The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050843	Klebsiella pneumoniae strain Bckp186 chromosome, complete genome	5330280	645263	690505	5330280	lysis,tRNA,integrase,terminase,plate,capsid,tail,head,portal	Salmonella_phage(79.07%)	55	643218:643232	669360:669374
643218:643232	attL	TGGCGCCGGTGGTGG	NA	NA	NA	NA
WP_023317294.1|645263_648506_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	4.3e-34
WP_004174237.1|648510_649125_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_004900718.1|649426_649792_+	hdeB family protein	NA	NA	NA	NA	NA
WP_004889691.1|649860_650133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167830204.1|650759_651845_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	61.3	3.1e-122
WP_167830391.1|651848_652427_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	38.9	1.1e-36
WP_004144798.1|652569_652806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065519549.1|652840_653350_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	83.4	2.7e-76
WP_004174277.1|653357_653558_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	87.7	1.5e-27
WP_004174279.1|653521_653863_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	86.7	1.1e-49
WP_024623053.1|653930_654164_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	92.2	3.5e-31
WP_167830205.1|654163_654391_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	89.3	2.1e-33
WP_048963752.1|654387_655275_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	71.1	1.5e-111
WP_167830392.1|655255_657661_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	89.1	0.0e+00
WP_004144689.1|657832_658021_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	7.9e-26
WP_004185723.1|658034_658268_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	85.7	2.0e-31
WP_069734302.1|658343_658601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065804324.1|658894_659704_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_142762938.1|659723_660386_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_117079998.1|660395_661244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117048824.1|661281_662313_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.0	3.0e-175
WP_167830206.1|662312_664076_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	93.2	0.0e+00
WP_167830207.1|664216_665050_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	75.1	2.7e-102
WP_020324020.1|665066_666131_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.6	1.5e-185
WP_004174300.1|666134_666785_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	86.6	9.6e-103
WP_167830208.1|666881_667346_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.3e-74
WP_002896155.1|667345_667549_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_004144702.1|667552_667768_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	1.0e-29
WP_125482778.1|667748_668258_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	1.2e-81
WP_167830209.1|668262_668646_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.9	4.7e-17
WP_064146896.1|668642_669071_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	79.4	5.6e-51
WP_072145348.1|669045_669204_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	73.1	2.0e-14
WP_167830210.1|669166_669598_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	81.1	1.1e-62
669360:669374	attR	TGGCGCCGGTGGTGG	NA	NA	NA	NA
WP_167830211.1|669590_670037_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	73.6	5.1e-55
WP_004174323.1|670105_670678_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	71.7	3.0e-76
WP_167830212.1|670674_671037_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	2.2e-48
WP_167830213.1|671023_671932_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_167830214.1|671924_672533_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	61.6	1.1e-57
WP_167830215.1|672529_674521_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_117256240.1|674520_675942_+	hypothetical protein	NA	I6R115	Nonlabens_phage	34.6	1.0e-27
WP_004144714.1|675954_676992_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	44.8	2.0e-33
WP_038421809.1|677130_678303_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	4.3e-210
WP_064146903.1|678312_678828_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	7.4e-82
WP_004144716.1|678880_679180_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	80.0	1.6e-33
WP_002896220.1|679194_679314_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_167830393.1|679540_681934_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	39.2	6.9e-106
WP_004185683.1|681930_682416_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	4.1e-58
WP_117058047.1|682412_683510_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.8	1.5e-172
WP_004174338.1|683580_683799_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004144517.1|683810_684188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032421839.1|684515_685022_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_004174339.1|685121_686963_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_004149864.1|687181_688927_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|689038_689254_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004185679.1|689491_690505_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 2
NZ_CP050843	Klebsiella pneumoniae strain Bckp186 chromosome, complete genome	5330280	1702264	1709171	5330280	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1702264_1703128_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|1703138_1703912_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|1704154_1705051_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1705293_1706655_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004201558.1|1706973_1707696_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1707692_1709171_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
NZ_CP050843	Klebsiella pneumoniae strain Bckp186 chromosome, complete genome	5330280	2664850	2675738	5330280		Escherichia_phage(87.5%)	9	NA	NA
WP_167830248.1|2664850_2667958_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
