The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050739	Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 chromosome, complete genome	4948999	65645	100522	4948999	integrase,transposase	Escherichia_phage(44.44%)	34	60916:60945	81546:81575
60916:60945	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_000935451.1|65645_67361_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000344784.1|67363_68224_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000287615.1|68274_69819_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_001324342.1|69941_71465_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_001163403.1|71454_72237_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_000376623.1|72412_72913_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|73040_73880_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|73873_74221_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001209508.1|74384_75176_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001334766.1|75288_76119_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000845048.1|76328_77342_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|77544_77895_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|78020_78581_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_167798684.1|78583_81550_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_000656305.1|81616_81994_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
81546:81575	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
WP_000412211.1|82194_82854_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_049802299.1|83826_84090_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|84082_84469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|84476_85163_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|85140_85764_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|85845_87051_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000428546.1|87163_87757_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_000449408.1|89083_89242_+	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
WP_000949452.1|89231_89738_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012372823.1|89920_90736_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000118029.1|91082_92969_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_000178050.1|93009_93537_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|93640_95020_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|95022_96306_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000729220.1|96295_97426_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|97430_98126_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	1.3e-17
WP_001267177.1|98112_98598_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|98622_99108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067834.1|99817_100522_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
>prophage 2
NZ_CP050739	Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 chromosome, complete genome	4948999	1262024	1470202	4948999	integrase,plate,tRNA,transposase,holin,terminase,tail,head,protease,portal,capsid,lysis	Salmonella_phage(48.87%)	211	1378834:1378852	1477157:1477175
WP_085983317.1|1262024_1263187_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
WP_000073810.1|1263465_1265448_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000061088.1|1265444_1266083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682341.1|1267796_1268393_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	91.3	2.6e-99
WP_010989066.1|1268970_1270254_+	membrane protein	NA	NA	NA	NA	NA
WP_001521074.1|1270513_1272388_-	membrane protein	NA	NA	NA	NA	NA
WP_000088556.1|1272553_1273429_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_000021514.1|1274545_1276225_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000819716.1|1276447_1277989_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000811366.1|1278118_1278961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682344.1|1278960_1279524_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000776032.1|1279547_1280183_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_000889012.1|1280256_1281459_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001033832.1|1281753_1282767_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001098984.1|1282777_1283758_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000973738.1|1283754_1284129_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000480483.1|1284125_1284647_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000749979.1|1284759_1285044_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_010989065.1|1285138_1285495_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989064.1|1285648_1286467_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_001520307.1|1288298_1290368_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_000701821.1|1290403_1290619_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001161781.1|1291069_1291897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|1292231_1293425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989063.1|1293814_1294408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001536726.1|1296028_1297054_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
WP_000052560.1|1297057_1297690_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000102104.1|1297806_1298046_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
WP_000460862.1|1298081_1298591_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	5.1e-83
WP_000957775.1|1298598_1298832_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
WP_000166366.1|1298779_1299238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963195.1|1299457_1299799_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
WP_001244234.1|1299866_1300100_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_000785509.1|1300099_1300327_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
WP_000104125.1|1300323_1301181_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.4	2.7e-129
WP_000301161.1|1301171_1303601_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.8	0.0e+00
WP_001154433.1|1303753_1303942_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_001217575.1|1303952_1304186_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_014344476.1|1304299_1304977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071892914.1|1305190_1306942_+	AIPR family protein	NA	NA	NA	NA	NA
WP_001292071.1|1307027_1308068_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	93.0	2.4e-188
WP_001098444.1|1308067_1309834_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.3	0.0e+00
WP_000216276.1|1309976_1310810_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_000730755.1|1310826_1311909_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	97.7	1.6e-190
WP_000059178.1|1311912_1312566_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	98.6	4.6e-113
WP_000673534.1|1312659_1313124_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	1.9e-84
WP_000868168.1|1313123_1313327_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	98.5	1.1e-33
WP_000171565.1|1313330_1313546_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069932.1|1313526_1314036_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	3.5e-92
WP_000871617.1|1314040_1314415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001648763.1|1314411_1314840_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_001039961.1|1314935_1315367_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_000343947.1|1315359_1315806_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.0	1.9e-65
WP_000993751.1|1315874_1316453_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	98.4	3.3e-107
WP_000177403.1|1316449_1316809_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	98.3	8.0e-59
WP_000268333.1|1316795_1317704_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	99.0	7.7e-159
