The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050745	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 chromosome, complete genome	4970193	65645	100522	4970193	transposase,integrase	Escherichia_phage(44.44%)	34	60916:60945	81546:81575
60916:60945	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_000935451.1|65645_67361_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000344784.1|67363_68224_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000287615.1|68274_69819_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_001324342.1|69941_71465_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_001163403.1|71454_72237_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_000376623.1|72412_72913_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|73040_73880_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|73873_74221_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001209508.1|74384_75176_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001334766.1|75288_76119_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000845048.1|76328_77342_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|77544_77895_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|78020_78581_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|78583_81550_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000656305.1|81616_81994_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
81546:81575	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
WP_000412211.1|82194_82854_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_049802299.1|83826_84090_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|84082_84469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|84476_85163_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|85140_85764_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|85845_87051_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000428546.1|87163_87757_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_000449408.1|89083_89242_+	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
WP_000949452.1|89231_89738_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012372823.1|89920_90736_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000118029.1|91082_92969_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_000178050.1|93009_93537_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|93640_95020_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|95022_96306_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000729220.1|96295_97426_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|97430_98126_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	1.3e-17
WP_001267177.1|98112_98598_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|98622_99108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067834.1|99817_100522_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
>prophage 2
NZ_CP050745	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 chromosome, complete genome	4970193	1150249	1261304	4970193	head,capsid,holin,portal,integrase,tail,lysis,protease,tRNA,terminase,transposase	Salmonella_phage(35.09%)	114	1142087:1142103	1255525:1255541
1142087:1142103	attL	AATACCGTCAGTTCCCA	NA	NA	NA	NA
WP_000047224.1|1150249_1152880_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	3.5e-79
WP_000906486.1|1153114_1153300_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000271296.1|1154694_1155261_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.6	7.2e-14
WP_001279499.1|1155257_1155683_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611817.1|1155759_1157316_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130194.1|1157465_1157981_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000645139.1|1158326_1159697_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_001187300.1|1159745_1161284_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001275603.1|1161300_1162473_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378431.1|1162599_1163130_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_000165758.1|1163626_1164811_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216622.1|1164975_1165971_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000775022.1|1166040_1167105_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985529.1|1167097_1168300_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.8	1.4e-27
WP_000777903.1|1168654_1169614_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	6.1e-130
WP_000246626.1|1169624_1171769_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.7	1.7e-196
WP_001275401.1|1171741_1172152_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	3.3e-16
WP_000028870.1|1172148_1172394_-	glutaredoxin-like protein NrdH	NA	NA	NA	NA	NA
WP_000209813.1|1172665_1173097_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001138459.1|1173185_1174520_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001519557.1|1174603_1174930_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281305.1|1175091_1175442_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492669.1|1175476_1175926_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_001051100.1|1176624_1177026_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_000494942.1|1177115_1177295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000022009.1|1177373_1177901_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_000137432.1|1177910_1178210_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508175.1|1178392_1178551_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522406.1|1178650_1179100_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
WP_000126152.1|1179121_1179799_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000531282.1|1179840_1181241_-	GABA permease	NA	NA	NA	NA	NA
WP_001095556.1|1181370_1182654_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.1	6.0e-32
WP_001176529.1|1182668_1184117_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271907.1|1184138_1185407_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000993096.1|1185432_1186410_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000382035.1|1186712_1188227_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_001574835.1|1188237_1188672_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_000744413.1|1188683_1189661_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_001237934.1|1189815_1190490_+	transcriptional regulator TctD	NA	NA	NA	NA	NA
WP_000872348.1|1190476_1191892_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_001059352.1|1192024_1193038_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000701506.1|1193759_1194656_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000178733.1|1194948_1195878_-	VirK family antimicrobial peptide resistance protein	NA	NA	NA	NA	NA
WP_001738474.1|1196396_1197449_+	SPI-2 type III secretion system effector PipB2	NA	NA	NA	NA	NA
WP_014343883.1|1197623_1197956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001687277.1|1198481_1200662_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000274378.1|1200703_1201639_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001239941.1|1201670_1202915_-	esterase family protein	NA	NA	NA	NA	NA
WP_167787403.1|1203024_1206678_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	28.4	1.4e-44