WP_167830249.1|2668012_2669278_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2669308_2670397_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004183954.1|2670483_2670744_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620095.1|2671041_2671902_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|2671922_2672684_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_032414898.1|2672945_2673848_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004190239.1|2673859_2675125_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
WP_002210516.1|2675117_2675738_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
NZ_CP050843	Klebsiella pneumoniae strain Bckp186 chromosome, complete genome	5330280	2878544	2956126	5330280	integrase,terminase,capsid,tail,head,plate,portal,holin,transposase	Salmonella_phage(14.63%)	82	2879869:2879883	2956671:2956685
WP_004176418.1|2878544_2879630_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032434417.1|2879593_2881348_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
2879869:2879883	attL	TCATCTCGCTGTCGG	NA	NA	NA	NA
WP_167830256.1|2881424_2881895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009486337.1|2881891_2882947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032434416.1|2882977_2884576_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_077254776.1|2884575_2888031_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_038990437.1|2888027_2889236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652570.1|2890683_2891782_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	7.4e-47
WP_004179560.1|2891974_2892496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015958252.1|2892675_2893443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167830257.1|2893429_2893573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072269220.1|2893662_2894631_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	1.7e-180
WP_015958251.1|2894752_2896513_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_072001616.1|2896548_2896911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071531918.1|2897305_2897581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190533.1|2897714_2898926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074182940.1|2898918_2901429_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.1	3.6e-20
WP_032434409.1|2901430_2904085_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	1.3e-97
WP_002902160.1|2904349_2904841_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_032421272.1|2904845_2906552_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004176431.1|2906548_2907238_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_073553528.1|2907234_2908578_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_032427977.1|2908587_2910132_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004176434.1|2910174_2910666_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_032410964.1|2910824_2910947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019705237.1|2911511_2911760_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
WP_032429381.1|2912167_2912590_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	46.1	4.3e-27
WP_167830258.1|2912667_2913099_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	68.6	6.1e-29
WP_167830259.1|2913198_2914620_-	hypothetical protein	NA	I6S6R9	Nonlabens_phage	34.9	1.3e-24
WP_107318781.1|2914619_2916569_-	hypothetical protein	NA	A0A1I9SEN3	Klebsiella_phage	52.0	1.5e-18
WP_107318758.1|2916742_2917705_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	32.7	1.2e-08
WP_159068230.1|2917722_2918607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719060.1|2918638_2919316_-	YmfQ family protein	NA	NA	NA	NA	NA
WP_107318759.1|2919312_2920461_-|plate	baseplate J/gp47 family protein	plate	J9QE72	Clostridium_phage	29.3	6.0e-07
WP_047719064.1|2920450_2920900_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	40.5	3.6e-16
WP_094089153.1|2920896_2921478_-|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_107318760.1|2921474_2922560_-|tail	phage tail protein	tail	Q8SBG7	Shigella_phage	30.6	1.5e-39
WP_047719069.1|2922556_2923957_-	hypothetical protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	39.1	4.0e-05
WP_107318761.1|2924003_2925857_-	hypothetical protein	NA	A0A172JGI1	Citrobacter_phage	45.3	1.8e-21
WP_047719073.1|2925998_2926277_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_107318762.1|2926278_2926650_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_065954088.1|2926653_2928165_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.8	3.7e-105
WP_047719076.1|2928161_2928347_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_065954087.1|2928349_2928895_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_049267342.1|2928891_2929251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107318763.1|2929255_2929636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021543308.1|2929637_2930687_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	34.0	1.2e-51
WP_047719081.1|2930785_2931193_-|head	head decoration protein	head	NA	NA	NA	NA
WP_047719083.1|2931192_2931786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719084.1|2931787_2932654_-	S49 family peptidase	NA	A0A2D1GN02	Marinobacter_phage	37.9	6.2e-49
WP_047719086.1|2932650_2934285_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.1	6.8e-89
WP_000483310.1|2934284_2934548_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_167830260.1|2934556_2936683_-|terminase	terminase	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.9	4.7e-98
WP_107318765.1|2936624_2937188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107318782.1|2937437_2938076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815315.1|2938262_2938652_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.0	1.1e-24
WP_107318783.1|2938648_2939146_-	lysozyme	NA	K7P7Q3	Enterobacteria_phage	84.2	2.8e-78
WP_012542609.1|2939123_2939393_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_142721747.1|2940079_2940199_+	small membrane protein	NA	NA	NA	NA	NA