WP_001086807.1|1317696_1318302_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.0	4.1e-116
WP_001274647.1|1318298_1319873_+|tail	tail protein	tail	A0A1S6KZZ8	Salmonella_phage	60.7	2.1e-156
WP_010989059.1|1319842_1320460_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	84.6	4.1e-95
WP_001287105.1|1320463_1320871_-|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	84.4	2.2e-60
WP_010989058.1|1320877_1321957_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	92.1	5.4e-183
WP_001165559.1|1321926_1322484_+	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	97.8	8.0e-98
WP_000046109.1|1322586_1323759_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
WP_001207652.1|1323768_1324284_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
WP_001280967.1|1324338_1324641_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
WP_000763317.1|1324655_1324775_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
WP_001282773.1|1324767_1327575_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	99.7	0.0e+00
WP_000980418.1|1327571_1328057_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	98.5	2.4e-66
WP_001010543.1|1328053_1329154_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.1	3.4e-193
WP_000980498.1|1329222_1329441_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_010989057.1|1329992_1331156_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196159.1|1331163_1333344_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533858.1|1333340_1334750_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237668.1|1334814_1346289_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1346902_1347385_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1347534_1348011_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1348000_1348291_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1348456_1348795_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1348943_1350605_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1350690_1351569_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1351691_1352282_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287923.1|1352316_1352922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1353042_1354329_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1354348_1355140_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1355305_1356667_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1356980_1357229_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1357247_1357796_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|1357840_1358608_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1358648_1358996_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1359152_1360373_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212379.1|1360365_1360884_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1361323_1362394_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225191.1|1362403_1363525_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210995.1|1363582_1364491_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200080.1|1364451_1365612_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1365711_1365759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024136262.1|1365922_1366915_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	4.7e-109
WP_000085723.1|1366981_1367281_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_000661530.1|1367389_1367728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000645096.1|1367753_1368086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681786.1|1368095_1368665_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_031603162.1|1368667_1368886_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	37.7	8.9e-05
WP_000994502.1|1368924_1371582_+	hypothetical protein	NA	A0A077K8T2	Ralstonia_phage	47.5	4.6e-244
WP_000088096.1|1371609_1371933_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_000746493.1|1371932_1372952_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.5	1.0e-135
WP_001151938.1|1372948_1374733_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	69.7	1.8e-247
WP_031603163.1|1374943_1375783_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.0	4.8e-46
WP_001176504.1|1375817_1376846_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	1.7e-133
WP_001177275.1|1376857_1377556_+|terminase	terminase endonuclease subunit	terminase	F1BUM0	Cronobacter_phage	52.6	6.1e-63
WP_000505908.1|1377574_1377766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031602415.1|1377820_1378312_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.3e-48
WP_000080872.1|1378308_1378791_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	4.0e-37
WP_000606932.1|1378787_1379492_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.5	2.0e-69
1378834:1378852	attL	AGGCGCTGAAAAAACTGGA	NA	NA	NA	NA
WP_000220185.1|1379488_1380616_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.9	1.6e-174
WP_000166745.1|1380612_1381068_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
WP_001154426.1|1381080_1381377_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_000175558.1|1381373_1381715_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376377.1|1381714_1382047_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	2.2e-34
WP_000411498.1|1382193_1382451_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	3.1e-20
WP_000811099.1|1382638_1384606_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	1.9e-271
WP_001002797.1|1384602_1384932_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|1384928_1386113_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001001823.1|1386105_1386693_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	8.4e-90
WP_025614139.1|1386702_1388946_+|tail	tail protein	tail	Q8HAB4	Salmonella_phage	72.7	3.4e-171
WP_000122989.1|1388958_1389513_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	97.2	4.6e-98
WP_000267951.1|1389502_1390228_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200792.1|1390199_1390745_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_024136261.1|1390747_1392448_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	2.9e-223
WP_001156922.1|1393481_1393868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1394025_1394364_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197660.1|1394635_1395373_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1395504_1396485_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992639.1|1396481_1397213_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235086.1|1397342_1399916_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	5.3e-128
WP_000985653.1|1405795_1406251_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_000807809.1|1406354_1407656_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	6.9e-44
WP_001264473.1|1407652_1407976_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1408020_1409376_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082639.1|1409490_1412151_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000183639.1|1412204_1412885_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098732.1|1412957_1413377_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1413580_1414618_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1414733_1415423_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1415741_1416125_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1416186_1416774_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1416876_1417776_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1417793_1419128_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1419258_1419996_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1419980_1421603_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1421866_1422031_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1422027_1422603_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1422634_1423285_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1423284_1424241_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1424237_1424717_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1425214_1426444_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1426421_1426706_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1426746_1426986_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_071892913.1|1427028_1428186_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_000017125.1|1428148_1431076_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_014344461.1|1431202_1431502_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	83.6	1.4e-48