WP_001221110.1|1206758_1207874_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_000178853.1|1210012_1210255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|1210293_1213656_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|1213717_1214365_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|1214262_1215000_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|1215006_1215705_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|1215714_1216044_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|1216046_1219142_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|1219113_1219452_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|1219448_1219844_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|1219894_1220641_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|1220648_1221050_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|1221158_1222289_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|1222337_1222916_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|1222943_1223327_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|1223337_1223697_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|1223754_1224783_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|1224837_1225185_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|1225197_1226694_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|1226683_1228264_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|1228260_1228464_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|1228447_1230379_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|1230350_1230896_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|1231182_1231584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|1231819_1232272_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|1232289_1232742_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|1232725_1233055_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110786.1|1233330_1234017_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	99.6	7.9e-132
WP_000657897.1|1234231_1234420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211409.1|1234926_1235490_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|1235762_1236440_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|1236436_1236577_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|1236573_1237185_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000929803.1|1237393_1237996_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_000807548.1|1238078_1238300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1238411_1238645_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_010989003.1|1238936_1239227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|1239304_1239616_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|1239612_1239960_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|1239970_1240720_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|1240722_1241706_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_167787404.1|1241790_1242165_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.1e-63
WP_000370145.1|1242130_1242370_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|1242489_1242900_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_010989055.1|1242949_1243210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|1243202_1243361_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_014344461.1|1243382_1243682_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	83.6	1.4e-48
WP_000017125.1|1243808_1246736_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_071892913.1|1246698_1247856_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|1247898_1248138_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|1248178_1248463_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|1248440_1249670_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|1250167_1250647_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|1250643_1251600_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|1251599_1252250_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|1252281_1252857_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|1252853_1253018_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|1253281_1254904_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|1254888_1255626_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
1255525:1255541	attR	AATACCGTCAGTTCCCA	NA	NA	NA	NA
WP_000219174.1|1255756_1257091_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|1257108_1258008_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|1258110_1258698_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|1258759_1259143_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|1259461_1260151_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|1260266_1261304_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP050745	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 chromosome, complete genome	4970193	1282436	1317044	4970193	head,capsid,holin,portal,integrase,tail,tRNA,terminase	Cronobacter_phage(64.52%)	41	1280889:1280904	1309052:1309067
1280889:1280904	attL	CCTTCGGGCGCGTTTT	NA	NA	NA	NA
WP_024136261.1|1282436_1284137_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	2.9e-223
WP_000200792.1|1284139_1284685_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_000267951.1|1284656_1285382_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000122989.1|1285371_1285926_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	97.2	4.6e-98
WP_025614139.1|1285938_1288182_-|tail	tail protein	tail	Q8HAB4	Salmonella_phage	72.7	3.4e-171
WP_001001823.1|1288191_1288779_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	8.4e-90
WP_000136921.1|1288771_1289956_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001002797.1|1289952_1290282_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811099.1|1290278_1292246_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	1.9e-271
WP_000411498.1|1292433_1292691_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	3.1e-20
WP_000376377.1|1292837_1293170_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	2.2e-34
WP_000175558.1|1293169_1293511_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154426.1|1293507_1293804_-|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_000166745.1|1293816_1294272_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
WP_000220185.1|1294268_1295396_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.9	1.6e-174
WP_000606932.1|1295392_1296097_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.5	2.0e-69
WP_000080872.1|1296093_1296576_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	4.0e-37
WP_031602415.1|1296572_1297064_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.3e-48
WP_000505908.1|1297118_1297310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167787427.1|1297328_1298027_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.0	2.7e-63
WP_001176504.1|1298038_1299067_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	1.7e-133
WP_031603163.1|1299101_1299941_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.0	4.8e-46
WP_001151938.1|1300151_1301936_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	69.7	1.8e-247
WP_000746493.1|1301932_1302952_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.5	1.0e-135
WP_000088096.1|1302951_1303275_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_000994502.1|1303302_1305960_-	hypothetical protein	NA	A0A077K8T2	Ralstonia_phage	47.5	4.6e-244
WP_031603162.1|1305998_1306217_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	37.7	8.9e-05
WP_000681786.1|1306219_1306789_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_167787405.1|1306798_1307131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661530.1|1307156_1307495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085723.1|1307603_1307903_+	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_024136262.1|1307969_1308962_+|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	4.7e-109
WP_010989056.1|1309125_1309173_+	hypothetical protein	NA	NA	NA	NA	NA
1309052:1309067	attR	CCTTCGGGCGCGTTTT	NA	NA	NA	NA
WP_000200080.1|1309272_1310433_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210995.1|1310393_1311302_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|1311359_1312481_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|1312490_1313561_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|1314000_1314519_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|1314511_1315732_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|1315888_1316236_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|1316276_1317044_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP050745	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 chromosome, complete genome	4970193	1345443	1378856	4970193	head,capsid,plate,integrase,portal,tail,lysis,terminase	Salmonella_phage(97.56%)	45	1345282:1345328	1378974:1379020
