The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP022650	Escherichia coli strain 09-02E	5075911	894076	1022867	5075911	portal,plate,capsid,tRNA,holin,lysis,head,protease,tail,terminase,integrase	Salmonella_phage(36.79%)	143	888511:888525	1004466:1004481
888511:888525	attL	TTTTTCTTCCACCAG	NA	NA	NA	NA
WP_021580608.1|894076_895129_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
888511:888525	attL	TTTTTCTTCCACCAG	NA	NA	NA	NA
WP_021580609.1|895208_896540_-	hypothetical protein	NA	R9TRQ8	Vibrio_phage	27.1	3.2e-20
WP_001350185.1|896553_896736_-	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	55.9	8.5e-09
WP_001350184.1|896751_897321_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	3.2e-38
WP_000188450.1|897466_897670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460900.1|897734_898244_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	2.9e-86
WP_001350183.1|898251_898485_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	86.1	5.2e-11
WP_000166365.1|898432_898891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085961902.1|899084_899351_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	83.3	1.1e-15
WP_000996717.1|899468_899810_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_032202462.1|899877_900111_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.4e-32
WP_000752613.1|900110_900338_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_032202463.1|900334_901192_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	6.2e-158
WP_113441978.1|901188_903603_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	95.6	0.0e+00
WP_001154430.1|903756_903945_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217562.1|903955_904189_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_000920990.1|904537_905593_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_063082208.1|905636_906662_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.2	3.1e-172
WP_097312837.1|906661_908428_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_113441977.1|908570_909404_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	85.9	2.2e-123
WP_000742511.1|909420_910479_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059191.1|910482_911133_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673523.1|911228_911693_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868192.1|911692_911896_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	6.8e-31
WP_000171568.1|911899_912115_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069909.1|912095_912608_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000727855.1|912609_912987_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	6.7e-16
WP_001337513.1|912983_913412_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.9e-47
WP_001039935.1|913507_913939_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_000829141.1|913931_914378_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
WP_000993775.1|914446_915025_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000177590.1|915021_915381_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000268280.1|915367_916276_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_001086824.1|916268_916874_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
WP_113441976.1|916870_918415_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	70.8	7.1e-197
WP_097312841.1|918415_919018_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	85.4	4.9e-93
WP_097312840.1|918989_919430_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	64.7	3.3e-46
WP_171005146.1|919432_919807_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	45.1	6.7e-16
WP_000905030.1|919834_920401_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	3.2e-86
WP_000046120.1|920543_921716_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_001207660.1|921725_922241_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|922295_922598_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|922612_922732_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_113441975.1|922724_925802_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.4	0.0e+00
WP_000980419.1|925798_926284_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_001011797.1|926280_927381_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	1.7e-176
WP_000972391.1|927471_927690_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|927925_929611_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681104.1|929880_930258_+	membrane protein	NA	NA	NA	NA	NA
WP_001195231.1|930287_930545_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201570.1|930704_930992_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189165.1|930975_931698_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001538500.1|931758_932661_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|932748_933225_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_001538501.1|933574_934687_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|934781_935915_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105434.1|935924_936878_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|936874_937720_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|937779_938268_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001538502.1|938308_939436_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.7	6.7e-27
WP_001467833.1|939464_940196_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|940421_941090_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001692.1|941089_941806_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756575.1|941812_942544_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|942561_943290_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001538503.1|943507_944023_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|944148_944472_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255186.1|944468_945299_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001538504.1|945295_946309_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001538505.1|946407_947838_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001556872.1|947848_948850_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815372.1|948886_950605_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
949628:949642	attR	TTTTTCTTCCACCAG	NA	NA	NA	NA
WP_000178690.1|950737_951706_-	NADH oxidoreductase	NA	NA	NA	NA	NA
949628:949642	attR	TTTTTCTTCCACCAG	NA	NA	NA	NA
WP_000458842.1|951717_953370_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491135.1|953513_954413_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|954733_955429_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599809.1|955854_957513_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001351020.1|957509_958466_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746478.1|958616_959732_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001538507.1|959728_961675_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|961747_961972_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_001538508.1|962294_962615_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	2.6e-13
WP_001538509.1|962645_964922_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.4	3.3e-166
WP_001040187.1|965665_965884_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241673.1|966168_966873_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202199.1|966914_968636_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001043558.1|968636_970403_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.9	4.1e-23
