The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050769	Salmonella enterica subsp. enterica serovar Indiana strain SI108 chromosome, complete genome	4925928	619947	677484	4925928	integrase,transposase,head,capsid,holin,terminase,tail,portal	Cronobacter_phage(61.9%)	65	619898:619913	680181:680196
619898:619913	attL	ATAGTCGGTGGTGATA	NA	NA	NA	NA
WP_001067855.1|619947_620652_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|620795_621350_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|621480_622311_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|622448_623081_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|623165_623618_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|623840_624188_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|624181_625021_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000050481.1|625425_626967_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000359986.1|628365_629139_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_077252464.1|629119_629401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002026779.1|629620_629806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002001451.1|629854_631039_+|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_000052512.1|631437_632913_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|632968_633853_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_004896925.1|634211_634754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|635638_636343_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_165488789.1|636951_638180_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	3.2e-176
WP_000287905.1|638951_639518_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000628304.1|639545_640160_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001428286.1|640541_641042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024201514.1|641323_642070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000265818.1|642132_642360_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000256688.1|643139_644744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000268404.1|644826_645423_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	87.4	9.4e-97
WP_000290290.1|645552_646869_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.8	3.5e-35
WP_001128281.1|647333_647495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054175283.1|648082_649783_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_000200791.1|649785_650331_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_000267954.1|650302_651028_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_001215677.1|651017_651548_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_054175279.1|651550_653563_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001001824.1|653572_654160_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175278.1|654152_655337_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001002797.1|655333_655663_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_167803027.1|655659_657627_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.8	4.0e-269
WP_000411340.1|657814_658072_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000376374.1|658218_658551_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_000175560.1|658550_658892_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|658888_659182_-|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|659191_659647_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_000220205.1|659643_660771_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
WP_000560081.1|660767_661475_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000084220.1|661471_661978_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000447490.1|661974_662463_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	4.3e-63
WP_000398492.1|662523_662718_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_001218534.1|662721_663426_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000550496.1|663429_664452_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_000018798.1|664513_665314_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_051129117.1|665474_667250_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.3	7.5e-291
WP_001650413.1|667246_668308_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.3	3.0e-162
WP_001552031.1|668304_668628_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_001748628.1|668601_668808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441649.1|668927_670949_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	7.9e-297
WP_001748626.1|670945_671806_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.4	4.9e-131
WP_000153512.1|671795_672125_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
WP_000422609.1|672121_672718_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_071592686.1|672708_672885_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_001748623.1|673031_673433_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.9e-48
WP_024139063.1|673432_673858_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.9e-23
WP_000643375.1|673847_674075_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000460877.1|674084_674588_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_001247709.1|674618_674840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748620.1|674959_675538_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
WP_001748619.1|675566_676460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001748617.1|676446_677484_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	65.6	7.1e-124
680181:680196	attR	ATAGTCGGTGGTGATA	NA	NA	NA	NA
>prophage 2
NZ_CP050769	Salmonella enterica subsp. enterica serovar Indiana strain SI108 chromosome, complete genome	4925928	704837	750183	4925928	integrase,transposase	Escherichia_phage(44.44%)	46	704785:704844	746215:747036
704785:704844	attL	AGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_001067855.1|704837_705542_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|705655_706432_+	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_000742814.1|706660_707686_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|708107_708860_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_165488106.1|710784_711156_+	phenol hydroxylase	NA	NA	NA	NA	NA
