_3966644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167582854.1|3968860_3971254_-	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	96.3	0.0e+00
WP_167582857.1|3971254_3972565_-	phage DNA ejection protein	NA	A0A2D1GLX5	Escherichia_phage	88.3	2.5e-195
WP_167582860.1|3972574_3973270_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	94.9	2.7e-87
WP_167582863.1|3973272_3973728_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.7	4.4e-86
WP_074517021.1|3973727_3974576_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.3e-103
WP_167582866.1|3974575_3975994_-	hypothetical protein	NA	A0A2D1GM00	Escherichia_phage	99.2	6.0e-275
WP_024245630.1|3976002_3976485_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	98.8	9.3e-87
WP_000375639.1|3976459_3976645_-	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	4.6e-26
WP_015973865.1|3976687_3977959_-	hypothetical protein	NA	Q716H0	Shigella_phage	100.0	1.0e-241
WP_000426736.1|3977970_3978855_-	hypothetical protein	NA	Q716H1	Shigella_phage	100.0	4.7e-145
WP_167582869.1|3978868_3980995_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.0	0.0e+00
WP_106505185.1|3980997_3982410_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.6	3.7e-277
WP_000179913.1|3982406_3982832_-	hypothetical protein	NA	Q716H4	Shigella_phage	90.8	5.0e-68
WP_167582872.1|3982911_3983154_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	98.8	4.9e-36
WP_167582875.1|3983381_3983924_-	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	99.4	7.0e-99
WP_001139677.1|3984131_3984284_-	hypothetical protein	NA	A0A088CQ22	Enterobacteria_phage	98.0	8.1e-21
WP_106505186.1|3984271_3984736_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	94.8	1.9e-73
WP_053902255.1|3984732_3985209_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	3.7e-88
WP_000783734.1|3985192_3985516_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001235460.1|3986186_3986810_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_167582878.1|3986990_3987353_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	99.2	1.0e-61
WP_167582881.1|3987349_3987640_-	DUF1364 domain-containing protein	NA	A5VW86	Enterobacteria_phage	99.0	2.2e-51
WP_001279421.1|3987639_3987909_-	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_000950962.1|3987901_3988078_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_000386657.1|3988077_3988437_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.8	1.2e-62
WP_167582884.1|3988418_3988616_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	98.3	3.4e-27
WP_167582887.1|3988612_3989140_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	99.4	1.6e-100
WP_000736903.1|3989136_3989577_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_167582890.1|3989653_3991090_-	AAA family ATPase	NA	G5DA90	Enterobacteria_phage	99.8	1.4e-274
WP_167582893.1|3991079_3992111_-	DNA replication protein	NA	A0A0N7C1Z7	Escherichia_phage	86.6	2.8e-157
WP_167582896.1|3992103_3992250_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	97.9	1.5e-19
WP_000438538.1|3992282_3992582_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	4.8e-49
WP_000067727.1|3992691_3992907_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_014532159.1|3992982_3993678_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	97.0	2.0e-130
WP_123055380.1|3994031_3994367_+	hypothetical protein	NA	F1C5C1	Cronobacter_phage	67.6	5.9e-32
WP_000167595.1|3994375_3994846_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_001198861.1|3995036_3995201_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_001484321.1|3995169_3995313_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	95.7	1.8e-17
WP_000995439.1|3995388_3995685_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3995690_3996476_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000611716.1|3996472_3997153_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000149544.1|3997149_3997332_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|3997304_3997496_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|3997506_3997788_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763383.1|3997886_3998108_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_167582899.1|3998104_3998842_+	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	94.3	3.4e-120
WP_106505152.1|3998801_3998993_+	hypothetical protein	NA	G9L660	Escherichia_phage	95.2	1.8e-25
WP_106505151.1|3998995_3999811_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	44.2	2.9e-48
WP_167582902.1|3999940_4000684_+	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	98.4	1.7e-143
WP_153069633.1|4000740_4001040_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	98.0	6.0e-52
WP_001163428.1|4001148_4001349_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_085949012.1|4003001_4003695_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
4008999:4009015	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 20
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	4182131	4267801	5615389	tail,integrase,head,holin,transposase,tRNA,terminase	Salmonella_phage(41.51%)	90	NA	NA
WP_000940018.1|4182131_4182869_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553451.1|4182987_4183791_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_001299515.1|4183935_4184790_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000982994.1|4184980_4186261_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_000244193.1|4186252_4187392_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000423261.1|4187551_4188442_-	DNA-binding transcriptional regulator HcaR	NA	NA	NA	NA	NA
WP_096245398.1|4188577_4189939_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_001276072.1|4189935_4190454_+	3-phenylpropionate/cinnamic acid dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_001080102.1|4190453_4190774_+	bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_001281377.1|4190770_4191583_+	3-(cis-5,6-dihydroxycyclohexa-1, 3-dien-1-yl)propanoate dehydrogenase	NA	NA	NA	NA	NA