WP_000537432.1|970525_971491_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|972034_972529_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_033561644.1|972663_976653_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|976811_977423_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|977433_978777_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|978867_980160_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_033561643.1|980398_982843_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	2.5e-220
WP_000213098.1|982853_983471_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_001357121.1|983472_984336_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|984371_984998_-	hydrolase	NA	NA	NA	NA	NA
WP_001538514.1|985311_986460_+	MFS transporter	NA	NA	NA	NA	NA
WP_000067979.1|986556_987354_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023390.1|987385_988381_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_001389238.1|988474_988774_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_001389237.1|988882_989239_+	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_001706203.1|989249_989420_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	3.0e-24
WP_001475191.1|989416_989917_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	98.8	6.5e-91
WP_000557699.1|989980_990205_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	1.0e-32
WP_001277961.1|990204_990507_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	99.0	3.8e-46
WP_001113264.1|990506_990731_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027668.1|990727_991003_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	6.6e-45
WP_134347189.1|990992_993278_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.2	0.0e+00
WP_001704921.1|993277_993730_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	97.3	2.1e-80
WP_000355825.1|994165_994897_+	hypothetical protein	NA	A0A218M4H5	Erwinia_phage	79.4	1.3e-108
WP_001704922.1|995009_996299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038148.1|996623_997658_-|portal	phage portal protein	portal	Q7Y4E8	Escherichia_virus	99.7	3.2e-201
WP_000156861.1|997657_999430_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085953.1|999603_1000458_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_001248573.1|1000516_1001590_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	6.7e-202
WP_021038202.1|1001593_1002337_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.2	4.3e-123
WP_000988633.1|1002436_1002946_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_021038203.1|1002945_1003149_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	98.5	3.4e-30
WP_000123123.1|1003152_1003434_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1003433_1003931_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_021038204.1|1003945_1004371_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.0	8.9e-57
WP_021038205.1|1004358_1004784_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	4.7e-66
WP_072134039.1|1004755_1004929_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	6.8e-24
WP_102787862.1|1004891_1005359_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.1	2.8e-80
WP_021563760.1|1005351_1005810_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	62.4	7.8e-43
WP_077727440.1|1005806_1006562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086353173.1|1006639_1007275_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	5.9e-113
WP_000127164.1|1007271_1007619_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_027662781.1|1007623_1008532_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	3.4e-162
WP_134347190.1|1008524_1009055_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	98.3	3.3e-101
WP_113286907.1|1009065_1011801_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	81.5	0.0e+00
WP_065275708.1|1011804_1012332_+|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	96.0	6.2e-92
WP_077727464.1|1012483_1013263_-	hypothetical protein	NA	Q858R7	Enterobacteria_phage	99.2	6.9e-116
WP_102787901.1|1013663_1014854_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.0e-224
WP_001251408.1|1014866_1015385_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1015441_1015717_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|1015749_1015869_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_134347161.1|1015861_1018309_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	93.0	0.0e+00
WP_134347162.1|1018323_1018803_+|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.1e-84
WP_001532454.1|1018802_1019966_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	4.8e-206
WP_000468308.1|1020047_1020266_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292822.1|1020584_1022867_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 2
NZ_AP022650	Escherichia coli strain 09-02E	5075911	1232103	1321408	5075911	portal,capsid,transposase,tRNA,holin,lysis,head,tail,terminase,integrase	Enterobacteria_phage(42.11%)	100	1229137:1229152	1307096:1307111
1229137:1229152	attL	CAGCCAATGCATTATT	NA	NA	NA	NA
WP_000074983.1|1232103_1233222_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|1233190_1233460_-	excisionase	NA	NA	NA	NA	NA
WP_032284123.1|1233521_1235993_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000199480.1|1236088_1236277_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|1236273_1236462_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001295058.1|1237028_1237223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394541.1|1237211_1237550_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_000380313.1|1237561_1237714_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_001303511.1|1238005_1238284_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|1238285_1238477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|1238497_1238869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|1238967_1239270_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|1239266_1239692_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095673.1|1239714_1240677_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	1.6e-69
WP_021534702.1|1240717_1241140_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	77.0	1.4e-54
WP_000004322.1|1241136_1241391_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	94.0	4.8e-42
WP_021534703.1|1241383_1241695_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	96.1	2.6e-58
WP_001224665.1|1241823_1242006_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_021534704.1|1241998_1242175_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	91.4	2.8e-25
WP_001142588.1|1242748_1242967_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	3.6e-30
WP_000224216.1|1242968_1243232_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
WP_000207997.1|1243242_1243410_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000350274.1|1243517_1243751_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
WP_000967408.1|1243986_1244199_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000401168.1|1244958_1246062_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000687431.1|1246219_1246393_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	68.5	6.8e-16
WP_001410105.1|1246452_1246731_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_094315388.1|1246732_1247788_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.7	2.3e-90
WP_094315389.1|1247788_1248169_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.6	5.3e-37