WP_000917562.1|1431523_1431682_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_010989055.1|1431674_1431935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1431984_1432395_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1432514_1432754_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1432719_1433094_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1433178_1434162_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1434164_1434914_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1434924_1435272_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1435268_1435580_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_010989003.1|1435657_1435948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1436239_1436473_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1436584_1436806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929803.1|1436888_1437491_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001096550.1|1437699_1438311_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1438307_1438448_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1438444_1439122_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211409.1|1439394_1439958_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1440464_1440653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110786.1|1440867_1441554_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	99.6	7.9e-132
WP_001574216.1|1441829_1442159_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1442142_1442595_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|1442612_1443065_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1443300_1443702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1443988_1444534_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1444505_1446437_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1446420_1446624_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1446620_1448201_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1448190_1449687_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1449699_1450047_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1450101_1451130_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1451187_1451547_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1451557_1451941_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1451968_1452547_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1452595_1453726_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1453834_1454236_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1454243_1454990_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1455040_1455436_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1455432_1455771_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|1455742_1458838_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|1458840_1459170_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1459179_1459878_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1459884_1460622_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1460519_1461167_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_167798691.1|1461228_1464591_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.9	0.0e+00
WP_000178849.1|1464629_1464872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167798692.1|1464925_1467298_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	4.8e-91
WP_000593433.1|1467294_1468119_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1468108_1468687_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1468783_1469011_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1469117_1469330_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|1470082_1470202_+|transposase	transposase	transposase	NA	NA	NA	NA
1477157:1477175	attR	AGGCGCTGAAAAAACTGGA	NA	NA	NA	NA
>prophage 3
NZ_CP050739	Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 chromosome, complete genome	4948999	1841270	1867811	4948999	protease,holin,tail	Salmonella_phage(30.0%)	29	NA	NA
WP_167798719.1|1841270_1841765_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1842178_1842670_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1842659_1842923_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1842919_1845406_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1845412_1846108_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1846094_1846964_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1847079_1847529_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1847538_1848141_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1848161_1848779_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|1848775_1849435_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1849486_1850224_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1850220_1850433_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1850429_1850909_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1850905_1852837_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1852833_1853391_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001238333.1|1853387_1854431_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1854474_1855122_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1855851_1856415_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1856606_1856810_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1857112_1857904_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1858200_1858404_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1858572_1860939_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1861267_1862257_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1862271_1862640_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894639.1|1862668_1864000_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1864296_1864626_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1865218_1866460_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1866462_1866990_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1867367_1867811_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
>prophage 4
NZ_CP050739	Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 chromosome, complete genome	4948999	2021171	2031677	4948999		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|2021171_2022575_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|2022752_2023646_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|2024022_2025108_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|2025107_2026007_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|2026054_2026933_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|2026933_2027485_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|2027490_2028483_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|2028479_2029253_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|2029257_2030337_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|2030363_2031677_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP050739	Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 chromosome, complete genome	4948999	2121020	2128274	4948999		Morganella_phage(33.33%)	8	NA	NA
