The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050734	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 chromosome, complete genome	4906732	65645	100522	4906732	integrase,transposase	Escherichia_phage(40.0%)	34	60916:60945	81546:81575
60916:60945	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_000935451.1|65645_67361_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000344784.1|67363_68224_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000287615.1|68274_69819_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_001324342.1|69941_71465_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_001163403.1|71454_72237_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_000376623.1|72412_72913_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|73040_73880_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|73873_74221_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001209508.1|74384_75176_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001334766.1|75288_76119_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000845048.1|76328_77342_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|77544_77895_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|78020_78581_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|78583_81550_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000656305.1|81616_81994_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
81546:81575	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
WP_000412211.1|82194_82854_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_049802299.1|83826_84090_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|84082_84469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|84476_85163_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|85140_85764_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|85845_87051_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000428546.1|87163_87757_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_000449408.1|89083_89242_+	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
WP_000949452.1|89231_89738_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012372823.1|89920_90736_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000118029.1|91082_92969_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_000178050.1|93009_93537_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|93640_95020_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|95022_96306_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000729220.1|96295_97426_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|97430_98126_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	1.3e-17
WP_001267177.1|98112_98598_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|98622_99108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067834.1|99817_100522_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
>prophage 2
NZ_CP050734	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 chromosome, complete genome	4906732	1186715	1394892	4906732	terminase,integrase,capsid,protease,head,tail,holin,portal,transposase,lysis,plate,tRNA	Salmonella_phage(48.87%)	211	1303523:1303541	1401823:1401841
WP_085983317.1|1186715_1187878_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
WP_000073810.1|1188156_1190139_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000061088.1|1190135_1190774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682341.1|1192487_1193084_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	91.3	2.6e-99
WP_010989066.1|1193661_1194945_+	membrane protein	NA	NA	NA	NA	NA
WP_001521074.1|1195204_1197079_-	membrane protein	NA	NA	NA	NA	NA
WP_000088556.1|1197244_1198120_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_000021514.1|1199236_1200916_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000819716.1|1201138_1202680_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000811366.1|1202809_1203652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682344.1|1203651_1204215_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000776032.1|1204238_1204874_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_000889012.1|1204947_1206150_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001033832.1|1206444_1207458_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001098984.1|1207468_1208449_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000973738.1|1208445_1208820_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000480483.1|1208816_1209338_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000749979.1|1209450_1209735_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_010989065.1|1209829_1210186_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989064.1|1210339_1211158_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_001520307.1|1212987_1215057_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_000701821.1|1215092_1215308_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001161781.1|1215758_1216586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|1216920_1218114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989063.1|1218503_1219097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001536726.1|1220717_1221743_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
WP_000052560.1|1221746_1222379_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000102104.1|1222495_1222735_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
WP_000460862.1|1222770_1223280_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	5.1e-83
WP_000957775.1|1223287_1223521_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
WP_000166366.1|1223468_1223927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963195.1|1224146_1224488_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
WP_001244234.1|1224555_1224789_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_000785509.1|1224788_1225016_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
WP_000104125.1|1225012_1225870_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.4	2.7e-129
WP_000301161.1|1225860_1228290_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.8	0.0e+00
WP_001154433.1|1228442_1228631_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_001217575.1|1228641_1228875_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_014344476.1|1228988_1229666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071892914.1|1229879_1231631_+	AIPR family protein	NA	NA	NA	NA	NA
WP_001292071.1|1231716_1232757_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	93.0	2.4e-188
WP_001098444.1|1232756_1234523_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.3	0.0e+00
WP_000216276.1|1234665_1235499_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_000730755.1|1235515_1236598_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	97.7	1.6e-190
WP_000059178.1|1236601_1237255_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	98.6	4.6e-113
WP_000673534.1|1237348_1237813_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	1.9e-84
WP_000868168.1|1237812_1238016_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	98.5	1.1e-33
WP_000171565.1|1238019_1238235_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069932.1|1238215_1238725_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	3.5e-92
WP_000871617.1|1238729_1239104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001648763.1|1239100_1239529_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_001039961.1|1239624_1240056_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_000343947.1|1240048_1240495_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.0	1.9e-65