WP_032265151.1|1248165_1248987_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.8	4.5e-81
WP_000917767.1|1249213_1249411_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_001563803.1|1249561_1250611_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	90.2	1.2e-184
WP_000562553.1|1251414_1251546_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000871291.1|1251826_1252162_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001309419.1|1252407_1252611_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
WP_001309421.1|1252607_1252769_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
WP_000284506.1|1252918_1253134_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001545911.1|1253138_1254029_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.6	4.7e-108
WP_001092866.1|1254065_1254599_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001446668.1|1254755_1254938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280932.1|1254952_1255084_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_064773083.1|1255086_1255554_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	85.1	3.0e-66
WP_000830178.1|1255864_1256191_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001322427.1|1256313_1256667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235436.1|1257149_1257659_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_060624626.1|1257630_1259559_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.0e-261
WP_000258993.1|1259542_1259749_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001322425.1|1259745_1261338_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
WP_001253888.1|1261327_1262833_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
WP_000256814.1|1262869_1263217_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_001573716.1|1263274_1264303_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	4.1e-116
WP_000201530.1|1264354_1264729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204533.1|1264721_1265075_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000974996.1|1265090_1265624_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
WP_000683079.1|1265620_1266016_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235047.1|1266023_1266773_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	2.7e-125
WP_001309426.1|1266791_1267223_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	7.4e-43
WP_094315422.1|1267249_1267663_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	3.5e-42
WP_001556919.1|1267643_1270205_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.7	0.0e+00
WP_000847298.1|1270201_1270531_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001348269.1|1270530_1271229_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.6	1.1e-128
WP_000194711.1|1271239_1271983_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	7.7e-149
WP_072037205.1|1271928_1272561_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.4e-103
WP_032198501.1|1272904_1276597_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
WP_044066009.1|1276664_1277264_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	8.8e-103
WP_094315386.1|1277415_1280442_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	54.4	4.5e-54
WP_001545928.1|1280441_1281026_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.0e-104
WP_000240999.1|1281080_1281749_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937481.1|1281805_1282072_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
WP_001538615.1|1282303_1283167_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	27.8	5.1e-11
WP_000531578.1|1283150_1284287_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1284536_1285763_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1285811_1286933_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|1287008_1288469_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1288468_1289140_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_033561626.1|1289309_1290680_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001295971.1|1290683_1291325_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001298466.1|1291360_1292467_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1292520_1292982_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248679.1|1292991_1293645_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_001773892.1|1293816_1295067_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001556895.1|1295503_1297021_+	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	53.0	8.1e-145
WP_001556896.1|1297020_1297878_+	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	38.9	8.3e-54
WP_001254932.1|1299790_1300942_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001538622.1|1301824_1302901_+|transposase	IS110-like element ISEc21 family transposase	transposase	NA	NA	NA	NA
WP_001538625.1|1304131_1304833_+	replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.3	1.0e-126
WP_139371347.1|1308325_1309539_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
1307096:1307111	attR	AATAATGCATTGGCTG	NA	NA	NA	NA
WP_000700202.1|1309983_1311027_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072093903.1|1311376_1311478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053004.1|1311474_1311930_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.2e-59
WP_001538627.1|1311929_1312100_+	protein ninE	NA	K7P7K0	Enterobacteria_phage	67.9	4.1e-13
WP_000774478.1|1312092_1312383_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	6.7e-48
WP_001538628.1|1312379_1312742_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.9	2.1e-59
WP_000971095.1|1312738_1312879_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001204794.1|1312964_1313348_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
WP_000737271.1|1313536_1314619_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1315208_1315424_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_050575893.1|1315603_1319014_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.9	0.0e+00
WP_001538630.1|1319072_1321133_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.5	3.3e-125
WP_000654168.1|1321129_1321408_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
>prophage 3
NZ_AP022650	Escherichia coli strain 09-02E	5075911	1426026	1492943	5075911	capsid,holin,lysis,head,protease,tail,terminase,integrase	Escherichia_phage(40.62%)	85	1425863:1425888	1478809:1478834
1425863:1425888	attL	CGGTCTGGTACATGGATATCGATACC	NA	NA	NA	NA
WP_000113674.1|1426026_1427157_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1427134_1427383_-	excisionase	NA	NA	NA	NA	NA
WP_000048416.1|1427447_1429919_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|1430011_1430203_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449191.1|1430199_1430388_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001351093.1|1430788_1431226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016238838.1|1431203_1431524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304608.1|1431526_1431766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379612.1|1431925_1432081_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_000753626.1|1432334_1432796_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
WP_001053425.1|1432903_1433179_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
WP_000702041.1|1433162_1433588_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262415.1|1433659_1434700_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	89.8	1.0e-98