WP_085940648.1|711352_712443_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|712532_713348_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|713434_713737_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|713630_713882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344975.1|713912_715406_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|715517_715823_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|715850_717065_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|717281_718166_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|719090_719795_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_046788546.1|719879_720281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138064.1|720289_723256_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|723258_723819_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|723944_724295_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|724497_725511_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001456218.1|725677_726520_+	alpha/beta fold putative hydrolase EstX	NA	W8EKH7	Mycobacterium_phage	26.1	3.0e-08
WP_000050382.1|726615_727224_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001261740.1|727281_728073_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|728334_729594_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|729686_730478_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|730647_730980_+	quaternary ammonium compound efflux SMR transporter QacL	NA	E5E3Y9	Acinetobacter_phage	35.3	2.0e-08
WP_109023896.1|731881_732157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|732159_732951_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	NA	NA	NA	NA
WP_001354008.1|733419_733665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|733702_734566_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001067855.1|734796_735501_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|735651_736467_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|736656_737361_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001083725.1|737765_738263_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_071523897.1|738419_738665_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|739311_740016_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427623.1|740312_741317_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004883563.1|741498_741771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|741898_742738_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|742731_743079_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|743301_743754_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000186237.1|743838_744471_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001334766.1|744608_745439_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|745569_746124_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|746267_746972_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001065546.1|748231_749410_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
746215:747036	attR	AGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCG	NA	NA	NA	NA
WP_001067855.1|749478_750183_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
NZ_CP050769	Salmonella enterica subsp. enterica serovar Indiana strain SI108 chromosome, complete genome	4925928	762224	801662	4925928	lysis,integrase,head,capsid,terminase,tail,tRNA,plate,portal	Salmonella_phage(74.42%)	53	765096:765142	795397:795443
WP_000692312.1|762224_762446_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_053271974.1|762525_762894_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854822.1|762983_763367_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_001177592.1|763357_763846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166635458.1|763812_764055_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001280435.1|764151_764997_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
765096:765142	attL	TGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGTC	NA	NA	NA	NA
WP_015386347.1|765254_766268_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	60.2	4.8e-117
WP_015386349.1|766494_767109_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.6	7.8e-38
WP_015386350.1|767210_767447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015386351.1|767481_767991_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	1.0e-83
WP_015386352.1|767998_768199_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	8.7e-31
WP_000963477.1|768162_768504_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	86.7	2.6e-51
WP_001744223.1|768571_768805_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	80.5	5.4e-24
WP_039505139.1|768804_769032_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	1.9e-34
WP_079792110.1|769028_769880_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	71.9	8.1e-118
WP_039505137.1|769876_772270_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	90.3	0.0e+00
WP_001154443.1|772431_772620_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
WP_001217561.1|772631_772865_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_053216779.1|773489_773984_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	41.3	1.2e-28
WP_053216775.1|774063_774243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053216774.1|774296_775346_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	80.6	7.1e-156
WP_017382378.1|775345_777109_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	87.7	3.2e-312
WP_053216773.1|777258_778086_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	56.0	1.3e-72
WP_053216772.1|778101_779250_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	69.1	1.6e-132
WP_006777754.1|779253_779907_+|terminase	Small terminase subunit	terminase	E5G6M7	Salmonella_phage	56.1	5.2e-56
WP_047746799.1|780005_780473_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
WP_000868184.1|780472_780676_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|780679_780895_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_032266129.1|780875_781385_+	lysozyme	NA	E5G6N1	Salmonella_phage	79.9	1.7e-75
WP_032266128.1|781389_781767_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	95.2	2.4e-58
WP_164848160.1|781763_782192_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
WP_001039961.1|782287_782719_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_039505111.1|782711_783158_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	1.7e-66
WP_023223445.1|783226_783805_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	97.9	2.6e-107
WP_023223444.1|783801_784161_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	92.4	1.4e-55
WP_023223443.1|784147_785056_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	92.1	8.3e-145
WP_039505106.1|785048_785576_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	84.1	8.1e-84
WP_053216770.1|785583_787485_+	hypothetical protein	NA	Q37842	Escherichia_phage	76.8	5.1e-96
WP_023223490.1|787510_787921_+|tail	phage tail fiber assembly protein	tail	A0A291LAV4	Bordetella_phage	28.6	2.6e-05
WP_039505102.1|788054_789227_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	95.1	1.1e-213
WP_039505100.1|789236_789752_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.2	6.7e-91