WP_000660797.1|4191592_4192795_+	phenylpropionate dioxygenase ferredoxin reductase subunit	NA	NA	NA	NA	NA
WP_001094726.1|4192891_4193314_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000158547.1|4193361_4194234_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_000700816.1|4194245_4195340_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_001276671.1|4195372_4196371_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000493455.1|4196395_4197907_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	9.6e-13
WP_001124887.1|4197929_4198913_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_167582908.1|4199009_4202291_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
WP_001200780.1|4202408_4203602_+	ROK family protein	NA	NA	NA	NA	NA
WP_000919159.1|4203665_4204919_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|4205246_4206437_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|4206481_4206820_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|4206880_4208215_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215888.1|4208204_4208918_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001341630.1|4209082_4210510_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.9e-16
WP_000970119.1|4211085_4214973_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.3	9.1e-132
WP_000734212.1|4215230_4216787_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001295367.1|4216783_4217320_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190655.1|4217344_4217980_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001013779.1|4218188_4219037_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_167583005.1|4219227_4219620_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	43.2	8.0e-12
WP_106485484.1|4219641_4220082_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.0	6.2e-53
WP_096317320.1|4220053_4220647_-|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	64.9	1.8e-60
WP_001115577.1|4220646_4221141_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	94.1	1.3e-80
WP_167582911.1|4221170_4221470_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	89.9	1.5e-39
WP_001300563.1|4221636_4222749_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_054579756.1|4222839_4223685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001253100.1|4223986_4224253_-	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	83.0	2.7e-35
WP_167567394.1|4224669_4225290_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	74.0	2.3e-85
WP_162829242.1|4225273_4226487_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_001197073.1|4226659_4227859_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.6	4.9e-185
WP_001270632.1|4227858_4228212_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	9.0e-55
WP_000301079.1|4228211_4228964_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.9	5.0e-87
WP_000110002.1|4229028_4229457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050470.1|4229456_4230188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001214055.1|4230337_4230679_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	86.8	2.5e-33
WP_000081738.1|4230682_4231744_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	82.3	4.5e-158
WP_000155119.1|4231746_4232049_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	2.2e-49
WP_001420197.1|4232048_4232636_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	6.9e-84
WP_162829242.1|4234174_4235388_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_001254932.1|4236031_4237183_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000393958.1|4237334_4237787_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.0	1.8e-55
WP_000109249.1|4237790_4238231_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_054579873.1|4238241_4239387_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.2	2.3e-160
WP_054579874.1|4239390_4239954_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	5.8e-80
WP_054579875.1|4239928_4240318_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	7.3e-66
WP_054579876.1|4240304_4240859_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	82.6	5.7e-80
WP_001125665.1|4240855_4241263_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	8.7e-70
WP_001473318.1|4241491_4242433_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	1.4e-155
WP_001066723.1|4242444_4242951_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.5	2.9e-70
WP_021529141.1|4242954_4244175_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.3	1.4e-200
WP_137530144.1|4244189_4244924_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	84.2	2.2e-95
WP_000113490.1|4244814_4246281_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	6.7e-261
WP_054579877.1|4246280_4247903_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
WP_024246483.1|4247975_4248182_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000162795.1|4248215_4248788_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	6.1e-61
WP_024246484.1|4248849_4249374_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	67.7	1.5e-42
WP_024246485.1|4249357_4249834_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	95.6	2.3e-85
WP_000781776.1|4249837_4250179_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001174014.1|4250624_4250966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244506.1|4250997_4251420_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
WP_000868571.1|4251465_4251696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096245616.1|4254283_4254484_-	transcriptional regulator	NA	K7RWG7	Bacteriophage	50.0	1.0e-07
WP_096245617.1|4254625_4255300_+	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	51.1	3.0e-59
WP_096245618.1|4255727_4256246_-	hypothetical protein	NA	K7P861	Enterobacteria_phage	52.4	1.9e-37
WP_000801672.1|4256470_4256620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051353.1|4256616_4257519_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_021529149.1|4257521_4258823_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.7	2.3e-132