WP_000993751.1|1240563_1241142_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	98.4	3.3e-107
WP_000177403.1|1241138_1241498_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	98.3	8.0e-59
WP_000268333.1|1241484_1242393_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	99.0	7.7e-159
WP_001086807.1|1242385_1242991_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.0	4.1e-116
WP_024159471.1|1242987_1244796_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	82.4	3.3e-209
WP_001287105.1|1244802_1245210_+|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	84.4	2.2e-60
WP_010989059.1|1245213_1245831_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	84.6	4.1e-95
WP_077908780.1|1245800_1246646_-	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	84.4	1.1e-114
WP_001165559.1|1246615_1247173_+	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	97.8	8.0e-98
WP_000046109.1|1247275_1248448_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
WP_001207652.1|1248457_1248973_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
WP_001280967.1|1249027_1249330_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
WP_000763317.1|1249344_1249464_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
WP_001282773.1|1249456_1252264_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	99.7	0.0e+00
WP_000980418.1|1252260_1252746_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	98.5	2.4e-66
WP_001010543.1|1252742_1253843_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.1	3.4e-193
WP_000980498.1|1253911_1254130_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_010989057.1|1254681_1255845_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196159.1|1255852_1258033_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533858.1|1258029_1259439_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237668.1|1259503_1270978_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1271591_1272074_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1272223_1272700_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1272689_1272980_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1273145_1273484_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1273632_1275294_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1275379_1276258_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1276380_1276971_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287923.1|1277005_1277611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1277731_1279018_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1279037_1279829_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1279994_1281356_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1281669_1281918_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1281936_1282485_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|1282529_1283297_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1283337_1283685_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1283841_1285062_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212379.1|1285054_1285573_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1286012_1287083_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225191.1|1287092_1288214_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210995.1|1288271_1289180_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200080.1|1289140_1290301_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1290400_1290448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024136262.1|1290611_1291604_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	4.7e-109
WP_000085723.1|1291670_1291970_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_000661530.1|1292078_1292417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000645096.1|1292442_1292775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681786.1|1292784_1293354_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_031603162.1|1293356_1293575_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	37.7	8.9e-05
WP_000994502.1|1293613_1296271_+	hypothetical protein	NA	A0A077K8T2	Ralstonia_phage	47.5	4.6e-244
WP_000088096.1|1296298_1296622_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_000746493.1|1296621_1297641_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.5	1.0e-135
WP_001151938.1|1297637_1299422_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	69.7	1.8e-247
WP_031603163.1|1299632_1300472_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.0	4.8e-46
WP_001176504.1|1300506_1301535_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	1.7e-133
WP_001177275.1|1301546_1302245_+|terminase	terminase endonuclease subunit	terminase	F1BUM0	Cronobacter_phage	52.6	6.1e-63
WP_000505908.1|1302263_1302455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031602415.1|1302509_1303001_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.3e-48
WP_000080872.1|1302997_1303480_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	4.0e-37
WP_000606932.1|1303476_1304181_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.5	2.0e-69
1303523:1303541	attL	AGGCGCTGAAAAAACTGGA	NA	NA	NA	NA
WP_000220185.1|1304177_1305305_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.9	1.6e-174
WP_000166745.1|1305301_1305757_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
WP_001154426.1|1305769_1306066_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_000175558.1|1306062_1306404_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376377.1|1306403_1306736_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	2.2e-34
WP_000411498.1|1306882_1307140_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	3.1e-20
WP_000811099.1|1307327_1309295_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	1.9e-271
WP_001002797.1|1309291_1309621_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|1309617_1310802_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001001823.1|1310794_1311382_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	8.4e-90
WP_025614139.1|1311391_1313635_+|tail	tail protein	tail	Q8HAB4	Salmonella_phage	72.7	3.4e-171
WP_000122989.1|1313647_1314202_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	97.2	4.6e-98
WP_000267951.1|1314191_1314917_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200792.1|1314888_1315434_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_024136261.1|1315436_1317137_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	2.9e-223
WP_001156922.1|1318170_1318557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1318714_1319053_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197660.1|1319324_1320062_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1320193_1321174_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992639.1|1321170_1321902_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235086.1|1322031_1324605_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	5.3e-128
WP_000985653.1|1330485_1330941_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_000807809.1|1331044_1332346_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	6.9e-44