WP_032233623.1|789806_790109_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	94.9	1.5e-42
WP_000763315.1|790123_790243_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_164848159.1|790469_793013_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	45.0	1.3e-107
WP_058800071.1|793009_793495_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	1.5e-71
WP_058800072.1|793491_794592_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	92.6	3.4e-185
WP_039505088.1|794660_794879_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	80.6	5.2e-29
WP_039505087.1|794894_795269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|795597_796104_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
795397:795443	attR	TGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGTC	NA	NA	NA	NA
WP_001519776.1|796227_798075_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|798224_799970_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|800205_800421_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_023200351.1|800648_801662_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	8.2e-109
>prophage 4
NZ_CP050769	Salmonella enterica subsp. enterica serovar Indiana strain SI108 chromosome, complete genome	4925928	1298299	1332436	4925928	integrase,capsid,head,terminase,holin,tail,tRNA,portal	Cronobacter_phage(68.97%)	39	1306276:1306291	1333969:1333984
WP_000469807.1|1298299_1299067_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1299107_1299455_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1299610_1300831_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212379.1|1300823_1301342_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1301781_1302852_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_023227266.1|1302861_1303983_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210991.1|1304040_1304949_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200077.1|1304909_1306070_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1306169_1306217_-	hypothetical protein	NA	NA	NA	NA	NA
1306276:1306291	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_054175282.1|1306380_1307373_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.1e-109
WP_000085723.1|1307439_1307739_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_002954289.1|1307847_1308186_+	phage regulatory protein	NA	NA	NA	NA	NA
WP_000645096.1|1308211_1308544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681786.1|1308553_1309123_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_000922120.1|1309125_1309344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054175272.1|1309382_1312040_+	toprim domain protein	NA	A0A077K8T2	Ralstonia_phage	47.6	7.1e-245
WP_000088096.1|1312067_1312391_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_054175273.1|1312390_1313410_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.8	2.5e-134
WP_023375469.1|1315401_1316238_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|1316272_1317301_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1317312_1318011_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_031602415.1|1318070_1318562_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.3e-48
WP_000080871.1|1318558_1319041_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|1319037_1319742_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|1319738_1320866_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|1320862_1321318_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|1321330_1321627_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|1321623_1321965_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|1321964_1322297_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|1322443_1322701_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_167803029.1|1322888_1324859_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	3.0e-272
WP_001002797.1|1324855_1325185_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|1325181_1326366_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|1326358_1326946_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|1326955_1328968_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1328970_1329501_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267954.1|1329490_1330216_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|1330187_1330733_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_054175283.1|1330735_1332436_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
1333969:1333984	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
>prophage 5
NZ_CP050769	Salmonella enterica subsp. enterica serovar Indiana strain SI108 chromosome, complete genome	4925928	1591342	1598203	4925928	transposase	Salmonella_virus(42.86%)	7	NA	NA
WP_106417237.1|1591342_1591489_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_109166850.1|1591504_1591648_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	85.4	2.6e-13
WP_023226601.1|1592637_1594560_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.8	3.9e-301
WP_000703601.1|1594566_1594833_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.3e-25
WP_023226602.1|1594801_1595191_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	97.5	1.3e-59
WP_001067855.1|1595302_1596007_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001590337.1|1597261_1598203_-	transporter protein	NA	E7DYY8	Enterobacteria_phage	87.8	4.1e-147
>prophage 6
NZ_CP050769	Salmonella enterica subsp. enterica serovar Indiana strain SI108 chromosome, complete genome	4925928	1829771	1838942	4925928	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1829771_1830719_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1830702_1831434_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1831414_1831522_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1831581_1832313_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1832535_1834221_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1834217_1834937_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950415.1|1834983_1835451_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
WP_023226723.1|1835507_1836038_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1836209_1836668_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023226722.1|1836908_1838942_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 7
NZ_CP050769	Salmonella enterica subsp. enterica serovar Indiana strain SI108 chromosome, complete genome	4925928	1917974	1928481	4925928		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023226691.1|1917974_1919378_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1919555_1920449_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1920825_1921911_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_023226690.1|1921910_1922810_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.8e-30