1345282:1345328	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_000980498.1|1345443_1345662_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_001010543.1|1345730_1346831_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.1	3.4e-193
WP_000980418.1|1346827_1347313_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	98.5	2.4e-66
WP_001282773.1|1347309_1350117_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	99.7	0.0e+00
WP_000763317.1|1350109_1350229_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
WP_001280967.1|1350243_1350546_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
WP_001207652.1|1350600_1351116_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
WP_000046109.1|1351125_1352298_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
WP_167787406.1|1352400_1352958_-	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	97.8	3.0e-97
WP_010989058.1|1352927_1354007_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	92.1	5.4e-183
WP_001287105.1|1354013_1354421_+|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	84.4	2.2e-60
WP_010989059.1|1354424_1355042_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	84.6	4.1e-95
WP_001274647.1|1355011_1356586_-|tail	tail protein	tail	A0A1S6KZZ8	Salmonella_phage	60.7	2.1e-156
WP_001086807.1|1356582_1357188_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.0	4.1e-116
WP_000268333.1|1357180_1358089_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	99.0	7.7e-159
WP_000177403.1|1358075_1358435_-|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	98.3	8.0e-59
WP_000993751.1|1358431_1359010_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	98.4	3.3e-107
WP_000343947.1|1359078_1359525_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.0	1.9e-65
WP_001039961.1|1359517_1359949_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_001648763.1|1360044_1360473_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_000871617.1|1360469_1360844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069932.1|1360848_1361358_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	3.5e-92
WP_000171565.1|1361338_1361554_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868168.1|1361557_1361761_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	98.5	1.1e-33
WP_000673534.1|1361760_1362225_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	1.9e-84
WP_000059178.1|1362318_1362972_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	98.6	4.6e-113
WP_000730755.1|1362975_1364058_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	97.7	1.6e-190
WP_000216276.1|1364074_1364908_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_001098444.1|1365050_1366817_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.3	0.0e+00
WP_001292071.1|1366816_1367857_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	93.0	2.4e-188
WP_071892914.1|1367942_1369694_-	AIPR family protein	NA	NA	NA	NA	NA
WP_014344476.1|1369907_1370585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|1370698_1370932_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154433.1|1370942_1371131_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_000301161.1|1371283_1373713_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.8	0.0e+00
WP_000104125.1|1373703_1374561_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.4	2.7e-129
WP_000785509.1|1374557_1374785_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
WP_001244234.1|1374784_1375018_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_000963195.1|1375085_1375427_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
WP_000166366.1|1375646_1376105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957775.1|1376052_1376286_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
WP_000460862.1|1376293_1376803_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	5.1e-83
WP_000102104.1|1376838_1377078_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
WP_000052560.1|1377194_1377827_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_001536726.1|1377830_1378856_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
1378974:1379020	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 5
NZ_CP050745	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 chromosome, complete genome	4970193	1401454	1438390	4970193	tail,transposase,integrase,tRNA	Salmonella_phage(27.27%)	33	1401563:1401579	1450652:1450668
WP_000088556.1|1401454_1402330_+|integrase	integrase	integrase	NA	NA	NA	NA
1401563:1401579	attL	CTGGCGCAGAATATTCA	NA	NA	NA	NA
WP_001521074.1|1402495_1404370_+	membrane protein	NA	NA	NA	NA	NA
WP_010989066.1|1404629_1405913_-	membrane protein	NA	NA	NA	NA	NA
WP_001682341.1|1406490_1407087_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	91.3	2.6e-99
WP_000061088.1|1408800_1409439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000073810.1|1409435_1411418_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_085983317.1|1411696_1412858_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
WP_000388997.1|1413638_1414178_-	phase 1 flagellin gene repressor FljA	NA	NA	NA	NA	NA
WP_000079794.1|1414245_1415766_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000190912.1|1416129_1416702_-	flagellar phase variation DNA invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	72.6	8.8e-68
WP_000593433.1|1417676_1418501_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1418490_1419069_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1419165_1419393_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1419499_1419712_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|1420464_1420584_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1421296_1421434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1421912_1423406_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1423810_1425610_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1425626_1426601_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1426874_1427555_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_080069629.1|1427551_1428457_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1428468_1429197_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1429208_1429940_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1429939_1430320_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1430431_1430692_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1430729_1431656_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|1431771_1432968_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684022.1|1432989_1433907_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1433945_1434794_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1434909_1435803_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1435813_1437175_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1437178_1437814_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1437838_1438390_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1450652:1450668	attR	TGAATATTCTGCGCCAG	NA	NA	NA	NA
>prophage 6