WP_032692691.1|2940236_2940386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071888089.1|2940388_2941156_-	hypothetical protein	NA	A0A1B2I9V6	Erwinia_phage	75.9	8.9e-108
WP_038992047.1|2941889_2942468_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_107318766.1|2942481_2943462_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	6.4e-135
WP_000779146.1|2943474_2943852_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_107318767.1|2943861_2944671_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.7	2.7e-110
WP_107318768.1|2944667_2945636_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.0	3.5e-85
WP_004184738.1|2945625_2945805_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	75.0	1.6e-15
WP_107318769.1|2946042_2946504_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	85.5	1.2e-67
WP_016530206.1|2946529_2946727_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_032408726.1|2946831_2947479_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
WP_107318770.1|2948026_2948326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040186298.1|2948325_2949111_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.8	2.9e-61
WP_025714330.1|2949238_2949547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107318771.1|2949559_2950150_+	hypothetical protein	NA	H2BD37	Pseudomonas_phage	54.8	2.8e-24
WP_107318772.1|2950149_2950377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167830199.1|2950783_2951089_+	hypothetical protein	NA	A0A0N7KZ94	Stx2-converting_phage	69.8	7.3e-13
WP_004198245.1|2951161_2951308_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_077255525.1|2951267_2951510_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_040186739.1|2951490_2952672_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	1.3e-201
WP_016197745.1|2952868_2953417_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_032434403.1|2953615_2955148_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.5e-21
WP_032434401.1|2955364_2956126_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.4e-20
2956671:2956685	attR	CCGACAGCGAGATGA	NA	NA	NA	NA
>prophage 5
NZ_CP050843	Klebsiella pneumoniae strain Bckp186 chromosome, complete genome	5330280	2996482	3044944	5330280	holin,integrase,tail,terminase	Klebsiella_phage(21.57%)	63	2988827:2988842	3042250:3042265
2988827:2988842	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_065811872.1|2996482_2997883_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	34.9	1.2e-22
WP_167830261.1|2998012_3000001_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A286S1R8	Klebsiella_phage	74.5	2.8e-12
WP_038992568.1|3000077_3003146_-	kinase	NA	A0A286S259	Klebsiella_phage	97.8	0.0e+00
WP_038992566.1|3003142_3003523_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	98.4	1.9e-71
WP_038992564.1|3003532_3004015_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.3e-80
WP_038992562.1|3004195_3004660_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	8.7e-58
WP_038992560.1|3004659_3007551_-|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	33.0	4.6e-104
WP_023313119.1|3007670_3008003_-	hypothetical protein	NA	M1PRT9	Cellulophaga_phage	66.7	3.8e-31
WP_074182938.1|3008069_3008267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038992558.1|3008404_3008887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167830262.1|3008940_3010113_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	9.4e-24
WP_023282426.1|3010136_3010529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038992555.1|3010525_3011077_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.1	5.9e-29
WP_023282424.1|3011078_3011462_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	9.2e-21
WP_016946677.1|3011448_3011682_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004190649.1|3011691_3011946_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_004217348.1|3011947_3012343_-	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_142689607.1|3012383_3012656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032427966.1|3012664_3013618_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.0	1.4e-131
WP_038992554.1|3013628_3014420_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	60.6	4.1e-63
WP_038992553.1|3014504_3015617_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	55.2	6.2e-110
WP_167830263.1|3015600_3017001_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	52.7	9.2e-127
WP_038992550.1|3017000_3018308_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	2.7e-149
WP_038992548.1|3018285_3019281_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.8	1.7e-34
WP_038421382.1|3019839_3020085_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	97.5	1.6e-34
WP_125046916.1|3020519_3020732_-	hypothetical protein	NA	A0A286N2Q9	Klebsiella_phage	71.4	6.0e-22
WP_032429431.1|3021043_3021319_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	65.2	2.3e-21
WP_004190674.1|3021315_3021660_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004184488.1|3021656_3022196_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_031281240.1|3022192_3022492_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	98.0	1.9e-45
WP_038991419.1|3023105_3023552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072039931.1|3023457_3023685_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	98.7	7.3e-34
WP_038991418.1|3023867_3024650_-	molecular chaperone	NA	F1C595	Cronobacter_phage	78.7	3.2e-113
WP_004190680.1|3024646_3025015_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	63.8	3.5e-41
WP_038991417.1|3025011_3025308_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.9	1.0e-35
WP_016946309.1|3025516_3026113_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	1.3e-90
WP_004184503.1|3026491_3026725_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_032413665.1|3027477_3027777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038991414.1|3027872_3028301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804600.1|3028304_3028526_-	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.3e-11
WP_020804604.1|3028522_3028777_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.6	1.4e-09