WP_023226689.1|1922857_1923736_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1923736_1924288_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_023200991.1|1924293_1925268_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1925283_1926057_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_167803032.1|1926061_1927141_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	8.7e-16
WP_000126349.1|1927167_1928481_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 8
NZ_CP050769	Salmonella enterica subsp. enterica serovar Indiana strain SI108 chromosome, complete genome	4925928	2038602	2049892	4925928	integrase	Burkholderia_phage(25.0%)	12	2032857:2032872	2047203:2047218
2032857:2032872	attL	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023226634.1|2038602_2039784_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	26.9	2.4e-35
WP_023226633.1|2039784_2040531_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_023226632.1|2040632_2041889_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	3.4e-80
WP_023226631.1|2042369_2042531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|2042657_2043077_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023194544.1|2043079_2044348_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	3.8e-228
WP_000208509.1|2044802_2045015_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2045025_2045214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154957.1|2045472_2046651_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	8.6e-110
WP_023227458.1|2047301_2047613_+	hypothetical protein	NA	NA	NA	NA	NA
2047203:2047218	attR	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023227459.1|2047692_2048388_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_001157305.1|2048461_2049892_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 9
NZ_CP050769	Salmonella enterica subsp. enterica serovar Indiana strain SI108 chromosome, complete genome	4925928	2231418	2270574	4925928	integrase,transposase,protease	Shigella_phage(37.5%)	30	2247855:2247871	2262442:2262458
WP_023227614.1|2231418_2232015_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000147031.1|2232011_2232743_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000070982.1|2232761_2234555_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_023227615.1|2234551_2235670_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_023227616.1|2236163_2237429_+	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
WP_089541817.1|2239991_2241219_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000136607.1|2242657_2245168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442952.1|2245171_2247736_+	hypothetical protein	NA	NA	NA	NA	NA
2247855:2247871	attL	TCAAACTGTTTTATTGA	NA	NA	NA	NA
WP_000716184.1|2248042_2248357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001232453.1|2248368_2248887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108266.1|2248940_2249468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442951.1|2249480_2249750_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	61.9	4.1e-15
WP_000093666.1|2249870_2250251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174655.1|2250408_2250951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142750.1|2250973_2251462_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_050516501.1|2251589_2251985_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_019841938.1|2252045_2252405_+	antitoxin	NA	NA	NA	NA	NA
WP_000744655.1|2252514_2253132_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_050516502.1|2253244_2254156_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	31.3	6.0e-10
WP_000870315.1|2254369_2254816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999224.1|2255080_2255275_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000468111.1|2255276_2256149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165488789.1|2256358_2257587_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	3.2e-176
WP_001218334.1|2257843_2261746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087212.1|2262067_2263753_-	hypothetical protein	NA	NA	NA	NA	NA
2262442:2262458	attR	TCAATAAAACAGTTTGA	NA	NA	NA	NA
WP_000151475.1|2263762_2264428_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000699006.1|2264428_2265826_-	hypothetical protein	NA	A0A2H4UW05	Bodo_saltans_virus	24.8	6.6e-08
WP_080229793.1|2267743_2268523_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	1.1e-137
WP_069067343.1|2269164_2269503_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	2.4e-33
WP_001443045.1|2269422_2270574_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	4.1e-40
>prophage 10
NZ_CP050769	Salmonella enterica subsp. enterica serovar Indiana strain SI108 chromosome, complete genome	4925928	2364906	2370718	4925928		Escherichia_phage(33.33%)	8	NA	NA
WP_000230462.1|2364906_2365713_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2365714_2366707_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2366706_2367597_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_023227163.1|2367720_2368122_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	3.8e-33
WP_051129228.1|2368421_2369309_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.5	5.6e-37
WP_023227161.1|2369615_2369885_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	92.1	1.8e-26
WP_071525147.1|2370239_2370380_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	1.1e-08
WP_071601154.1|2370418_2370718_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	57.1	2.2e-14
>prophage 11
NZ_CP050769	Salmonella enterica subsp. enterica serovar Indiana strain SI108 chromosome, complete genome	4925928	2836354	2842103	4925928	transposase	Enterobacteria_phage(33.33%)	6	NA	NA
WP_000497451.1|2836354_2836594_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_023226907.1|2837467_2838277_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	9.2e-63
WP_001277616.1|2838349_2838727_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_023226906.1|2838874_2839417_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	1.1e-70
WP_089541817.1|2840106_2841335_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_023226904.1|2841689_2842103_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 12
NZ_CP050769	Salmonella enterica subsp. enterica serovar Indiana strain SI108 chromosome, complete genome	4925928	3664036	3717850	4925928	lysis,integrase,transposase,terminase,coat,protease,portal	Enterobacteria_phage(72.06%)	75	3672613:3672658	3713959:3714004
WP_089541817.1|3664036_3665264_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000062033.1|3666017_3666554_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000781485.1|3666615_3667377_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_064441706.1|3667360_3669922_+	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