WP_000769011.1|4258838_4259387_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	1.6e-66
WP_096306367.1|4259438_4260077_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	69.8	1.0e-72
WP_000490740.1|4260144_4260414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054579863.1|4260470_4262534_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.5	2.3e-275
WP_000008820.1|4262539_4262755_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000637722.1|4262751_4263051_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	64.2	5.5e-29
WP_054579864.1|4263040_4263322_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	64.0	1.7e-27
WP_042043889.1|4263304_4264237_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	39.0	6.5e-52
WP_054579865.1|4264340_4265735_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.5	1.9e-212
WP_054579866.1|4265731_4265932_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054579867.1|4265928_4267326_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000054752.1|4267540_4267801_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
>prophage 21
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	4402162	4409302	5615389		Escherichia_phage(83.33%)	6	NA	NA
WP_096317340.1|4402162_4404724_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.9e-30
WP_001141347.1|4404829_4405486_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001297141.1|4405536_4406304_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|4406499_4407408_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|4407404_4408667_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|4408663_4409302_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 22
NZ_CP047378	Escherichia coli strain CAU16175 chromosome, complete genome	5615389	4653183	4719332	5615389	integrase,protease,tRNA,transposase	Escherichia_phage(22.22%)	55	4643711:4643726	4725043:4725058
4643711:4643726	attL	CTGGTATCAGCGTTTA	NA	NA	NA	NA
WP_001297457.1|4653183_4653942_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_001169551.1|4653997_4654741_-	2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_096245744.1|4654727_4655834_-	D-glucosaminate-6-phosphate ammonia lyase	NA	NA	NA	NA	NA
WP_160333632.1|4655837_4656698_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_000380263.1|4656694_4657444_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001284302.1|4657469_4657955_-	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_000214203.1|4657965_4658394_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001252647.1|4658512_4661311_-	transcriptional regulator DagR	NA	NA	NA	NA	NA
WP_000105566.1|4661569_4662490_-	agmatinase	NA	NA	NA	NA	NA
WP_000758903.1|4662625_4663357_-	membrane protein	NA	NA	NA	NA	NA
WP_001295380.1|4663502_4665479_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001338822.1|4665487_4665619_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|4665754_4665970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|4666273_4667428_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_085949012.1|4667651_4668345_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
WP_001112301.1|4668637_4670032_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|4670108_4670606_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|4670700_4671408_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|4671487_4672219_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|4672231_4673182_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000126441.1|4673218_4673854_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|4673853_4674270_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001055633.1|4674445_4675426_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|4675443_4676148_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|4676165_4676732_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|4676728_4677019_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174743.1|4677026_4677620_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239919.1|4677612_4678749_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000784004.1|4679060_4680047_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577033.1|4680091_4680595_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000745217.1|4681951_4682959_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394117.1|4683075_4684122_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|4684297_4685017_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|4685200_4685527_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|4685526_4686246_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001321419.1|4686406_4687459_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|4687486_4687762_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|4687826_4688906_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|4689107_4690364_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839764.1|4690413_4692549_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234514.1|4692946_4693654_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_167582929.1|4694032_4695295_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	2.0e-80
WP_000286652.1|4698280_4701130_+	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	39.6	2.2e-183
WP_001273465.1|4701155_4702136_+	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	30.2	4.2e-17
WP_000126413.1|4702145_4704533_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000105162.1|4704542_4706171_+	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	42.6	4.6e-85
WP_000081335.1|4706173_4709044_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_024237546.1|4709132_4709426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000747051.1|4709495_4709846_+|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
WP_000005572.1|4711471_4712758_-	McrC family protein	NA	NA	NA	NA	NA
WP_000366615.1|4712750_4714808_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	33.8	2.9e-36