WP_001264473.1|1332342_1332666_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1332710_1334066_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082639.1|1334180_1336841_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000183639.1|1336894_1337575_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098732.1|1337647_1338067_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1338270_1339308_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1339423_1340113_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1340431_1340815_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1340876_1341464_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1341566_1342466_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1342483_1343818_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1343948_1344686_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1344670_1346293_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1346556_1346721_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1346717_1347293_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1347324_1347975_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1347974_1348931_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1348927_1349407_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1349904_1351134_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1351111_1351396_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1351436_1351676_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_071892913.1|1351718_1352876_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_000017125.1|1352838_1355766_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_014344461.1|1355892_1356192_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	83.6	1.4e-48
WP_000917562.1|1356213_1356372_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_010989055.1|1356364_1356625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1356674_1357085_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1357204_1357444_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1357409_1357784_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1357868_1358852_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1358854_1359604_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1359614_1359962_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1359958_1360270_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_010989003.1|1360347_1360638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1360929_1361163_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1361274_1361496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929803.1|1361578_1362181_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001096550.1|1362389_1363001_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1362997_1363138_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1363134_1363812_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211409.1|1364084_1364648_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1365154_1365343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110786.1|1365557_1366244_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	99.6	7.9e-132
WP_001574216.1|1366519_1366849_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1366832_1367285_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|1367302_1367755_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1367990_1368392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1368678_1369224_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1369195_1371127_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1371110_1371314_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1371310_1372891_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1372880_1374377_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1374389_1374737_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1374791_1375820_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1375877_1376237_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1376247_1376631_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1376658_1377237_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1377285_1378416_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1378524_1378926_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1378933_1379680_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1379730_1380126_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1380122_1380461_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|1380432_1383528_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|1383530_1383860_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1383869_1384568_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1384574_1385312_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1385209_1385857_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_167798691.1|1385918_1389281_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.9	0.0e+00
WP_000178849.1|1389319_1389562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167798692.1|1389615_1391988_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	4.8e-91
WP_000593433.1|1391984_1392809_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1392798_1393377_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1393473_1393701_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1393807_1394020_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|1394772_1394892_+|transposase	transposase	transposase	NA	NA	NA	NA
1401823:1401841	attR	AGGCGCTGAAAAAACTGGA	NA	NA	NA	NA
>prophage 3
NZ_CP050734	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 chromosome, complete genome	4906732	1765747	1792288	4906732	tail,protease,holin	Salmonella_phage(30.0%)	29	NA	NA
WP_000781589.1|1765747_1766242_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1766655_1767147_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1767136_1767400_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1767396_1769883_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1769889_1770585_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1770571_1771441_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1771556_1772006_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1772015_1772618_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1772638_1773256_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|1773252_1773912_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1773963_1774701_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1774697_1774910_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1774906_1775386_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1775382_1777314_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1777310_1777868_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_079850075.1|1777864_1778908_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1778951_1779599_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1780328_1780892_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1781083_1781287_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1781589_1782381_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1782677_1782881_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1783049_1785416_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1785744_1786734_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1786748_1787117_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894639.1|1787145_1788477_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1788773_1789103_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1789695_1790937_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1790939_1791467_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1791844_1792288_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
>prophage 4
