The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050777	Salmonella enterica subsp. enterica serovar Indiana strain SI96 chromosome, complete genome	4782837	647124	683765	4782837	tRNA,head,terminase,portal,capsid,integrase,tail,holin	Cronobacter_phage(70.27%)	45	636993:637014	686074:686095
636993:637014	attL	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
WP_001748617.1|647124_648162_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	65.6	7.1e-124
WP_001748619.1|648148_649042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748620.1|649070_649649_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
WP_001247709.1|649768_649990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460877.1|650020_650524_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|650533_650761_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_024139063.1|650750_651176_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.9e-23
WP_001748623.1|651175_651577_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.9e-48
WP_071592686.1|651723_651900_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000422609.1|651890_652487_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_000153512.1|652483_652813_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
WP_001748626.1|652802_653663_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.4	4.9e-131
WP_064441649.1|653659_655681_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	7.9e-297
WP_001748628.1|655800_656007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|655980_656304_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_001650413.1|656300_657362_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.3	3.0e-162
WP_051129117.1|657358_659134_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.3	7.5e-291
WP_000018798.1|659294_660095_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|660156_661179_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218534.1|661182_661887_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000398492.1|661890_662085_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_000447490.1|662145_662634_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	4.3e-63
WP_000084220.1|662630_663137_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560081.1|663133_663841_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000220205.1|663837_664965_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
WP_000166743.1|664961_665417_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|665426_665720_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|665716_666058_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376374.1|666057_666390_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_000411340.1|666536_666794_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_051129153.1|666981_668952_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.8	3.6e-270
WP_001002797.1|668948_669278_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|669274_670459_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|670451_671039_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|671048_673061_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|673063_673594_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_054175280.1|673583_674309_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200791.1|674280_674826_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_001747522.1|674828_676529_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
WP_001128281.1|677116_677278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|677700_678207_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|678330_680178_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|680327_682073_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|682308_682524_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_023200351.1|682751_683765_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	8.2e-109
686074:686095	attR	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
>prophage 2
NZ_CP050777	Salmonella enterica subsp. enterica serovar Indiana strain SI96 chromosome, complete genome	4782837	1179604	1260906	4782837	tRNA,terminase,head,portal,capsid,integrase,tail,holin	Cronobacter_phage(51.22%)	82	1187581:1187596	1215271:1215286
WP_000469807.1|1179604_1180372_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1180412_1180760_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1180915_1182136_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212379.1|1182128_1182647_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1183086_1184157_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_023227266.1|1184166_1185288_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210991.1|1185345_1186254_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200077.1|1186214_1187375_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1187474_1187522_-	hypothetical protein	NA	NA	NA	NA	NA
1187581:1187596	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_054175282.1|1187685_1188678_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.1e-109
WP_000085723.1|1188744_1189044_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_002954289.1|1189152_1189491_+	phage regulatory protein	NA	NA	NA	NA	NA
WP_000645096.1|1189516_1189849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681786.1|1189858_1190428_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_000922120.1|1190430_1190649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054175272.1|1190687_1193345_+	toprim domain protein	NA	A0A077K8T2	Ralstonia_phage	47.6	7.1e-245
WP_000088096.1|1193372_1193696_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_054175273.1|1193695_1194715_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.8	2.5e-134
WP_054175274.1|1194711_1196496_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_023375469.1|1196706_1197543_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|1197577_1198606_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1198617_1199316_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_031602415.1|1199375_1199867_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.3e-48
WP_000080871.1|1199863_1200346_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|1200342_1201047_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|1201043_1202171_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|1202167_1202623_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|1202635_1202932_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|1202928_1203270_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|1203269_1203602_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|1203748_1204006_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_167811179.1|1204193_1206161_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.4	5.6e-271