WP_001309414.1|1434611_1435154_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450708.1|1435187_1435958_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.0	1.5e-86
WP_001141099.1|1435973_1436366_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|1436362_1436659_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209475.1|1436655_1437117_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_000403780.1|1437094_1437394_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.3e-50
WP_001224665.1|1437546_1437729_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_021534704.1|1437721_1437898_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	91.4	2.8e-25
WP_001289986.1|1437894_1438254_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	73.5	1.7e-37
WP_000510387.1|1438254_1438470_+	hypothetical protein	NA	A0A222YWK2	Escherichia_phage	94.4	2.2e-35
WP_001142588.1|1438471_1438690_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	3.6e-30
WP_000224216.1|1438691_1438955_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
WP_000207997.1|1438965_1439133_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000350274.1|1439240_1439474_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
WP_000967408.1|1439708_1439921_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001004956.1|1440086_1440737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000687431.1|1441979_1442153_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	68.5	6.8e-16
WP_001403449.1|1442212_1442485_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
WP_001265091.1|1442486_1443533_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
WP_000904114.1|1443545_1443920_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|1443916_1444738_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917768.1|1444964_1445162_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_000935524.1|1445312_1446371_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.9	5.2e-207
WP_001304604.1|1446834_1447266_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	95.1	8.1e-66
WP_000216690.1|1447262_1447427_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	2.6e-17
WP_000874510.1|1448392_1450354_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	3.3e-239
WP_001304601.1|1450489_1450672_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
WP_001304600.1|1450709_1450955_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
WP_000284510.1|1451031_1451247_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000731249.1|1451251_1451602_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	93.0	4.0e-55
WP_000992075.1|1451665_1452199_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	1.4e-99
WP_000459345.1|1452358_1452496_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
WP_001082534.1|1452497_1452992_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	90.7	1.1e-74
WP_000736383.1|1452988_1453213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304598.1|1453411_1453612_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829186.1|1453653_1454019_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	1.7e-61
WP_000958372.1|1454309_1454873_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_001304597.1|1454869_1456531_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.6	0.0e+00
WP_000173054.1|1456595_1458533_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	97.8	0.0e+00
WP_001063027.1|1458577_1458799_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_000125984.1|1461163_1461490_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007909.1|1461502_1461853_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	4.6e-59
WP_000573362.1|1461849_1462296_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_000133388.1|1462292_1462637_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275433.1|1462702_1463416_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	2.3e-126
WP_000710952.1|1463433_1463808_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001538679.1|1463903_1464113_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	2.0e-33
WP_033561640.1|1464160_1467403_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.1	0.0e+00
WP_000807940.1|1467395_1467737_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_021524657.1|1467736_1468435_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	1.9e-128
WP_001351101.1|1468445_1469189_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
WP_032300536.1|1469134_1469767_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_001773905.1|1470110_1473803_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.8	0.0e+00
WP_016238842.1|1473870_1474470_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	1.0e-106
WP_016238843.1|1474621_1476685_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	62.5	2.4e-147
WP_001204581.1|1476681_1476960_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_000355614.1|1476969_1477266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304590.1|1477383_1477716_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001304589.1|1477901_1478354_+	VapA/VapB family virulence-associated protein	NA	NA	NA	NA	NA
WP_001357405.1|1478981_1479788_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
1478809:1478834	attR	CGGTCTGGTACATGGATATCGATACC	NA	NA	NA	NA
WP_000209513.1|1479787_1480981_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001538690.1|1480992_1482351_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763537.1|1482354_1483950_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001538691.1|1483949_1485512_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1485603_1485648_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001538692.1|1485785_1486667_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1486663_1487284_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_024186832.1|1487311_1489201_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1489413_1490289_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278898.1|1490328_1490919_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559258.1|1490915_1491674_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	9.7e-06
WP_000422063.1|1491893_1492943_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 4
NZ_AP022650	Escherichia coli strain 09-02E	5075911	1717638	1758691	5075911	portal,transposase,capsid,protease,head,tail,terminase	uncultured_Caudovirales_phage(40.0%)	45	NA	NA
WP_000526115.1|1717638_1718097_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
WP_000592831.1|1718382_1719273_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	39.0	9.6e-21
WP_001357327.1|1719526_1719688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001538770.1|1719779_1721825_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001296081.1|1721961_1722708_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_001538771.1|1722796_1723483_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|1723660_1723864_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_001538772.1|1723899_1725360_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	1.1e-42
WP_000151242.1|1725448_1726816_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000836075.1|1726873_1727893_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	5.7e-17
WP_001298659.1|1727904_1729119_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	2.8e-47