NZ_CP050734	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 chromosome, complete genome	4906732	1867385	1876556	4906732	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1867385_1868333_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824855.1|1868316_1869048_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1869028_1869136_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1869195_1869927_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1870149_1871835_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1871831_1872551_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1872597_1873065_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1873121_1873652_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1873823_1874282_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1874522_1876556_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP050734	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 chromosome, complete genome	4906732	1944864	1955370	4906732		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1944864_1946268_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1946445_1947339_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1947715_1948801_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1948800_1949700_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1949747_1950626_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1950626_1951178_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1951183_1952176_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1952172_1952946_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1952950_1954030_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1954056_1955370_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP050734	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 chromosome, complete genome	4906732	2044715	2051969	4906732		Morganella_phage(33.33%)	8	NA	NA
WP_000394196.1|2044715_2045135_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|2045137_2046406_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|2046860_2047073_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2047083_2047272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|2047532_2048729_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|2049378_2049678_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|2049769_2050465_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|2050538_2051969_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP050734	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 chromosome, complete genome	4906732	2948274	3033837	4906732	protease,terminase,integrase,tail,holin,portal,transposase,lysis,tRNA	Salmonella_phage(43.64%)	93	2972368:2972387	3044983:3045002
WP_000938191.1|2948274_2948955_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2949575_2950235_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2950321_2950651_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2950647_2950929_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2950977_2951757_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2951782_2952331_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2952545_2953757_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2953814_2954132_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2954176_2954590_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2954763_2955426_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2955520_2955979_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2956014_2958069_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2958192_2958639_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2958657_2960811_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2960797_2961403_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2961619_2962129_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2962485_2963538_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2963609_2964062_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2964247_2966008_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2966076_2966595_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2966694_2966862_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2967117_2967681_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2967677_2969318_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2969322_2970576_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2970590_2972498_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2972368:2972387	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2972510_2974619_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2974717_2975827_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2975823_2976366_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2976531_2977542_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2977749_2980362_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2980788_2980980_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2981250_2981937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2981921_2982221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2982289_2982916_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001533476.1|2983563_2984532_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000143167.1|2985007_2985589_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001067855.1|2986528_2987233_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000178849.1|2988908_2989151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001687102.1|2989189_2990065_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_001541992.1|2990091_2992539_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	68.0	0.0e+00
WP_000246065.1|2992610_2993315_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2993212_2993950_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2993959_2994655_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2994744_2995278_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2995394_2995892_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|2995990_2996323_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|2996319_2999307_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|2999386_2999716_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2999712_3000111_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|3000156_3000906_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|3000917_3001319_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|3001315_3001882_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|3001862_3002162_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|3002154_3002478_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|3002568_3004650_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001009207.1|3004573_3006121_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_000196190.1|3006117_3006324_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|3006320_3008459_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|3008415_3008949_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|3009156_3009636_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|3009653_3010106_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|3010089_3010419_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|3010694_3011381_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|3011741_3012191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|3012326_3012452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|3012625_3012943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|3013009_3013807_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|3013796_3013943_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|3013939_3014551_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_000929802.1|3014759_3015362_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_000807548.1|3015444_3015666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|3015777_3016011_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_010989003.1|3016302_3016593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|3016670_3016982_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|3016978_3017326_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|3017336_3018086_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|3018088_3019072_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|3019156_3019531_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|3019496_3019736_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|3019855_3020266_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_010989055.1|3020315_3020576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|3020568_3020727_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_014344461.1|3020748_3021048_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	83.6	1.4e-48