WP_001002797.1|1206157_1206487_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|1206483_1207668_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|1207660_1208248_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|1208257_1210270_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1210272_1210803_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_054175280.1|1210792_1211518_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200791.1|1211489_1212035_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_001747522.1|1212037_1213738_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
WP_001748131.1|1214771_1215158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1215315_1215654_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1215271:1215286	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_000197660.1|1215925_1216663_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1216794_1217775_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992640.1|1217771_1218503_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235094.1|1218632_1221206_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_023227274.1|1227155_1227611_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.9e-34
WP_000807818.1|1227714_1229016_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264473.1|1229012_1229336_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1229380_1230736_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082642.1|1230850_1233511_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023227275.1|1233564_1234245_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023227276.1|1234317_1234737_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1234940_1235978_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1236093_1236783_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1237101_1237485_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023227277.1|1237546_1238134_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_023227278.1|1238236_1239136_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023227279.1|1239153_1240488_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083338.1|1240617_1241355_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_023227280.1|1241339_1242962_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1243225_1243390_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1243386_1243962_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1243993_1244644_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812021.1|1244643_1245600_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589049.1|1245596_1246076_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790154.1|1246327_1248127_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1248143_1249118_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1249391_1250072_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102230.1|1250068_1250974_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1250985_1251714_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818964.1|1251725_1252457_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1252456_1252837_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1252948_1253209_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022463.1|1253246_1254173_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276364.1|1254288_1255485_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_023227281.1|1255506_1256424_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1256461_1257310_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048531.1|1257425_1258319_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361660.1|1258329_1259691_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1259694_1260330_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_023216173.1|1260354_1260906_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP050777	Salmonella enterica subsp. enterica serovar Indiana strain SI96 chromosome, complete genome	4782837	1711057	1720228	4782837	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1711057_1712005_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1711988_1712720_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1712700_1712808_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1712867_1713599_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1713821_1715507_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1715503_1716223_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950415.1|1716269_1716737_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
WP_023226723.1|1716793_1717324_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1717495_1717954_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023226722.1|1718194_1720228_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 4
NZ_CP050777	Salmonella enterica subsp. enterica serovar Indiana strain SI96 chromosome, complete genome	4782837	1799260	1809767	4782837		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023226691.1|1799260_1800664_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1800841_1801735_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1802111_1803197_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_023226690.1|1803196_1804096_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.8e-30
WP_023226689.1|1804143_1805022_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1805022_1805574_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_023200991.1|1805579_1806554_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1806569_1807343_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|1807347_1808427_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1808453_1809767_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP050777	Salmonella enterica subsp. enterica serovar Indiana strain SI96 chromosome, complete genome	4782837	1919885	1931173	4782837	integrase	Burkholderia_phage(25.0%)	12	1914144:1914159	1928484:1928499
1914144:1914159	attL	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023226634.1|1919885_1921067_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	26.9	2.4e-35
WP_023226633.1|1921067_1921814_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_023226632.1|1921915_1923172_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	3.4e-80
WP_023226631.1|1923652_1923814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1923940_1924360_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023194544.1|1924362_1925631_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	3.8e-228