WP_000598292.1|1729324_1729651_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705201.1|1729785_1730127_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|1730161_1730722_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001350228.1|1730724_1731435_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000778146.1|1731542_1731848_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001538775.1|1732046_1734473_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.3e-213
WP_074159585.1|1734533_1736957_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	6.3e-208
WP_001538777.1|1736967_1737585_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526500.1|1737586_1738441_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148695.1|1738483_1739098_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	5.1e-29
WP_071590022.1|1739256_1740549_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919226.1|1740501_1741197_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225276.1|1741321_1742542_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001538779.1|1742676_1743570_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091839.1|1743676_1744930_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743943.1|1745327_1745663_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|1745755_1745839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001538780.1|1745938_1746760_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|1746798_1747128_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001538781.1|1747114_1747480_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000133423.1|1748754_1749036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001560954.1|1749049_1750711_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.7	8.9e-278
WP_000113645.1|1750694_1751051_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|1751173_1751356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145905.1|1751339_1751780_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000134109.1|1751779_1752076_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	64.3	6.9e-32
WP_001020662.1|1752072_1752411_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
WP_000267605.1|1752407_1753619_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_000504056.1|1753620_1754193_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_001137337.1|1754232_1755390_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.3e-137
WP_000233313.1|1755677_1755950_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126693.1|1755962_1756373_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000557476.1|1756369_1756648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761836.1|1756936_1758691_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.0	3.2e-92
>prophage 5
NZ_AP022650	Escherichia coli strain 09-02E	5075911	1992357	2091419	5075911	portal,capsid,tRNA,holin,protease,head,tail,terminase	Enterobacteria_phage(43.48%)	110	NA	NA
WP_000984517.1|1992357_1993239_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055794.1|1993430_1995479_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431376.1|1995498_1996197_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001029106.1|1996293_1996791_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207279.1|1996920_1998204_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001298452.1|1998172_2000806_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_024186841.1|2000885_2002325_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2002443_2002680_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_024186842.1|2002784_2002976_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812744.1|2002976_2003633_-	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	49.5	6.8e-56
WP_000984819.1|2004027_2004369_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879311.1|2004381_2005254_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|2005257_2005632_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2005770_2006001_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011664.1|2006102_2006759_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944258.1|2006782_2007445_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_001538837.1|2007441_2009502_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024728.1|2009710_2010370_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|2010696_2011053_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|2011119_2011410_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173466.1|2011543_2012722_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|2012777_2013419_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001538838.1|2013455_2015267_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301727.1|2015501_2016977_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001056695.1|2017314_2018184_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091149.1|2018311_2019754_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_001296141.1|2019885_2020857_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|2020975_2022298_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001347089.1|2022313_2023246_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|2023324_2024080_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|2024076_2024862_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2025006_2026017_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2026025_2026637_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072093883.1|2026775_2026841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024913.1|2026910_2027513_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2027514_2028036_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|2028070_2028811_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077393227.1|2028839_2029292_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258675.1|2029284_2031057_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891620.1|2031366_2031933_+	hydrolase	NA	NA	NA	NA	NA
WP_001217553.1|2032287_2032536_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000937498.1|2032652_2032922_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	77.8	2.7e-19
WP_000240999.1|2032978_2033647_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885576.1|2033701_2034286_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	1.7e-103
WP_000216487.1|2034285_2037312_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	54.5	7.0e-55
WP_001228314.1|2037463_2038063_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_172468529.1|2038131_2041605_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.5	0.0e+00
WP_032300536.1|2041948_2042581_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_139483711.1|2042526_2043270_-	Mov34/MPN/PAD-1 family protein	NA	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_001335877.1|2043280_2043979_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000847298.1|2043978_2044308_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_061089832.1|2044304_2046878_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.3	0.0e+00
WP_000533402.1|2046858_2047272_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479095.1|2047298_2047730_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000235110.1|2047743_2048496_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683079.1|2048503_2048899_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_001575631.1|2048895_2049471_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	1.1e-49