WP_000017133.1|3021174_3024060_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|3024022_3025180_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|3025222_3025462_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|3025502_3025751_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|3025795_3027088_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|3027282_3028485_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|3028562_3029999_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|3030243_3031458_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|3031774_3032236_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|3032436_3033837_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
3044983:3045002	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 8
NZ_CP050734	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 chromosome, complete genome	4906732	3097973	3106705	4906732	protease,transposase	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3097973_3099228_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3099691_3100150_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3100341_3102618_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3102648_3102969_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3103292_3103514_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3103643_3105590_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3105586_3106705_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 9
NZ_CP050734	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 chromosome, complete genome	4906732	3682445	3727393	4906732	terminase,protease,integrase,coat,portal,lysis	Enterobacteria_phage(77.61%)	68	3673839:3673855	3736608:3736624
3673839:3673855	attL	ACGCGAATTTCAATATC	NA	NA	NA	NA
WP_000915528.1|3682445_3682808_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3682804_3683737_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3683726_3685184_+	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129933.1|3685242_3687246_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000532177.1|3687381_3687630_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|3687650_3687944_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_001029860.1|3688082_3690059_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_000246977.1|3690058_3691495_-	phage DNA ejection protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_000964904.1|3691505_3692195_-	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000627593.1|3692197_3692653_-	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000774917.1|3692652_3693354_-	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_001122420.1|3693357_3694776_-	Packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_001166103.1|3694735_3695236_-	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_000538670.1|3695219_3695780_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001196937.1|3695820_3697113_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_000433855.1|3697112_3698024_-	scaffold protein	NA	Q76H22	Enterobacteria_phage	100.0	1.5e-162
WP_000774652.1|3698037_3700215_-|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_000417860.1|3700214_3701714_-|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
WP_000729923.1|3701691_3702180_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3702183_3702588_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3702587_3702977_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3702980_3703223_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_000877028.1|3703445_3703976_-	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_001687043.1|3704188_3704656_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3704652_3705150_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3705127_3705331_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001047566.1|3705761_3706535_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000219133.1|3706531_3706711_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|3706691_3706895_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|3706891_3707116_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001108073.1|3707112_3707724_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000950963.1|3707716_3707893_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001532927.1|3707885_3708227_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000113770.1|3708229_3708406_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000679703.1|3708372_3708546_-	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000736891.1|3708542_3708980_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_001036030.1|3709053_3709323_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_001248410.1|3709319_3710696_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_000539342.1|3710692_3711514_-	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_000166961.1|3711500_3711662_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_001103492.1|3711696_3711978_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3712088_3712304_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3712414_3713104_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_001532928.1|3713268_3714348_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000834175.1|3714386_3714590_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_000216178.1|3714953_3715256_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_001066179.1|3715268_3715856_-	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000213982.1|3716069_3716264_+	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_015974224.1|3716347_3716992_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	100.0	6.5e-51
WP_000713613.1|3717025_3717313_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_000776963.1|3717588_3717903_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|3717987_3718146_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000156731.1|3718126_3718315_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000902092.1|3718304_3718448_+	hypothetical protein	NA	A0A2H5BFM6	Salmonella_phage	100.0	6.4e-20
WP_001046968.1|3718444_3719152_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_001253476.1|3719151_3719436_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111291.1|3719482_3719776_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001214777.1|3719786_3719957_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_000812203.1|3719953_3720463_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_071533029.1|3720459_3720693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025617570.1|3720679_3721324_+	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_000371199.1|3721323_3721608_+	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_000002104.1|3721600_3721885_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_155675089.1|3721953_3722094_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000051897.1|3722323_3723487_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_000893231.1|3723692_3724943_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|3724954_3726058_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|3726340_3727393_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