WP_000899098.1|3669926_3671252_+	fimbrial usher protein StbD	NA	NA	NA	NA	NA
WP_023227313.1|3671217_3671976_+	fimbrial assembly chaperone	NA	NA	NA	NA	NA
WP_023227314.1|3672023_3672218_-	hypothetical protein	NA	NA	NA	NA	NA
3672613:3672658	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000915528.1|3672946_3673309_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3673305_3674238_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3674227_3675685_+	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129933.1|3675743_3677747_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000532177.1|3677882_3678131_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|3678151_3678445_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_001029860.1|3678583_3680560_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_000246977.1|3680559_3681996_-	phage DNA ejection protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_000964904.1|3682006_3682696_-	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000627593.1|3682698_3683154_-	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000774917.1|3683153_3683855_-	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_001122420.1|3683858_3685277_-	Packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_001166103.1|3685236_3685737_-	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_000538670.1|3685720_3686281_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001196937.1|3686321_3687614_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_051129359.1|3687613_3688522_-	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	94.1	4.3e-149
WP_051129358.1|3688535_3690701_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.6	0.0e+00
WP_051129357.1|3690701_3692201_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.4	9.1e-306
WP_000729923.1|3692178_3692667_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3692670_3693075_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3693074_3693464_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3693467_3693710_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_000877028.1|3693932_3694463_-	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_001687043.1|3694675_3695143_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3695139_3695637_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3695614_3695818_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001047566.1|3696248_3697022_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000219133.1|3697018_3697198_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|3697178_3697382_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|3697378_3697603_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001108073.1|3697599_3698211_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000950963.1|3698203_3698380_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001532927.1|3698372_3698714_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000113770.1|3698716_3698893_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000679703.1|3698859_3699033_-	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000736891.1|3699029_3699467_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_001036030.1|3699540_3699810_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_001248410.1|3699806_3701183_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_000539342.1|3701179_3702001_-	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_000166961.1|3701987_3702149_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_001103492.1|3702183_3702465_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3702575_3702791_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3702901_3703591_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_001532928.1|3703755_3704835_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000834175.1|3704873_3705077_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_000216178.1|3705440_3705743_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_001066179.1|3705755_3706343_-	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000213982.1|3706556_3706751_+	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_072097849.1|3706834_3707449_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	94.4	7.0e-47
WP_000713613.1|3707482_3707770_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_000776963.1|3708045_3708360_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|3708444_3708603_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_051129356.1|3708583_3708739_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	4.7e-24
WP_000902092.1|3708761_3708905_+	hypothetical protein	NA	A0A2H5BFM6	Salmonella_phage	100.0	6.4e-20
WP_001046968.1|3708901_3709609_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_001253476.1|3709608_3709893_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111291.1|3709939_3710233_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001214777.1|3710243_3710414_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_000812203.1|3710410_3710920_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_071533029.1|3710916_3711150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025617570.1|3711136_3711781_+	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_000371199.1|3711780_3712065_+	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_000002104.1|3712057_3712342_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_155675089.1|3712410_3712551_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000051897.1|3712780_3713944_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_000893225.1|3714149_3715400_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.7e-98
3713959:3714004	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285275.1|3715411_3716515_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043667.1|3716797_3717850_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
>prophage 13
NZ_CP050769	Salmonella enterica subsp. enterica serovar Indiana strain SI108 chromosome, complete genome	4925928	3726838	3789881	4925928	transposase,plate	Stx2-converting_phage(60.0%)	54	NA	NA
WP_023226548.1|3726838_3727825_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000284051.1|3728138_3728717_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
WP_000973041.1|3728956_3731401_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_023226791.1|3731509_3732277_+	amidohydrolase	NA	NA	NA	NA	NA
WP_000788200.1|3732647_3733055_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_023226792.1|3733385_3734105_+	adhesin/invasin protein PagN	NA	NA	NA	NA	NA