WP_001204553.1|2049485_2049839_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201501.1|2049831_2050215_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522601.1|2050266_2051295_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.1e-113
WP_000256835.1|2051352_2051700_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_061089831.1|2051736_2053242_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.3	7.9e-100
WP_021551910.1|2053231_2054824_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.8e-185
WP_000259002.1|2054820_2055027_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_024186256.1|2055010_2056939_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.4	6.1e-262
WP_001102145.1|2056910_2057459_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.7	6.1e-58
WP_133301888.1|2057955_2058141_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	73.8	1.3e-17
WP_000459345.1|2058362_2058500_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
WP_001092910.1|2058659_2059193_-	lysozyme	NA	Q08J98	Stx2-converting_phage	96.6	1.1e-101
WP_000551290.1|2059321_2059636_+	hypothetical protein	NA	Q08J99	Stx2-converting_phage	100.0	4.7e-55
WP_000731196.1|2059645_2060452_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	99.6	4.8e-152
WP_000284510.1|2060456_2060672_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_113442070.1|2060821_2062675_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	91.9	0.0e+00
WP_080855704.1|2063463_2064513_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	89.9	9.5e-185
WP_000917767.1|2064663_2064861_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_001204806.1|2065076_2065457_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_097485805.1|2065474_2066464_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.6	8.3e-191
WP_033816723.1|2066515_2066773_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	70.1	2.8e-21
WP_032183441.1|2066769_2068170_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	91.8	3.2e-244
WP_000988266.1|2068166_2069066_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	2.3e-139
WP_021519718.1|2069076_2070069_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	96.4	4.6e-56
WP_000995578.1|2070065_2070365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000618007.1|2070361_2070586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000626793.1|2070582_2070777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029700955.1|2070773_2071625_-	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	68.9	1.9e-103
WP_109966836.1|2071621_2072284_-	ash family protein	NA	Q8W643	Enterobacteria_phage	86.8	2.5e-98
WP_001090259.1|2072392_2073100_-	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	86.0	9.1e-107
WP_000838350.1|2073435_2074092_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	98.2	3.1e-125
WP_000608402.1|2074195_2074699_+	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	95.5	1.2e-63
WP_000141093.1|2074986_2075193_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	94.1	1.3e-29
WP_021553030.1|2075387_2075576_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	51.0	7.4e-08
WP_113442066.1|2075581_2076163_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	64.5	1.6e-69
WP_021519724.1|2076682_2076997_+	hypothetical protein	NA	B1GS43	Salmonella_phage	86.0	2.8e-39
WP_021553029.1|2076983_2077799_+	ead/Ea22-like family protein	NA	A0A2I6TD51	Escherichia_phage	96.0	3.8e-141
WP_021519726.1|2077800_2078211_+	hypothetical protein	NA	C6ZR27	Salmonella_phage	49.6	2.7e-18
WP_000224227.1|2078212_2078476_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_021519727.1|2078486_2078654_+	hypothetical protein	NA	A0A192Y7X3	Salmonella_phage	80.8	3.6e-14
WP_021519728.1|2078650_2078995_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	98.2	1.4e-57
WP_000457723.1|2079079_2079322_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_001030156.1|2079325_2079472_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
WP_000528718.1|2079480_2079717_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_000362005.1|2079772_2081086_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	95.6	4.1e-246
WP_050575735.1|2081067_2081838_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000252980.1|2081890_2082286_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|2082326_2083070_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564725.1|2083066_2084038_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_001214286.1|2086655_2087756_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|2088143_2088890_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|2088903_2089470_-	VOC family protein	NA	NA	NA	NA	NA
WP_001773938.1|2089685_2091419_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	9.8e-86
>prophage 6
NZ_AP022650	Escherichia coli strain 09-02E	5075911	2305905	2312217	5075911		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001557076.1|2305905_2306457_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.9	2.3e-49
WP_001681957.1|2306461_2307340_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	5.6e-106
WP_001023638.1|2307397_2308297_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_001557078.1|2308296_2309382_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.3e-101
WP_001773992.1|2309754_2310648_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	2.3e-46
WP_001557079.1|2310822_2312217_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.8e-18
>prophage 7
NZ_AP022650	Escherichia coli strain 09-02E	5075911	2402152	2411597	5075911		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001538973.1|2402152_2403289_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
WP_001538974.1|2403285_2405289_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|2405413_2405875_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2405915_2406386_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2406432_2407152_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001538977.1|2407148_2408834_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	1.6e-303
WP_001240405.1|2409055_2409787_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001216963.1|2409846_2409954_+	protein YohO	NA	NA	NA	NA	NA
WP_001538978.1|2409934_2410666_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001538980.1|2410670_2411597_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 8
NZ_AP022650	Escherichia coli strain 09-02E	5075911	2779615	2825227	5075911	holin,terminase,integrase,tail	Escherichia_phage(57.69%)	57	2800945:2800962	2832158:2832175
WP_000017558.1|2779615_2779768_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	92.0	1.9e-17
WP_000076001.1|2779785_2779977_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001311989.1|2780287_2780806_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_001774017.1|2780821_2781361_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	96.6	5.1e-41
WP_000637727.1|2781555_2782053_-	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	66.5	1.0e-48
WP_032153852.1|2782049_2782679_-	glycoside hydrolase family 19 protein	NA	A0A0F6R8M1	Escherichia_coli_O157_typing_phage	97.6	1.7e-112
WP_016245479.1|2782668_2782977_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	94.1	4.6e-47
WP_000009883.1|2782963_2783368_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	95.5	3.9e-62
WP_032153853.1|2783440_2785903_-|tail	tail fiber domain-containing protein	tail	O09496	Escherichia_virus	48.8	3.3e-164
WP_016245482.1|2786099_2786357_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	97.6	6.3e-42