WP_000208509.1|1926085_1926298_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1926308_1926497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154957.1|1926755_1927934_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	8.6e-110
WP_023227458.1|1928582_1928894_+	hypothetical protein	NA	NA	NA	NA	NA
1928484:1928499	attR	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023227459.1|1928973_1929669_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_001157305.1|1929742_1931173_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP050777	Salmonella enterica subsp. enterica serovar Indiana strain SI96 chromosome, complete genome	4782837	2111919	2151074	4782837	transposase,protease,integrase	Shigella_phage(37.5%)	31	2128356:2128372	2142942:2142958
WP_023227614.1|2111919_2112516_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000147031.1|2112512_2113244_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000070982.1|2113262_2115056_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_023227615.1|2115052_2116171_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_023227616.1|2116664_2117930_+	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
WP_089541817.1|2120492_2121720_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000136607.1|2123158_2125669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442952.1|2125672_2128237_+	hypothetical protein	NA	NA	NA	NA	NA
2128356:2128372	attL	TCAAACTGTTTTATTGA	NA	NA	NA	NA
WP_000716184.1|2128543_2128858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001232453.1|2128869_2129388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108266.1|2129441_2129969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442951.1|2129981_2130251_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	61.9	4.1e-15
WP_000093666.1|2130371_2130752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174655.1|2130909_2131452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142750.1|2131474_2131963_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_050516501.1|2132090_2132486_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_019841938.1|2132546_2132906_+	antitoxin	NA	NA	NA	NA	NA
WP_000744655.1|2133015_2133633_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_050516502.1|2133745_2134657_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	31.3	6.0e-10
WP_000870315.1|2134870_2135317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999224.1|2135581_2135776_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000468111.1|2135777_2136650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165488789.1|2136859_2138088_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	3.2e-176
WP_167803806.1|2138344_2139568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167803807.1|2139588_2142246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087212.1|2142567_2144253_-	hypothetical protein	NA	NA	NA	NA	NA
2142942:2142958	attR	TCAATAAAACAGTTTGA	NA	NA	NA	NA
WP_000151475.1|2144262_2144928_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000699006.1|2144928_2146326_-	hypothetical protein	NA	A0A2H4UW05	Bodo_saltans_virus	24.8	6.6e-08
WP_080229793.1|2148243_2149023_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	1.1e-137
WP_069067343.1|2149664_2150003_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	2.4e-33
WP_001443045.1|2149922_2151074_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	4.1e-40
>prophage 7
NZ_CP050777	Salmonella enterica subsp. enterica serovar Indiana strain SI96 chromosome, complete genome	4782837	2245406	2251218	4782837		Escherichia_phage(33.33%)	8	NA	NA
WP_000230462.1|2245406_2246213_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2246214_2247207_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2247206_2248097_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_023227163.1|2248220_2248622_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	3.8e-33
WP_051129228.1|2248921_2249809_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.5	5.6e-37
WP_023227161.1|2250115_2250385_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	92.1	1.8e-26
WP_071525147.1|2250739_2250880_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	1.1e-08
WP_071601154.1|2250918_2251218_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	57.1	2.2e-14
>prophage 8
NZ_CP050777	Salmonella enterica subsp. enterica serovar Indiana strain SI96 chromosome, complete genome	4782837	2714312	2721775	4782837	transposase	Escherichia_phage(42.86%)	8	NA	NA
WP_000497451.1|2714312_2714552_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_023226907.1|2715425_2716235_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	9.2e-63
WP_001277616.1|2716307_2716685_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_023226906.1|2716832_2717375_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	1.1e-70
WP_023218771.1|2717566_2718295_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	1.4e-62
WP_023226904.1|2718311_2718725_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_023226903.1|2719675_2720800_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000502119.1|2721316_2721775_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 9
NZ_CP050777	Salmonella enterica subsp. enterica serovar Indiana strain SI96 chromosome, complete genome	4782837	3545986	3635924	4782837	lysis,terminase,portal,integrase,tail,protease,holin,coat,plate	Enterobacteria_phage(46.34%)	131	3545653:3545698	3632033:3632078
3545653:3545698	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000915528.1|3545986_3546349_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3546345_3547278_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3547267_3548725_+	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129933.1|3548783_3550787_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000532177.1|3550922_3551171_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|3551191_3551485_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_001029860.1|3551623_3553600_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_000246977.1|3553599_3555036_-	phage DNA ejection protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_000964904.1|3555046_3555736_-	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000627593.1|3555738_3556194_-	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000774917.1|3556193_3556895_-	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_001122420.1|3556898_3558317_-	Packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_001166103.1|3558276_3558777_-	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_000538670.1|3558760_3559321_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001196937.1|3559361_3560654_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_051129359.1|3560653_3561562_-	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	94.1	4.3e-149