WP_000394196.1|2121020_2121440_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|2121442_2122711_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|2123165_2123378_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2123388_2123577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|2123837_2125034_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|2125683_2125983_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|2126074_2126770_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|2126843_2128274_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP050739	Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 chromosome, complete genome	4948999	3028302	3113037	4948999	integrase,tRNA,holin,terminase,tail,protease,portal,lysis	Salmonella_phage(43.64%)	93	3052396:3052415	3124183:3124202
WP_000938191.1|3028302_3028983_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|3029603_3030263_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|3030349_3030679_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|3030675_3030957_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|3031005_3031785_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|3031810_3032359_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|3032573_3033785_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|3033842_3034160_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|3034204_3034618_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|3034791_3035454_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|3035548_3036007_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|3036042_3038097_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|3038220_3038667_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|3038685_3040839_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|3040825_3041431_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|3041647_3042157_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|3042513_3043566_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|3043637_3044090_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|3044275_3046036_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|3046104_3046623_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|3046722_3046890_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|3047145_3047709_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|3047705_3049346_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|3049350_3050604_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|3050618_3052526_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
3052396:3052415	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|3052538_3054647_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|3054745_3055855_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|3055851_3056394_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|3056559_3057570_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|3057777_3060390_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|3060816_3061008_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|3061278_3061965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|3061949_3062249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|3062317_3062944_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001533476.1|3063591_3064560_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000143167.1|3065035_3065617_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_014344464.1|3065616_3068055_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|3068108_3068351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001687102.1|3068389_3069265_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_001541992.1|3069291_3071739_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	68.0	0.0e+00
WP_000246065.1|3071810_3072515_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|3072412_3073150_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|3073159_3073855_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|3073944_3074478_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|3074594_3075092_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|3075190_3075523_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|3075519_3078507_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|3078586_3078916_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|3078912_3079311_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|3079356_3080106_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|3080117_3080519_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|3080515_3081082_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|3081062_3081362_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|3081354_3081678_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|3081768_3083850_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001009207.1|3083773_3085321_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_000196190.1|3085317_3085524_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|3085520_3087659_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|3087615_3088149_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|3088356_3088836_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|3088853_3089306_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|3089289_3089619_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|3089894_3090581_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|3090941_3091391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|3091526_3091652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|3091825_3092143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|3092209_3093007_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|3092996_3093143_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|3093139_3093751_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_000929802.1|3093959_3094562_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_000807548.1|3094644_3094866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|3094977_3095211_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_010989003.1|3095502_3095793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|3095870_3096182_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|3096178_3096526_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|3096536_3097286_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|3097288_3098272_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|3098356_3098731_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|3098696_3098936_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|3099055_3099466_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_010989055.1|3099515_3099776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|3099768_3099927_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_014344461.1|3099948_3100248_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	83.6	1.4e-48
WP_000017133.1|3100374_3103260_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|3103222_3104380_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|3104422_3104662_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|3104702_3104951_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|3104995_3106288_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|3106482_3107685_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|3107762_3109199_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|3109443_3110658_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|3110974_3111436_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|3111636_3113037_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
3124183:3124202	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 7
NZ_CP050739	Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 chromosome, complete genome	4948999	3177173	3185905	4948999	transposase,protease	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3177173_3178428_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3178891_3179350_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3179541_3181818_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3181848_3182169_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3182492_3182714_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3182843_3184790_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3184786_3185905_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 8