WP_000993735.1|2786674_2787331_+	phage antirepressor Ant	NA	A0A1U9AJ93	Stx1_converting_phage	52.2	4.3e-50
WP_000708858.1|2787402_2787564_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_001260052.1|2787662_2788295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127505.1|2788441_2789137_-	hypothetical protein	NA	G9L6E2	Escherichia_phage	100.0	5.4e-128
WP_001555166.1|2789916_2790213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032153854.1|2790290_2791139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032153855.1|2791140_2794530_-	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.8	3.4e-183
WP_032153984.1|2794529_2797277_-	bacteriophage protein	NA	A0A193GYI3	Enterobacter_phage	43.8	8.1e-119
WP_001555169.1|2797276_2797843_-	hypothetical protein	NA	A0A193GYJ4	Enterobacter_phage	81.5	1.5e-59
WP_000568023.1|2797842_2798307_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
WP_022645084.1|2798306_2800778_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.3	0.0e+00
WP_000179264.1|2800777_2801383_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	6.2e-112
2800945:2800962	attL	GCCAGGCCAACGCCTCCA	NA	NA	NA	NA
WP_000424495.1|2801382_2801706_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_032153857.1|2801756_2802092_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	5.0e-55
WP_032153858.1|2802102_2802540_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	95.2	5.0e-71
WP_000268715.1|2802591_2803578_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
WP_032153859.1|2803592_2804288_-	peptidase	NA	G9L6C4	Escherichia_phage	98.3	8.7e-94
WP_021517651.1|2804290_2804587_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	99.0	3.7e-46
WP_000852419.1|2804583_2806263_-|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.5	3.6e-303
WP_000335899.1|2806277_2806484_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_001600316.1|2807186_2807609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032153863.1|2807652_2809128_-	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.2	2.2e-296
WP_001090112.1|2809124_2809799_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	3.4e-119
WP_016235741.1|2809839_2810178_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	98.2	6.4e-58
WP_016235742.1|2810170_2810452_-	ASCH domain-containing protein	NA	A0A077SLL0	Escherichia_phage	97.8	1.1e-47
WP_032153864.1|2810444_2811218_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	47.7	2.0e-51
WP_032153985.1|2811219_2811579_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	75.5	2.4e-39
WP_000753053.1|2811575_2811752_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_001224665.1|2811744_2811927_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_001018057.1|2812499_2812790_-	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
WP_032153869.1|2812786_2813350_-	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	74.2	9.0e-65
WP_032153870.1|2813411_2813756_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	6.9e-60
WP_000843279.1|2813873_2814650_-	hypothetical protein	NA	G9L6A9	Escherichia_phage	100.0	4.6e-152
WP_000168729.1|2814621_2815452_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	97.1	1.1e-154
WP_001282459.1|2815793_2816024_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836290.1|2816178_2816763_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001198620.1|2816916_2817069_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	100.0	5.4e-25
WP_001102251.1|2817071_2817371_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	97.0	4.9e-46
WP_032153871.1|2817367_2818189_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A2R9YJH7	Escherichia_phage	98.5	5.2e-162
WP_001617197.1|2818185_2819127_+	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	99.7	1.0e-177
WP_000675390.1|2819176_2819425_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001550170.1|2819582_2819834_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	95.2	5.8e-40
WP_001617199.1|2819826_2820477_+	hypothetical protein	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	97.2	3.4e-124
WP_001617200.1|2820473_2820668_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	95.3	1.4e-25
WP_001617201.1|2820671_2821922_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	8.0e-239
WP_000138282.1|2822114_2823692_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001296289.1|2823760_2825227_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
2832158:2832175	attR	TGGAGGCGTTGGCCTGGC	NA	NA	NA	NA
>prophage 9
NZ_AP022650	Escherichia coli strain 09-02E	5075911	2959798	2966624	5075911		Enterobacteria_phage(100.0%)	9	NA	NA
WP_001430678.1|2959798_2960371_-	phage polarity suppression family protein	NA	Q7M2A1	Enterobacteria_phage	96.8	1.4e-94
WP_001774020.1|2960444_2960945_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001392508.1|2960941_2961676_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	6.1e-130
WP_001149160.1|2962229_2962496_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001774021.1|2962492_2963092_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	80.3	6.6e-50
WP_001244665.1|2963084_2963372_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459295.1|2963364_2963820_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|2963955_2964276_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001774022.1|2964290_2966624_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
>prophage 10
NZ_AP022650	Escherichia coli strain 09-02E	5075911	3039357	3046497	5075911		Escherichia_phage(83.33%)	6	NA	NA
WP_001539446.1|3039357_3041919_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	6.0e-31
WP_001141302.1|3042024_3042681_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001298167.1|3042731_3043499_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_000847997.1|3043694_3044603_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001539448.1|3044599_3045862_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279001.1|3045858_3046497_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
>prophage 11
NZ_AP022650	Escherichia coli strain 09-02E	5075911	3288987	3354702	5075911	transposase,tRNA,lysis,protease,integrase	Shigella_phage(50.0%)	52	3289857:3289874	3348391:3348408
WP_001298254.1|3288987_3289746_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|3289836_3290757_-	agmatinase	NA	NA	NA	NA	NA