3736608:3736624	attR	ACGCGAATTTCAATATC	NA	NA	NA	NA
>prophage 10
NZ_CP050734	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 chromosome, complete genome	4906732	4485367	4532411	4906732	tail,plate,tRNA	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4485367_4486366_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4486453_4487764_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4488010_4488526_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4488624_4488834_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4488855_4488969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4488965_4490291_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4490469_4491078_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4491186_4491555_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4491725_4494146_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4494244_4495117_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4495130_4495628_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4495808_4496726_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4496889_4498248_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4498336_4499446_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4499807_4500998_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4501129_4502674_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4502688_4503579_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4503744_4504155_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4504297_4506394_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4506393_4507131_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_022742863.1|4507127_4507796_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4507829_4508072_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4508515_4510165_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4510509_4511859_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4511991_4512339_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4512914_4513202_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270442.1|4513204_4513810_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	4.2e-60
WP_000777266.1|4513822_4514137_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4514296_4514752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4514748_4514946_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4514935_4516363_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4516362_4516887_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4516938_4517256_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4517215_4517344_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4517440_4519795_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4519794_4520748_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4520747_4520957_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4520944_4521988_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4521997_4522720_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4523047_4523410_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4523406_4524336_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4524335_4525883_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4526046_4526406_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4526396_4527512_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4527504_4528137_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4528139_4529885_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4529889_4530495_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4530491_4530947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4531195_4531486_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4531682_4532411_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP050735	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-1, complete sequence	150326	1262	53972	150326	protease,transposase,integrase	Escherichia_phage(33.33%)	47	NA	NA
WP_001066953.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_042344623.1|2123_2306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113708090.1|3077_4305_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.2e-177
WP_001105060.1|6150_6444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421272.1|6549_6825_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001387467.1|6824_7109_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000562172.1|7713_8466_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|8841_9546_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|10037_11051_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_032491824.1|11199_11991_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA22	NA	NA	NA	NA	NA
WP_072135327.1|13508_14912_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	1.4e-106
WP_001532073.1|14945_16160_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	2.1e-34
WP_001067855.1|16454_17159_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_052259184.1|18847_19585_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|19581_19806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|20016_21510_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|21540_21792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|21685_21988_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043265.1|22074_22890_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_000240536.1|23197_24049_-	replication protein	NA	NA	NA	NA	NA
WP_032199621.1|24773_25478_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	5.3e-139
WP_131193628.1|25536_25917_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	75.4	9.1e-45
WP_000422420.1|25932_28029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104774283.1|28140_30060_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	99.8	0.0e+00
WP_001791010.1|30075_30192_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_001067855.1|32131_32836_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012372821.1|33975_35511_+	fluoroquinolone efflux MFS transporter QepA1	NA	NA	NA	NA	NA
WP_001470701.1|35538_35907_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_012372820.1|36163_37696_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_014342205.1|37922_38300_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	8.2e-22
WP_014342204.1|38335_38884_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_012372818.1|38964_39720_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_000027057.1|39889_40750_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|40932_41490_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067858.1|41759_42464_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001682408.1|42590_43268_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|43267_43615_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|43634_45206_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000616807.1|46019_46673_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|46765_47023_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|46955_47357_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|48667_49372_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000248278.1|50585_50813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|50836_51028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|51509_52052_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|52064_52925_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067858.1|53267_53972_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 1