WP_051129358.1|3561575_3563741_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.6	0.0e+00
WP_051129357.1|3563741_3565241_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.4	9.1e-306
WP_000729923.1|3565218_3565707_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3565710_3566115_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3566114_3566504_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3566507_3566750_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_000877028.1|3566972_3567503_-	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_001687043.1|3567715_3568183_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3568179_3568677_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3568654_3568858_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001047566.1|3569288_3570062_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000219133.1|3570058_3570238_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|3570218_3570422_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|3570418_3570643_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001108073.1|3570639_3571251_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000950963.1|3571243_3571420_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001532927.1|3571412_3571754_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000113770.1|3571756_3571933_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000679703.1|3571899_3572073_-	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000736891.1|3572069_3572507_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_001036030.1|3572580_3572850_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_001248410.1|3572846_3574223_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_000539342.1|3574219_3575041_-	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_000166961.1|3575027_3575189_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_001103492.1|3575223_3575505_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3575615_3575831_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3575941_3576631_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_001532928.1|3576795_3577875_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000834175.1|3577913_3578117_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_000216178.1|3578480_3578783_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_001066179.1|3578795_3579383_-	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000213982.1|3579596_3579791_+	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_072097849.1|3579874_3580489_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	94.4	7.0e-47
WP_000713613.1|3580522_3580810_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_000776963.1|3581085_3581400_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|3581484_3581643_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_051129356.1|3581623_3581779_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	4.7e-24
WP_000902092.1|3581801_3581945_+	hypothetical protein	NA	A0A2H5BFM6	Salmonella_phage	100.0	6.4e-20
WP_001046968.1|3581941_3582649_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_001253476.1|3582648_3582933_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111291.1|3582979_3583273_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001214777.1|3583283_3583454_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_000812203.1|3583450_3583960_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_071533029.1|3583956_3584190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025617570.1|3584176_3584821_+	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_000371199.1|3584820_3585105_+	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_000002104.1|3585097_3585382_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_155675089.1|3585450_3585591_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000051897.1|3585820_3586984_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_167811182.1|3588188_3588743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064441708.1|3588802_3590041_-	hypothetical protein	NA	S4TRC1	Salmonella_phage	44.6	1.0e-92
WP_031604121.1|3590042_3590474_-|tail	tail assembly chaperone	tail	K7P7H0	Enterobacteria_phage	37.1	1.1e-11
WP_064441710.1|3590486_3591254_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	58.0	1.4e-44
WP_064441712.1|3591253_3591934_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	77.9	1.8e-104
WP_064441714.1|3591930_3593121_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J5T1	uncultured_Caudovirales_phage	75.6	2.5e-165
WP_064441716.1|3593121_3593475_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	75.2	5.3e-47
WP_064441718.1|3593474_3594230_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	72.4	8.0e-85
WP_064441720.1|3594423_3594771_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	57.1	1.9e-25
WP_064441722.1|3594757_3595849_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	59.4	1.9e-119
WP_064441723.1|3595851_3596154_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	55.0	1.3e-25
WP_129406985.1|3596150_3596741_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	63.1	4.2e-57
WP_064441727.1|3596740_3598717_-	hypothetical protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	45.1	1.3e-134
WP_064441729.1|3598713_3598860_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	74.5	3.2e-14
WP_064441731.1|3598895_3599339_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	52.8	7.9e-32
WP_064441733.1|3599342_3599783_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	8.3e-58
WP_064441837.1|3599792_3600944_-	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	81.5	2.2e-174
WP_064441735.1|3600949_3601501_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	45.7	8.8e-41
WP_064441736.1|3601493_3601898_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	71.8	9.7e-45
WP_064441738.1|3601897_3602407_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	42.4	2.2e-22
WP_064441740.1|3602406_3602823_-	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	63.0	2.7e-42
WP_064441742.1|3602809_3603157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441744.1|3603197_3604139_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.7	9.2e-139
WP_064441746.1|3604150_3604645_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	9.3e-50
WP_064441748.1|3604648_3605851_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.5	1.4e-107
WP_064441838.1|3605902_3606451_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	54.6	1.1e-43
WP_064441750.1|3606506_3607958_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	69.0	1.4e-191