NZ_CP050745	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 chromosome, complete genome	4970193	1791451	1821044	4970193	tail,protease,holin	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|1791451_1791946_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1792359_1792851_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1792840_1793104_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1793100_1795587_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1795593_1796289_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1796275_1797145_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1797260_1797710_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1797719_1798322_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1798342_1798960_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|1798956_1799616_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1799667_1800405_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1800401_1800614_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1800610_1801090_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1801086_1803018_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1803014_1803572_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001238333.1|1803568_1804612_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1804655_1805303_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1806032_1806596_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1806787_1806991_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1807293_1808085_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1808381_1808585_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1808753_1811120_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1811448_1812438_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1812452_1812821_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894639.1|1812849_1814181_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1814477_1814807_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1815399_1816641_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1816643_1817171_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1817548_1817992_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1818045_1819875_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1820222_1820513_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1820540_1821044_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 7
NZ_CP050745	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 chromosome, complete genome	4970193	1893096	1902267	4970193	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1893096_1894044_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824855.1|1894027_1894759_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1894739_1894847_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1894906_1895638_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1895860_1897546_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1897542_1898262_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1898308_1898776_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1898832_1899363_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1899534_1899993_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1900233_1902267_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 8
NZ_CP050745	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 chromosome, complete genome	4970193	1970575	1981081	4970193		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1970575_1971979_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1972156_1973050_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1973426_1974512_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1974511_1975411_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1975458_1976337_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1976337_1976889_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1976894_1977887_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1977883_1978657_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1978661_1979741_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1979767_1981081_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 9
NZ_CP050745	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 chromosome, complete genome	4970193	2070424	2077678	4970193		Morganella_phage(33.33%)	8	NA	NA
WP_000394196.1|2070424_2070844_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|2070846_2072115_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|2072569_2072782_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2072792_2072981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|2073241_2074438_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|2075087_2075387_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|2075478_2076174_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|2076247_2077678_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 10
NZ_CP050745	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 chromosome, complete genome	4970193	2973718	3058453	4970193	holin,portal,integrase,tail,lysis,protease,tRNA,terminase	Salmonella_phage(43.64%)	93	2997812:2997831	3069599:3069618
WP_000938191.1|2973718_2974399_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2975019_2975679_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2975765_2976095_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2976091_2976373_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2976421_2977201_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2977226_2977775_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2977989_2979201_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2979258_2979576_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2979620_2980034_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2980207_2980870_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2980964_2981423_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2981458_2983513_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2983636_2984083_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2984101_2986255_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2986241_2986847_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2987063_2987573_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2987929_2988982_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2989053_2989506_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2989691_2991452_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2991520_2992039_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2992138_2992306_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2992561_2993125_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2993121_2994762_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2994766_2996020_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2996034_2997942_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2997812:2997831	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2997954_3000063_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|3000161_3001271_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|3001267_3001810_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|3001975_3002986_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|3003193_3005806_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|3006232_3006424_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|3006694_3007381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|3007365_3007665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|3007733_3008360_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001533476.1|3009007_3009976_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000143167.1|3010451_3011033_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_014344464.1|3011032_3013471_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|3013524_3013767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001687102.1|3013805_3014681_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_001541992.1|3014707_3017155_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	68.0	0.0e+00