WP_031603649.1|3734108_3734297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012532524.1|3734409_3734604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133467700.1|3735067_3735685_-	TioA protein	NA	NA	NA	NA	NA
WP_000141547.1|3735824_3736280_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023226794.1|3736412_3737471_-	fimbrial protein TcfD	NA	NA	NA	NA	NA
WP_023226795.1|3737493_3740181_-	fimbrial outer membrane usher protein TcfC	NA	NA	NA	NA	NA
WP_000287810.1|3740289_3740865_-	fimbrial protein TcfB	NA	NA	NA	NA	NA
WP_001009507.1|3740915_3741626_-	fimbrial protein TcfA	NA	NA	NA	NA	NA
WP_001682408.1|3743163_3743841_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3743840_3744188_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3744207_3745779_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001537061.1|3746224_3746350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000970302.1|3746469_3747417_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023209688.1|3748233_3749055_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000266939.1|3749462_3749933_-	pilin structural protein SafD	NA	NA	NA	NA	NA
WP_053505593.1|3749954_3752465_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_051129375.1|3752488_3753229_-	pili assembly chaperone PapD	NA	NA	NA	NA	NA
WP_051129374.1|3753303_3753801_-	Saf-pilin pilus formation protein SafA	NA	NA	NA	NA	NA
WP_051129373.1|3753933_3754428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051129376.1|3755984_3756212_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_127201574.1|3756257_3756722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023227287.1|3757967_3758105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053505599.1|3758247_3758856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000375832.1|3762999_3763446_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_023227778.1|3763469_3765659_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_000968384.1|3766055_3766577_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_023227777.1|3766600_3767017_-	DUF2195 family protein	NA	NA	NA	NA	NA
WP_001668725.1|3767143_3767605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023227776.1|3767589_3768060_-	glucosaminidase domain-containing protein	NA	NA	NA	NA	NA
WP_001254127.1|3768102_3768870_-	DUF2094 domain-containing protein	NA	NA	NA	NA	NA
WP_023227775.1|3768869_3772739_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_023166851.1|3772772_3773204_-	putative Shiga-like toxin A subunit	NA	NA	NA	NA	NA
WP_023227774.1|3773405_3774179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132483.1|3774183_3775488_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_023227773.1|3775484_3776828_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_023227772.1|3776831_3777368_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119443.1|3777434_3777920_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_000379146.1|3778062_3778446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001081544.1|3778430_3778916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312802.1|3779220_3779706_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_077907151.1|3779961_3780294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013884.1|3780593_3782102_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_023227770.1|3782125_3782671_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_023227769.1|3782770_3785410_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.9	5.3e-75
WP_023227768.1|3785777_3786680_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000750543.1|3786666_3787491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108007.1|3787487_3787982_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_023227767.1|3787997_3789881_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 14
NZ_CP050769	Salmonella enterica subsp. enterica serovar Indiana strain SI108 chromosome, complete genome	4925928	4336630	4400062	4925928	integrase,transposase,tRNA,protease	Vibrio_phage(16.67%)	56	4373241:4373256	4390089:4390104
WP_001232417.1|4336630_4337635_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312505.1|4337637_4338897_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_000460338.1|4339111_4340392_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051875.1|4340463_4340772_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001000734.1|4340854_4341805_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122557.1|4341797_4343654_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.8	5.8e-60
WP_023226964.1|4343663_4344986_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.2	1.8e-15
WP_000981984.1|4345002_4345464_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_000968675.1|4345435_4346983_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001615111.1|4346981_4348121_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001595273.1|4349205_4349946_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001271546.1|4350007_4350553_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	4.5e-29
WP_001595272.1|4350635_4351712_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934949.1|4351803_4352772_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236755.1|4352790_4356117_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000074655.1|4356183_4356498_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000149872.1|4356549_4358052_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004797.1|4358277_4359255_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.7e-26
WP_001192954.1|4359577_4361368_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829509.1|4361360_4362095_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208749.1|4362105_4362501_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000609650.1|4362511_4362871_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001221670.1|4362982_4363516_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.8	1.2e-47
WP_000118469.1|4363532_4363850_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000912959.1|4364105_4364693_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000239598.1|4364723_4364870_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_001595192.1|4364977_4365112_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_000257282.1|4365173_4365740_-	elongation factor P	NA	NA	NA	NA	NA
WP_017441214.1|4365780_4366809_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001229227.1|4367090_4367948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558210.1|4367995_4368349_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729126.1|4368592_4370239_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.7	1.2e-189
WP_000027827.1|4370282_4370576_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