3289857:3289874	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758891.1|3290892_3291624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3291769_3293746_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3293754_3293886_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|3294021_3294237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3294540_3295695_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001305311.1|3296131_3297526_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|3297602_3298100_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001305312.1|3298194_3298902_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3298981_3299713_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593255.1|3299725_3300676_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3300784_3301348_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017107.1|3301347_3301764_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001305314.1|3301937_3302918_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997805.1|3302935_3303640_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094838.1|3303657_3304224_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3304220_3304511_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174738.1|3304518_3305112_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239983.1|3305104_3306241_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745234.1|3306305_3307313_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394107.1|3307429_3308476_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3308651_3309371_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107567.1|3309554_3309881_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786915.1|3309880_3310600_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001305316.1|3310760_3311813_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3311840_3312116_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3312180_3313260_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001296363.1|3313461_3314718_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_001305317.1|3314766_3316902_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|3317294_3318002_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|3318380_3319646_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_032153878.1|3319901_3320945_+	tetratricopeptide repeat family protein	NA	NA	NA	NA	NA
WP_001774069.1|3322638_3323190_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296368.1|3325693_3325915_+	pap operon regulatory protein PapI	NA	NA	NA	NA	NA
WP_001513409.1|3327782_3327896_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_001110186.1|3329729_3329990_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|3330031_3330592_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|3330631_3331060_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_103103190.1|3331768_3332996_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.2e-170
WP_000074477.1|3333109_3334303_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|3334438_3336163_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|3336163_3337111_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|3337110_3338853_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|3338849_3340127_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_033561627.1|3340208_3342410_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_011076574.1|3342960_3343104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|3351736_3351952_-	hypothetical protein	NA	NA	NA	NA	NA
3348391:3348408	attR	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_001521284.1|3351955_3352324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001322947.1|3352335_3352527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296383.1|3352614_3352857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949836.1|3353489_3354702_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
>prophage 1
NZ_AP022651	Escherichia coli strain 09-02E plasmid p1-09-02E, complete sequence	102029	1320	66900	102029	transposase,integrase	Escherichia_phage(50.0%)	59	1206:1219	2301:2314
1206:1219	attL	ATCTGCCTGTTCCT	NA	NA	NA	NA
WP_001066952.1|1320_2061_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001309252.1|2181_2370_-	hypothetical protein	NA	NA	NA	NA	NA
2301:2314	attR	AGGAACAGGCAGAT	NA	NA	NA	NA
WP_001072358.1|2736_3906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|4752_5025_-	adhesin biosynthesis transcription regulatory family protein	NA	NA	NA	NA	NA
WP_001298664.1|6267_8238_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_000977394.1|8244_9036_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001323403.1|9774_10554_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001310017.1|10553_11576_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_000612626.1|12655_13003_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|12999_13404_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001189113.1|13905_15414_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001020413.1|17679_18855_-	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_001100763.1|18923_21185_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000981091.1|21353_22130_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_001224623.1|22137_23013_-	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_001080732.1|25463_25799_-	colicin transporter	NA	NA	NA	NA	NA
WP_000142452.1|25927_26275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194542.1|26294_26804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371882.1|26800_27061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189106.1|28574_29063_+|transposase	transposase	transposase	A0A077SK28	Escherichia_phage	93.2	6.7e-24
WP_000874189.1|29967_30453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267176.1|30477_30963_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|30949_31645_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729218.1|31649_32780_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_033561596.1|32769_34053_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|34055_35435_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|35538_36066_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|36106_37993_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|38339_39155_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949452.1|39337_39844_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_000449408.1|39833_39992_-	DsbA family protein	NA	NA	NA	NA	NA
WP_001067858.1|40141_40846_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001389366.1|41811_42285_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|42415_43204_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|43409_43757_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|43750_44590_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|44717_44921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|45076_46282_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|46292_46598_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|46824_47589_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|48081_48666_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|48665_49904_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|49900_50806_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|50927_51632_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_024192851.1|51656_51869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|52176_52992_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|53052_53856_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480972.1|53855_54692_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_042005022.1|54745_54982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031606906.1|55013_55640_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|55745_56945_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000493383.1|56976_57837_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001067858.1|58404_59109_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000080860.1|60551_61688_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000248278.1|61738_61966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|61989_62181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|63172_63877_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_032277257.1|64674_65550_-	class A extended-spectrum beta-lactamase CTX-M-27	NA	A0A1B0VBP7	Salmonella_phage	100.0	1.2e-153
WP_001067855.1|66195_66900_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