WP_001013334.1|4715580_4716006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096098544.1|4716002_4716392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001545062.1|4716645_4717215_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_096098543.1|4718118_4719332_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	1.8e-102
4725043:4725058	attR	CTGGTATCAGCGTTTA	NA	NA	NA	NA
>prophage 1
NZ_CP047379	Escherichia coli strain CAU16175 plasmid pCAU16175_1, complete sequence	190219	59427	113434	190219	integrase,protease,transposase	Escherichia_phage(41.18%)	57	53535:53550	114195:114210
53535:53550	attL	CAAAAAAGTAACTTTG	NA	NA	NA	NA
WP_000795947.1|59427_60603_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|60773_60986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232449.1|61346_62429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284313.1|62595_64095_-	kinase	NA	NA	NA	NA	NA
WP_000081622.1|64120_65758_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|65757_66798_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|66883_67522_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|67521_68163_-	TerD family protein	NA	NA	NA	NA	NA
WP_001253657.1|68185_68824_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|69286_69754_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|69771_70980_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|70990_71947_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182411.1|71946_73026_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	8.1e-38
WP_001040056.1|73027_73801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|73793_74936_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001035166.1|74945_76004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254140.1|76326_76908_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001054789.1|76907_78065_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|78087_78543_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|78565_79606_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|79654_80233_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301242.1|80300_80876_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|81304_82546_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|83108_83390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|83439_83631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151575.1|83722_84064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|84436_84829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|85432_85726_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|85730_87056_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|87116_87323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|87424_87835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|87847_88663_+	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
WP_001043843.1|88916_89342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572440.1|90087_90387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032192809.1|90699_92739_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	24.8	2.5e-24
WP_001572342.1|92735_93722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194555.1|94752_94956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287392.1|95297_95702_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000175476.1|96199_96436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572344.1|96477_96933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|96992_97658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001426317.1|97715_98096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|98738_99557_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|99553_100759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|101038_102358_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000220758.1|102380_102548_-	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
WP_001067855.1|103946_104651_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063102497.1|105278_105665_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_057109146.1|105984_106377_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_001067858.1|106711_107416_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_167583015.1|108395_108962_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.1e-49
WP_001067858.1|108986_109691_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000454193.1|110199_110550_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|110768_111473_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001167416.1|111683_112445_+	methyltransferase	NA	A0A2I7RNS1	Vibrio_phage	32.9	1.2e-19
WP_000149861.1|112538_112802_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	46.5	3.2e-09
WP_001572415.1|112822_113434_+	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	71.1	1.2e-09
114195:114210	attR	CAAAAAAGTAACTTTG	NA	NA	NA	NA
>prophage 2
NZ_CP047379	Escherichia coli strain CAU16175 plasmid pCAU16175_1, complete sequence	190219	121583	164000	190219	transposase	Escherichia_phage(50.0%)	44	NA	NA
WP_001067858.1|121583_122288_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_046788546.1|123379_123781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|123865_124570_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|125494_126379_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|126595_127810_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|127837_128143_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015344975.1|128254_129748_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|129778_130030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|129923_130226_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|130312_131128_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_085940648.1|131217_132307_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_165488106.1|132504_132876_-	phenol hydroxylase	NA	NA	NA	NA	NA