NZ_CP050739	Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 chromosome, complete genome	4948999	3746007	3769955	4948999	integrase,protease,lysis	Enterobacteria_phage(77.78%)	46	3757060:3757073	3766110:3766123
WP_000877028.1|3746007_3746538_-	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_001687043.1|3746750_3747218_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3747214_3747712_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3747689_3747893_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001047566.1|3748323_3749097_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000219133.1|3749093_3749273_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|3749253_3749457_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|3749453_3749678_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001108073.1|3749674_3750286_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000950963.1|3750278_3750455_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001532927.1|3750447_3750789_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000113770.1|3750791_3750968_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000679703.1|3750934_3751108_-	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000736891.1|3751104_3751542_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_001036030.1|3751615_3751885_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_001248410.1|3751881_3753258_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_000539342.1|3753254_3754076_-	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_000166961.1|3754062_3754224_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_001103492.1|3754258_3754540_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3754650_3754866_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3754976_3755666_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_001532928.1|3755830_3756910_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000834175.1|3756948_3757152_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
3757060:3757073	attL	GCGCTGCTCTACCA	NA	NA	NA	NA
WP_000216178.1|3757515_3757818_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_001066179.1|3757830_3758418_-	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000213982.1|3758631_3758826_+	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_015974224.1|3758909_3759554_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	100.0	6.5e-51
WP_000713613.1|3759587_3759875_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_000776963.1|3760150_3760465_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|3760549_3760708_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000156731.1|3760688_3760877_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000902092.1|3760866_3761010_+	hypothetical protein	NA	A0A2H5BFM6	Salmonella_phage	100.0	6.4e-20
WP_001046968.1|3761006_3761714_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_001253476.1|3761713_3761998_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111291.1|3762044_3762338_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001214777.1|3762348_3762519_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_000812203.1|3762515_3763025_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_071533029.1|3763021_3763255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025617570.1|3763241_3763886_+	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_000371199.1|3763885_3764170_+	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_000002104.1|3764162_3764447_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_155675089.1|3764515_3764656_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000051897.1|3764885_3766049_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_000893231.1|3766254_3767505_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
3766110:3766123	attR	GCGCTGCTCTACCA	NA	NA	NA	NA
WP_001285275.1|3767516_3768620_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|3768902_3769955_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
>prophage 9
NZ_CP050739	Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 chromosome, complete genome	4948999	4527532	4574576	4948999	plate,tRNA,tail	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4527532_4528531_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4528618_4529929_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4530175_4530691_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4530789_4530999_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4531020_4531134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4531130_4532456_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4532634_4533243_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4533351_4533720_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4533890_4536311_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4536409_4537282_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4537295_4537793_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4537973_4538891_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4539054_4540413_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4540501_4541611_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4541972_4543163_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4543294_4544839_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4544853_4545744_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4545909_4546320_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4546462_4548559_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4548558_4549296_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_022742863.1|4549292_4549961_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4549994_4550237_-	outer membrane protein	NA	NA	NA	NA	NA
WP_167798714.1|4550680_4552330_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4552674_4554024_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4554156_4554504_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4555079_4555367_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270442.1|4555369_4555975_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	4.2e-60
WP_000777266.1|4555987_4556302_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4556461_4556917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4556913_4557111_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4557100_4558528_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4558527_4559052_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4559103_4559421_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4559380_4559509_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4559605_4561960_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4561959_4562913_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4562912_4563122_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4563109_4564153_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4564162_4564885_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4565212_4565575_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4565571_4566501_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4566500_4568048_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4568211_4568571_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4568561_4569677_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4569669_4570302_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4570304_4572050_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4572054_4572660_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4572656_4573112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4573360_4573651_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4573847_4574576_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP050740	Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-1, complete sequence	137774	5614	109786	137774	integrase,transposase	Escherichia_phage(34.38%)	111	18013:18072	69714:70534