WP_000246065.1|3017226_3017931_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|3017828_3018566_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|3018575_3019271_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|3019360_3019894_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|3020010_3020508_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|3020606_3020939_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|3020935_3023923_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|3024002_3024332_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|3024328_3024727_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|3024772_3025522_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|3025533_3025935_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|3025931_3026498_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|3026478_3026778_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|3026770_3027094_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|3027184_3029266_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001009207.1|3029189_3030737_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_000196190.1|3030733_3030940_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|3030936_3033075_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|3033031_3033565_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|3033772_3034252_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|3034269_3034722_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|3034705_3035035_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|3035310_3035997_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|3036357_3036807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|3036942_3037068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|3037241_3037559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|3037625_3038423_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|3038412_3038559_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|3038555_3039167_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_000929802.1|3039375_3039978_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_000807548.1|3040060_3040282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|3040393_3040627_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_010989003.1|3040918_3041209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|3041286_3041598_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|3041594_3041942_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|3041952_3042702_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|3042704_3043688_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_167787404.1|3043772_3044147_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.1e-63
WP_000370145.1|3044112_3044352_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|3044471_3044882_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_010989055.1|3044931_3045192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|3045184_3045343_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_014344461.1|3045364_3045664_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	83.6	1.4e-48
WP_020979158.1|3045790_3048676_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.2	0.0e+00
WP_001539618.1|3048638_3049796_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|3049838_3050078_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|3050118_3050367_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|3050411_3051704_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|3051898_3053101_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|3053178_3054615_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|3054859_3056074_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|3056390_3056852_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|3057052_3058453_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
3069599:3069618	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 11
NZ_CP050745	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 chromosome, complete genome	4970193	3122589	3131321	4970193	transposase,protease	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3122589_3123844_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3124307_3124766_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3124957_3127234_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3127264_3127585_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3127908_3128130_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3128259_3130206_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3130202_3131321_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 12
NZ_CP050745	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 chromosome, complete genome	4970193	3711926	3723022	4970193	transposase,integrase	Enterobacteria_phage(66.67%)	18	3697692:3697706	3731371:3731385
3697692:3697706	attL	GAGCAAAACGCCATC	NA	NA	NA	NA
WP_000915528.1|3711926_3712289_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_167787418.1|3712285_3712606_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	100.0	6.1e-34
WP_000957857.1|3712620_3712809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000948429.1|3712818_3714018_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_167787419.1|3714202_3714781_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	5.3e-113
WP_001253476.1|3714780_3715065_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111291.1|3715111_3715405_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001214777.1|3715415_3715586_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_000812203.1|3715582_3716092_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_071533029.1|3716088_3716322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025617570.1|3716308_3716953_+	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_000371199.1|3716952_3717237_+	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_000002104.1|3717229_3717514_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_155675089.1|3717582_3717723_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000051897.1|3717952_3719116_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_000893231.1|3719321_3720572_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|3720583_3721687_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|3721969_3723022_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
3731371:3731385	attR	GAGCAAAACGCCATC	NA	NA	NA	NA
>prophage 13
NZ_CP050745	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 chromosome, complete genome	4970193	4550280	4597324	4970193	tail,plate,tRNA	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4550280_4551279_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4551366_4552677_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4552923_4553439_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4553537_4553747_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4553768_4553882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4553878_4555204_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4555382_4555991_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4556099_4556468_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4556638_4559059_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4559157_4560030_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4560043_4560541_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4560721_4561639_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4561802_4563161_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4563249_4564359_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4564720_4565911_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4566042_4567587_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4567601_4568492_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4568657_4569068_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4569210_4571307_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4571306_4572044_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_022742863.1|4572040_4572709_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4572742_4572985_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4573428_4575078_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4575422_4576772_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4576904_4577252_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4577827_4578115_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270442.1|4578117_4578723_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	4.2e-60