WP_000602738.1|134800_135553_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|135974_137000_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|137228_138005_-	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_001067855.1|138118_138823_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|138966_139521_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|139651_140482_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|140619_141252_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|141336_141789_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|142011_142359_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|142352_143192_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|143319_143523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|143747_144452_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071523897.1|145098_145344_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|145500_145998_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001067855.1|146402_147107_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|147296_148112_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|148262_148967_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000612791.1|149197_150061_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|150098_150344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|150812_151604_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_109023896.1|151606_151882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800531.1|152783_153116_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001206316.1|153285_154077_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|154169_155429_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001261740.1|155690_156482_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000050382.1|156539_157148_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001456218.1|157243_158086_-	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_001067858.1|159083_159788_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067855.1|160587_161292_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_167583018.1|161338_162940_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	7.2e-293
WP_001067855.1|162930_163635_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000844627.1|163757_164000_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP047380	Escherichia coli strain CAU16175 plasmid pCAU16175_2, complete sequence	161176	1262	93109	161176	transposase,integrase	Escherichia_phage(60.0%)	46	NA	NA
WP_001066942.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_032351338.1|2123_2267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024241295.1|2789_3164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000526859.1|3366_3546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024241296.1|3794_4232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045903391.1|4612_5116_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	97.1	1.4e-48
WP_162829242.1|6031_7245_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_167583024.1|8600_13304_-	DUF3491 domain-containing protein	NA	NA	NA	NA	NA
WP_001297096.1|21154_21934_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000905839.1|23829_24417_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_029797792.1|25862_25988_-	membrane protein	NA	NA	NA	NA	NA
WP_001418709.1|26096_26705_-	YjiK family protein	NA	NA	NA	NA	NA
WP_162829242.1|31776_32990_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_167583026.1|33041_33668_-	peptidase dimerisation domain-containing protein	NA	NA	NA	NA	NA
WP_000957857.1|34922_35111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032163645.1|49129_49828_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	42.5	1.6e-18
WP_167583051.1|49764_49989_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	73.3	1.8e-21
WP_000405636.1|50578_50848_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_096317679.1|54737_58679_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	39.2	2.2e-226
WP_032163643.1|58770_59238_+	EspF protein	NA	NA	NA	NA	NA
WP_096317678.1|59496_60658_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.6e-52
WP_000957857.1|62069_62258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161954550.1|63843_65151_+	iron reductase	NA	NA	NA	NA	NA
WP_096317730.1|65639_66221_+	secretion protein EspT	NA	NA	NA	NA	NA
WP_096317729.1|66412_66736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106485644.1|66871_67201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032216024.1|67309_68290_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	3.0e-185
WP_162829242.1|68617_69831_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_085949012.1|72201_72895_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
WP_001632354.1|73652_73811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064560668.1|73828_74176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311056.1|74471_74954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096245924.1|75070_75274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050439874.1|75922_76147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541974.1|76398_76728_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	45.1	6.3e-18
WP_000780222.1|76708_76990_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_167567414.1|77895_79058_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.3	1.0e-163
WP_001172748.1|79219_79609_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_167583029.1|79652_81860_-	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_085949012.1|82072_82767_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
WP_064560619.1|83365_87457_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	42.6	2.8e-285
WP_085949012.1|87659_88353_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
WP_000969996.1|88488_88770_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_044720349.1|88766_89036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077150956.1|89538_90162_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.7	3.4e-41
WP_072024409.1|90142_93109_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	38.2	1.6e-181