WP_000948429.1|5614_6814_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|6823_7012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032064504.1|7404_7938_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000356489.1|7937_8210_-	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
WP_000683483.1|8925_9288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000534551.1|9325_12940_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_000256129.1|12952_14386_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_001326396.1|14387_15428_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000811656.1|15538_17050_-	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
18013:18072	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|18075_18780_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
18013:18072	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_167798729.1|21844_23368_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	23.9	4.7e-15
WP_000259031.1|25300_26140_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|26133_26481_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_013263788.1|26609_27068_-	aminoglycoside N-acetyltransferase AAC(6')-Il	NA	NA	NA	NA	NA
WP_001067855.1|27978_28683_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_167798731.1|28628_29108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097010.1|29260_30136_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_014342220.1|30285_30417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000139717.1|30462_30954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997323.1|30950_31820_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000543934.1|31824_32835_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|32837_33374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575657.1|33672_33954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|34223_34826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326394.1|35464_35905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257735.1|35876_40130_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
WP_032410269.1|40084_40288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988731.1|40262_40988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868820.1|41101_41476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338626.1|41596_41713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|42118_43123_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000414383.1|43222_43657_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_001294666.1|43728_44079_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732290.1|44094_44370_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000149288.1|44441_46127_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.1e-38
WP_000761850.1|46141_46780_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_000995361.1|46891_47257_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087810.1|47253_47490_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001276635.1|47486_48476_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_167798732.1|48601_49099_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.9	2.8e-38
WP_001067855.1|49145_49850_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|50185_50890_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
49083:49902	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAAGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
WP_000130000.1|51562_51868_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
49083:49902	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAAGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
WP_001389365.1|52094_52859_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|53351_53936_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|53935_55174_-	MFS transporter	NA	NA	NA	NA	NA
WP_023063803.1|55170_56085_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|56206_56911_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013362819.1|57045_57141_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_013362818.1|57266_58004_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
WP_013362817.1|58633_59083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013362816.1|59611_61144_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|61466_62171_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|62721_63426_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000184001.1|63601_64807_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|64962_65166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|65293_66133_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|66126_66474_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|66637_67429_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_071523897.1|67434_67680_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|67836_68334_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|68478_69492_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|69766_70471_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557452.1|70577_71438_+	aminoglycoside N-acetyltransferase AAC(3)-IIe	NA	NA	NA	NA	NA
WP_002063889.1|71450_71993_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|72974_73679_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001447736.1|75158_75584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000118520.1|75840_76158_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001221666.1|76154_76688_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
WP_000976514.1|76781_77927_-	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_000608644.1|78250_79513_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000479535.1|79797_80190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793435.1|80193_80772_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_024131605.1|80768_82082_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_000794249.1|82081_82999_-	conjugal transfer protein TraK	NA	NA	NA	NA	NA
WP_001049717.1|82982_83609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000805625.1|83605_83887_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_001326174.1|84031_84409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001231464.1|84732_85395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000869297.1|85394_85772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122507.1|85781_86228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743449.1|86237_86867_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_000332868.1|86823_87408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012729609.1|87418_89278_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_064986968.1|89280_92253_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_001249396.1|92420_93038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001191892.1|93019_93253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000366822.1|93252_95445_+	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	29.2	1.7e-42
WP_000468105.1|95459_95948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000542259.1|96039_96339_-	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	2.1e-20
WP_000464631.1|96550_97168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000362482.1|97261_97480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268551.1|97685_98342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000936896.1|98341_99769_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000647189.1|99772_100273_-	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
WP_002210541.1|100281_100593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005507681.1|100598_101030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344151.1|101097_101772_-	thymidylate kinase	NA	NA	NA	NA	NA