NZ_CP050736	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-2, complete sequence	110163	0	8214	110163	transposase	Escherichia_phage(100.0%)	5	NA	NA
WP_000979451.1|2949_3252_+	transcriptional regulator PefB	NA	NA	NA	NA	NA
WP_000748205.1|3526_4045_+	major pilin PefA	NA	NA	NA	NA	NA
WP_000007893.1|4272_6681_+	outer membrane usher protein PefC	NA	NA	NA	NA	NA
WP_001038510.1|6673_7366_+	fimbrial chaperone PefD	NA	NA	NA	NA	NA
WP_001067855.1|7509_8214_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP050736	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-2, complete sequence	110163	12095	21391	110163	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_001541564.1|12095_12512_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|12695_13031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541562.1|13087_13654_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728917.1|13685_14627_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|15041_16247_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000064274.1|16246_17221_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.1e-84
WP_000457541.1|17302_18577_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000925627.1|18576_18999_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|19509_19980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|19972_20329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|20710_21391_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
>prophage 3
NZ_CP050736	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-2, complete sequence	110163	24583	28489	110163		Escherichia_phage(33.33%)	4	NA	NA
WP_000015983.1|24583_24907_+	hypothetical protein	NA	G8C7V1	Escherichia_phage	56.5	2.0e-13
WP_000741240.1|25607_26126_+	single-stranded DNA-binding protein SSB2	NA	A0A0A0P1Q9	Enterobacteria_phage	82.5	6.8e-51
WP_000131520.1|26180_26423_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000117513.1|26491_28489_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.0	5.5e-16
>prophage 4
NZ_CP050736	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-2, complete sequence	110163	38722	38944	110163		Vibrio_virus(100.0%)	1	NA	NA
WP_001278699.1|38722_38944_+	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	42.3	1.0e-08
>prophage 5
NZ_CP050736	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-2, complete sequence	110163	45413	45833	110163		Salmonella_phage(100.0%)	1	NA	NA
WP_001229397.1|45413_45833_+	HNH endonuclease	NA	C6ZR29	Salmonella_phage	88.9	2.2e-68
>prophage 6
NZ_CP050736	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-2, complete sequence	110163	57763	90671	110163	tRNA,integrase,transposase	Stx2-converting_phage(27.27%)	40	77998:78057	85816:86636
WP_000911322.1|57763_58162_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_000450265.1|58161_58389_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000986921.1|58470_63729_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000177629.1|63748_64489_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	3.9e-07
WP_000139307.1|64543_65107_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000477658.1|65221_65506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000983042.1|65518_65674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010999936.1|66460_66727_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001541552.1|66976_67054_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_001738692.1|67034_67916_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_071533052.1|68775_68997_+	YjiK family protein	NA	NA	NA	NA	NA
WP_000417898.1|69093_69852_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000725062.1|70118_70676_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	38.5	4.5e-24
WP_167810549.1|70765_71479_-	YjiK family protein	NA	NA	NA	NA	NA
WP_001682408.1|71519_72197_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|72196_72544_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|72563_74135_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001192557.1|74368_74515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178592.1|74504_75158_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_001526811.1|75402_75753_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000004313.1|75737_75950_-	transcriptional regulator PefI	NA	NA	NA	NA	NA
WP_014343944.1|76381_77257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167798735.1|77509_78037_-	hypothetical protein	NA	NA	NA	NA	NA
77998:78057	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|78061_78766_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845039.1|79040_80054_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|80198_80696_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_071523897.1|80852_81098_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|81103_81895_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|82058_82406_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|82399_83239_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|83366_83570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|83725_84931_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_001067855.1|85106_85811_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|86153_87014_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
85816:86636	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCGGCCAAGTTCGGTAAGAGTGAGAGTTTTACAGTCAAGTAATGCGTGGCAAGCCAACGTTAAGCTGTTGAGTCGTTTTAAGTGTAATTCGGGGCAGAATTGGTAAAGAGAGTCGTGTAAAATATCGAGTTCGCACATCTTGTTGTCTGATTATTGATTTTTCGCGAAACCATTTGATCATATGACAAGATGTGTATCCACCTTAACTTAATGATTTTTACCAAAATCATTAGGGGATTCATCAGCGTATAGTGTTTTGCAGTTTAGAGGAGATATCGCGATGCATACGCGGAAGGCAATAACGGAGGCGCTTCAAAAACTCGGAGTCCAAACCGGTGACCTCTTGATGGTGCATGCCTCACTTAAAGCGATTGGTCCGGTCGAAGGAGGAGCGGAGACGGTCGTTGCCGCGTTACGCTCCGCGGTTGGGCCGACTGGCACTGTGATGGGATACGCGTCGTGGGACCGATCACCCTACGAGGAGACTCTGAATGGCGCTCGGCTGGATGACGAAGCCCGCCGTACCTGGCTGCCGTTCGATCCCGCAACAGCCGGGACTTACCGTGGGTTCGGCCTGCTGAATCAATTTCTGGTTCAAGCCCCCGGCGCGCGGCGCAGCGCGCACCCCGATGCATCGATGGTCGCGGTTGGTCCGCTGGCTGAAACGCTGACGGAGCCTCACGAACTCGGTCACGCCTTGGGGGAAGGATCGCCCGTCGAGCGGTTCGTTCGCCTTGGCGGGAAGGCCCTGCTGTTGGGTGCG	NA	NA	NA	NA
WP_000587837.1|87026_87569_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|88050_88242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|88265_88493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080860.1|88543_89680_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014342212.1|89646_89796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|89966_90671_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 7
NZ_CP050736	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-2, complete sequence	110163	96530	96695	110163		Salmonella_phage(100.0%)	1	NA	NA
WP_001576629.1|96530_96695_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
>prophage 8
NZ_CP050736	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-2, complete sequence	110163	102117	102468	110163		Escherichia_phage(100.0%)	1	NA	NA
WP_001541541.1|102117_102468_+	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
>prophage 9
NZ_CP050736	Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-2, complete sequence	110163	105528	106311	110163	integrase	Macacine_betaherpesvirus(100.0%)	1	96867:96878	109233:109244
96867:96878	attL	TTATGAATATGA	NA	NA	NA	NA
WP_000082169.1|105528_106311_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
WP_000082169.1|105528_106311_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
109233:109244	attR	TCATATTCATAA	NA	NA	NA	NA