WP_000777266.1|4578735_4579050_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4579209_4579665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4579661_4579859_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4579848_4581276_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4581275_4581800_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4581851_4582169_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4582128_4582257_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4582353_4584708_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4584707_4585661_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4585660_4585870_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4585857_4586901_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4586910_4587633_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4587960_4588323_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4588319_4589249_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4589248_4590796_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4590959_4591319_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4591309_4592425_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4592417_4593050_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4593052_4594798_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4594802_4595408_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4595404_4595860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4596108_4596399_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4596595_4597324_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP050746	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-1, complete sequence	115084	0	14879	115084		Enterobacteria_phage(50.0%)	14	NA	NA
WP_000979451.1|2949_3252_+	transcriptional regulator PefB	NA	NA	NA	NA	NA
WP_000748205.1|3526_4045_+	major pilin PefA	NA	NA	NA	NA	NA
WP_000007893.1|4272_6681_+	outer membrane usher protein PefC	NA	NA	NA	NA	NA
WP_001038510.1|6673_7366_+	fimbrial chaperone PefD	NA	NA	NA	NA	NA
WP_010999940.1|7380_7938_+	membrane protein	NA	NA	NA	NA	NA
WP_014343944.1|8190_9066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000004313.1|9497_9710_+	transcriptional regulator PefI	NA	NA	NA	NA	NA
WP_001526811.1|9694_10045_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000178592.1|10289_10943_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_001192557.1|10932_11079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010999938.1|11075_11975_+	YjiK family protein	NA	NA	NA	NA	NA
WP_167787428.1|12064_12616_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	37.8	3.0e-20
WP_000957857.1|12704_12893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000220561.1|14597_14879_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	2.9e-24
>prophage 2
NZ_CP050746	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-1, complete sequence	115084	18518	23824	115084	transposase	Escherichia_phage(66.67%)	3	NA	NA
WP_000572405.1|18518_19313_+	aminoglycoside O-phosphotransferase APH(3')-IIa	NA	Q75ZG1	Hepacivirus	100.0	9.5e-153
WP_001067858.1|19619_20324_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067855.1|23119_23824_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
NZ_CP050746	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-1, complete sequence	115084	30118	30859	115084		Xanthomonas_phage(100.0%)	1	NA	NA
WP_000177629.1|30118_30859_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	3.9e-07
>prophage 4
NZ_CP050746	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-1, complete sequence	115084	48765	49185	115084		Salmonella_phage(100.0%)	1	NA	NA
WP_001229397.1|48765_49185_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	88.9	2.2e-68
>prophage 5
NZ_CP050746	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-1, complete sequence	115084	55654	55876	115084		Vibrio_virus(100.0%)	1	NA	NA
WP_001278699.1|55654_55876_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	42.3	1.0e-08
>prophage 6
NZ_CP050746	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-1, complete sequence	115084	66109	70015	115084		Emiliania_huxleyi_virus(33.33%)	4	NA	NA
WP_000117513.1|66109_68107_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.0	5.5e-16
WP_000131520.1|68175_68418_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000741240.1|68472_68991_-	single-stranded DNA-binding protein SSB2	NA	A0A0A0P1Q9	Enterobacteria_phage	82.5	6.8e-51
WP_000015983.1|69691_70015_-	hypothetical protein	NA	G8C7V1	Escherichia_phage	56.5	2.0e-13
>prophage 7
NZ_CP050746	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-1, complete sequence	115084	73207	82503	115084	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_000088645.1|73207_73888_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
WP_000369839.1|74269_74626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490265.1|74618_75089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925627.1|75599_76022_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000457541.1|76021_77296_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000064274.1|77377_78352_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.1e-84
WP_000427676.1|78351_79557_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|79971_80913_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|80944_81511_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|81567_81903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|82086_82503_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
>prophage 8
NZ_CP050746	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-1, complete sequence	115084	88520	94133	115084	transposase	Bacillus_phage(33.33%)	7	NA	NA
WP_001083725.1|88520_89018_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_071523897.1|89174_89420_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|89425_90217_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_167787430.1|90720_91560_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	S4VNV0	Pandoravirus	26.3	1.1e-10
WP_000376616.1|91687_91891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|92046_93252_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_167787432.1|93473_94133_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.4e-125
>prophage 9
NZ_CP050746	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-1, complete sequence	115084	98178	101615	115084	transposase	Escherichia_phage(50.0%)	3	NA	NA
WP_001067858.1|98178_98883_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000346691.1|100383_101277_+	virulence genes transcriptional activator SpvR	NA	NA	NA	NA	NA
WP_001576629.1|101450_101615_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
>prophage 10
NZ_CP050746	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-1, complete sequence	115084	107038	107389	115084		Escherichia_phage(100.0%)	1	NA	NA
WP_001541541.1|107038_107389_+	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
>prophage 11
NZ_CP050746	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-1, complete sequence	115084	110449	111232	115084	integrase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_000082169.1|110449_111232_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
>prophage 1
NZ_CP050747	Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-2, complete sequence	88006	44084	52527	88006		Rhodococcus_virus(16.67%)	8	NA	NA
WP_000117626.1|44084_44585_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	26.5	7.1e-05
WP_000977995.1|45046_45643_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	56.6	9.0e-15
WP_012783927.1|45639_46359_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001402001.1|46355_46790_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_063267868.1|46842_48801_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.0	1.2e-20
WP_015508350.1|48859_49093_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.2	2.3e-06
WP_012783926.1|49150_49678_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	2.1e-47
WP_012372796.1|50859_52527_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.3	1.7e-164