WP_014342216.1|101758_101878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001125905.1|102020_102398_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
WP_000939033.1|102716_102860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074431.1|102951_103587_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000703827.1|103639_103912_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001207227.1|103960_105142_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_001151304.1|105145_105931_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_014342215.1|105958_106090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338945.1|106104_106416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|106722_107538_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|107598_108402_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|108401_109238_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000844627.1|109543_109786_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP050741	Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-2, complete sequence	108574	0	13803	108574	transposase	Escherichia_phage(50.0%)	11	NA	NA
WP_000979451.1|2949_3252_+	transcriptional regulator PefB	NA	NA	NA	NA	NA
WP_000748205.1|3526_4045_+	major pilin PefA	NA	NA	NA	NA	NA
WP_000007893.1|4272_6681_+	outer membrane usher protein PefC	NA	NA	NA	NA	NA
WP_001038510.1|6673_7366_+	fimbrial chaperone PefD	NA	NA	NA	NA	NA
WP_001067855.1|7509_8214_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001200150.1|8726_9161_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000274533.1|9227_9662_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_000015983.1|9897_10221_+	hypothetical protein	NA	G8C7V1	Escherichia_phage	56.5	2.0e-13
WP_000741240.1|10921_11440_+	single-stranded DNA-binding protein SSB2	NA	A0A0A0P1Q9	Enterobacteria_phage	82.5	6.8e-51
WP_000131520.1|11494_11737_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000117513.1|11805_13803_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.0	5.5e-16
>prophage 2
NZ_CP050741	Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-2, complete sequence	108574	24036	24258	108574		Vibrio_virus(100.0%)	1	NA	NA
WP_001278699.1|24036_24258_+	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	42.3	1.0e-08
>prophage 3
NZ_CP050741	Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-2, complete sequence	108574	30727	31147	108574		Salmonella_phage(100.0%)	1	NA	NA
WP_001229397.1|30727_31147_+	HNH endonuclease	NA	C6ZR29	Salmonella_phage	88.9	2.2e-68
>prophage 4
NZ_CP050741	Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-2, complete sequence	108574	43059	84496	108574	transposase,integrase,tRNA	Escherichia_phage(35.71%)	51	60585:60644	88312:89134
WP_000911322.1|43059_43458_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_000450265.1|43457_43685_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000986921.1|43766_49025_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000177629.1|49044_49785_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	3.9e-07
WP_000139307.1|49839_50403_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000477658.1|50517_50802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000983042.1|50814_50970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010999936.1|51756_52023_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001541552.1|52272_52350_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_001738692.1|52330_53212_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_071533052.1|54071_54293_+	YjiK family protein	NA	NA	NA	NA	NA
WP_000417898.1|54389_55148_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000725062.1|55414_55972_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	38.5	4.5e-24
WP_010999938.1|56061_56961_-	YjiK family protein	NA	NA	NA	NA	NA
WP_001192557.1|56957_57104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178592.1|57093_57747_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_001526811.1|57991_58342_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000004313.1|58326_58539_-	transcriptional regulator PefI	NA	NA	NA	NA	NA
WP_014343944.1|58970_59846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167798735.1|60098_60626_-	hypothetical protein	NA	NA	NA	NA	NA
60585:60644	attL	CAGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAG	NA	NA	NA	NA
WP_001067855.1|60650_61355_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845054.1|61986_63000_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_013263788.1|63165_63624_+	aminoglycoside N-acetyltransferase AAC(6')-Il	NA	NA	NA	NA	NA
WP_000679427.1|63753_64101_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|64094_64934_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_004883563.1|65061_65334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|65515_66520_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|66747_67953_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_001067855.1|68128_68833_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|69050_69911_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|69923_70466_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|70947_71139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|71162_71390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|71440_72577_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014342212.1|72543_72693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|72863_73568_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001246548.1|73674_74439_-	membrane protein	NA	NA	NA	NA	NA
WP_000990114.1|74510_74924_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001109588.1|74979_75201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|75200_75881_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
WP_015056585.1|76025_76217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|76262_76619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490265.1|76611_77082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925627.1|77592_78015_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000457541.1|78014_79289_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000064274.1|79370_80345_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.1e-84
WP_000427676.1|80344_81550_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|81964_82906_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|82937_83504_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|83560_83896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|84079_84496_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
88312:89134	attR	CAGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 5
NZ_CP050741	Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-2, complete sequence	108574	88377	89082	108574	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001067855.1|88377_89082_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 6
NZ_CP050741	Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-2, complete sequence	108574	94941	95106	108574		Salmonella_phage(100.0%)	1	NA	NA
WP_001576629.1|94941_95106_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
>prophage 7
NZ_CP050741	Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-2, complete sequence	108574	100528	100879	108574		Escherichia_phage(100.0%)	1	NA	NA
WP_001541541.1|100528_100879_+	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
>prophage 8
NZ_CP050741	Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-2, complete sequence	108574	103939	104722	108574	integrase	Macacine_betaherpesvirus(100.0%)	1	95278:95289	107644:107655
95278:95289	attL	TTATGAATATGA	NA	NA	NA	NA
WP_000082169.1|103939_104722_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
WP_000082169.1|103939_104722_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
107644:107655	attR	TCATATTCATAA	NA	NA	NA	NA