WP_064441752.1|3607962_3609576_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	84.4	3.0e-278
WP_064441754.1|3609578_3610052_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	69.5	9.6e-52
WP_064441756.1|3610082_3610715_-	hypothetical protein	NA	I6S676	Salmonella_phage	75.9	7.9e-94
WP_064441758.1|3610803_3611007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441840.1|3611082_3611517_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	59.7	6.1e-37
WP_064441760.1|3611549_3611990_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	84.6	1.0e-63
WP_064441762.1|3611973_3612297_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	73.3	1.6e-37
WP_064441763.1|3612940_3613630_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	4.9e-57
WP_064441765.1|3613739_3614333_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	58.1	2.1e-56
WP_077951536.1|3614325_3614496_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	61.8	2.9e-11
WP_064441767.1|3614488_3614938_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	51.4	1.8e-36
WP_063161920.1|3615864_3616287_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	85.2	6.1e-66
WP_064441771.1|3616288_3616822_-	ead/Ea22-like family protein	NA	A0A193GYX5	Enterobacter_phage	38.5	6.0e-10
WP_064441773.1|3616818_3617064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441777.1|3617548_3617848_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	48.4	3.1e-16
WP_064441779.1|3617847_3619281_-	AAA family ATPase	NA	Q716D2	Shigella_phage	86.5	2.0e-230
WP_064441781.1|3619270_3620170_-	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	55.0	2.4e-80
WP_015571544.1|3620162_3620309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441783.1|3620398_3620965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001514164.1|3620994_3621246_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	54.7	9.0e-17
WP_064441784.1|3621373_3622066_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.4	6.9e-59
WP_063407876.1|3622101_3622578_+	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	64.7	1.4e-50
WP_064441842.1|3623200_3623806_+	hypothetical protein	NA	A0A2C9D0J8	Yersinia_phage	36.6	2.5e-28
WP_167802264.1|3624196_3624355_+	hypothetical protein	NA	M9NZI5	Enterobacteria_phage	88.5	3.5e-19
WP_064441788.1|3624351_3624555_+	hypothetical protein	NA	K7PM31	Enterobacteria_phage	80.9	9.5e-25
WP_064441790.1|3624625_3625564_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	73.7	1.6e-37
WP_064441792.1|3625571_3625856_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	61.7	3.1e-29
WP_064441794.1|3625870_3626716_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.0	3.7e-70
WP_064441796.1|3626712_3627393_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	91.2	4.8e-121
WP_064441798.1|3627389_3627821_+	hypothetical protein	NA	G8C7S8	Escherichia_phage	65.0	3.5e-45
WP_064441800.1|3627978_3628461_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.4	5.5e-71
WP_064441802.1|3628457_3629123_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	83.3	1.6e-105
WP_064441804.1|3629122_3629347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064441806.1|3629343_3629949_+	hypothetical protein	NA	R9VWB9	Serratia_phage	46.8	1.8e-47
WP_064441808.1|3629948_3630170_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	48.4	2.7e-09
WP_064441812.1|3630854_3632018_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	68.3	2.5e-154
WP_000893225.1|3632223_3633474_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.7e-98
3632033:3632078	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285275.1|3633485_3634589_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043667.1|3634871_3635924_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
>prophage 1
NZ_CP050778	Salmonella enterica subsp. enterica serovar Indiana strain SI96 plasmid pSI96-1, complete sequence	190811	92796	127492	190811	transposase	Escherichia_phage(41.67%)	37	NA	NA
WP_087522250.1|92796_94165_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
WP_024136340.1|94270_94423_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001067855.1|94534_95239_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|95382_95937_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|96067_96898_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|97035_97668_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|97752_98205_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|98427_98775_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|98768_99608_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|99735_99939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|100056_100761_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012783960.1|100751_102341_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	1.4e-293
WP_001493764.1|102671_103322_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_001493765.1|103427_104627_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|104658_105543_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|105680_106073_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_031613424.1|107937_108288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|108664_108982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|109032_109440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|109469_109931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|110267_110498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|111159_111393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975182.1|111614_112511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572389.1|112513_113029_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833382.1|113243_114671_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000220758.1|114731_114899_+	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
WP_000078514.1|114921_116241_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_001572381.1|116520_117726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|117722_118541_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001426317.1|119183_119564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|119621_120287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104976713.1|121061_121667_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	7.0e-116
WP_000691727.1|121742_123662_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	100.0	0.0e+00
WP_001791010.1|123677_123794_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000184001.1|124979_126185_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|126195_126501_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|126727_127492_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