WP_023227722.1|4370851_4372093_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267291.1|4372151_4372628_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069440.1|4372968_4374405_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
4373241:4373256	attL	CCAGTTCCCGGTAGAT	NA	NA	NA	NA
WP_000637595.1|4374519_4375821_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000887832.1|4375941_4376289_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_001748740.1|4376264_4377968_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188504.1|4378004_4378580_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218742.1|4378948_4380133_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	1.7e-121
WP_000053331.1|4380282_4381293_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000253907.1|4381388_4383515_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_001083368.1|4383577_4384855_+	MFS transporter	NA	NA	NA	NA	NA
WP_000813678.1|4384854_4386285_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_001037798.1|4386479_4387874_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_023181049.1|4388813_4389089_-|transposase	IS1 family transposase	transposase	Q71TE9	Escherichia_phage	97.8	3.8e-45
WP_100620379.1|4389138_4389948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001282653.1|4389944_4390700_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
4390089:4390104	attR	ATCTACCGGGAACTGG	NA	NA	NA	NA
WP_023181050.1|4390716_4392252_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	6.6e-102
WP_024179174.1|4392961_4394635_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001238009.1|4394687_4394885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000766273.1|4395024_4395291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001100175.1|4395287_4396859_-	ATP--cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
WP_001207400.1|4396905_4397985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541817.1|4398833_4400062_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
>prophage 1
NZ_CP050770	Salmonella enterica subsp. enterica serovar Indiana strain SI108 plasmid pSI108-1, complete sequence	145548	1262	66702	145548	integrase,transposase,protease	Escherichia_phage(31.82%)	59	NA	NA
WP_001066953.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_042344623.1|2123_2306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113708090.1|3077_4305_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.2e-177
WP_001072355.1|4784_5954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105060.1|6149_6443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421272.1|6548_6824_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001387467.1|6823_7108_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_167803036.1|8046_8418_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	8.2e-67
WP_001067855.1|8454_9159_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_167803037.1|9280_10186_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|10182_11421_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|11420_12005_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014342101.1|14708_14831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032277257.1|14810_15686_+	class A extended-spectrum beta-lactamase CTX-M-27	NA	A0A1B0VBP7	Salmonella_phage	100.0	1.2e-153
WP_013362812.1|15720_16689_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_000723069.1|17778_18213_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_000193209.1|18589_19408_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|19404_20610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|20889_22209_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000220758.1|22231_22399_-	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
WP_000833382.1|22459_23887_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|24101_24617_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|24619_25516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|25737_25971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|26632_26863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|27199_27661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|27690_28098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|28148_28466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|29906_30257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161490.1|33333_33894_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001323888.1|33882_34050_+	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_000454193.1|34069_34420_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001389366.1|35788_36262_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_001067855.1|36391_37096_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000844627.1|38732_38975_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001493764.1|39006_39657_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_001493765.1|39762_40962_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|40993_41878_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|42015_42408_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_167803038.1|45171_45519_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	74.8	4.9e-45
WP_000616807.1|47922_48576_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|48668_48926_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|48858_49260_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|50570_51275_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012372821.1|52414_53950_+	fluoroquinolone efflux MFS transporter QepA1	NA	NA	NA	NA	NA
WP_001470701.1|53977_54346_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_012372820.1|54602_56135_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_014342205.1|56361_56739_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	8.2e-22
WP_014342204.1|56774_57323_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_012372818.1|57403_58159_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_000027057.1|58328_59189_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|59371_59929_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067855.1|60731_61436_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001403349.1|61412_61838_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.7e-53
WP_000214483.1|63104_63284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045893453.1|63727_64564_-	APH(6)-I family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
WP_024261901.1|64563_65367_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_167803039.1|65473_66007_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.5	7.0e-35
WP_001067855.1|65997_66702_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