WP_020804603.1|3028769_3028973_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	84.8	3.8e-26
WP_032438549.1|3028969_3029755_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.7	7.3e-65
WP_032417027.1|3029747_3030083_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	1.3e-10
WP_032417026.1|3030090_3030840_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
WP_032417025.1|3030842_3031757_-	DNA-binding protein	NA	V5URT9	Shigella_phage	54.1	1.0e-89
WP_020804480.1|3031771_3031960_-	ClpX C4-type zinc finger	NA	NA	NA	NA	NA
WP_023287506.1|3032047_3032584_-	bacteriophage regulatory protein CII	NA	K7PJT7	Enterobacteria_phage	70.4	2.1e-63
WP_029503646.1|3032586_3032820_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
WP_004190707.1|3032924_3033320_+	helix-turn-helix transcriptional regulator	NA	K7PM35	Enterobacteria_phage	74.0	3.1e-48
WP_136085610.1|3033337_3033436_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_020805737.1|3034580_3034784_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	76.1	6.3e-21
WP_158423358.1|3035148_3035379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804303.1|3035672_3035864_+	YebW family protein	NA	NA	NA	NA	NA
WP_020804294.1|3035872_3036028_+	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	71.2	5.7e-14
WP_038991407.1|3036165_3039264_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	55.5	8.2e-293
WP_032421692.1|3039276_3040386_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	87.0	9.1e-186
WP_022631172.1|3040426_3040666_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	67.5	6.8e-22
WP_071844645.1|3040675_3040990_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	2.1e-10
WP_052263199.1|3040886_3042116_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.3	6.2e-119
WP_004151901.1|3042250_3043141_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3042250:3042265	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3043140_3044133_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3044134_3044944_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 6
NZ_CP050843	Klebsiella pneumoniae strain Bckp186 chromosome, complete genome	5330280	3160308	3239659	5330280	tRNA,protease,integrase,terminase,tail,portal,holin	Enterobacteria_phage(22.5%)	85	3205060:3205074	3236796:3236810
WP_004892876.1|3160308_3160809_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3160925_3161372_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004140469.1|3161355_3162150_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020324105.1|3162257_3163433_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3163464_3164157_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3164302_3164812_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|3164816_3165155_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_004176548.1|3165144_3165384_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004176549.1|3165684_3166698_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004150782.1|3166755_3166857_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|3166856_3166931_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3167048_3167174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3167233_3167497_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3167627_3168266_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3168355_3169270_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004148037.1|3169731_3169851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150784.1|3169931_3170975_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004224183.1|3171277_3172486_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_019705575.1|3172559_3174344_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3174350_3175241_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3175361_3176870_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_032410895.1|3176903_3177068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|3177180_3177867_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140501.1|3178264_3178444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3178483_3179116_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_032434340.1|3179682_3179880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004183659.1|3179995_3181006_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_032434338.1|3181002_3182409_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004179357.1|3182464_3183352_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3183368_3183875_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004148027.1|3183901_3184396_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3184486_3184672_-	general stress protein	NA	NA	NA	NA	NA
WP_167830266.1|3184891_3185227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140529.1|3185294_3186488_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3186600_3186828_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_032434336.1|3187277_3187601_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004190914.1|3187593_3187986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140538.1|3187982_3188696_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3188968_3189121_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023342882.1|3189275_3190772_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	65.4	5.6e-130
WP_023342883.1|3190833_3199650_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	43.2	0.0e+00
WP_167830267.1|3199712_3200303_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.5	9.4e-81
WP_023342884.1|3200334_3201045_-	hypothetical protein	NA	Q6UAW4	Klebsiella_phage	90.7	1.1e-136
WP_016530342.1|3201046_3201802_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	84.1	1.3e-130
WP_023342885.1|3201798_3202146_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	67.8	4.7e-40
WP_023342886.1|3202150_3205294_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	73.1	0.0e+00
3205060:3205074	attL	CGGCGGCGGCATCCG	NA	NA	NA	NA
WP_071609142.1|3205277_3205592_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	75.0	5.0e-41
WP_072216832.1|3205612_3206041_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	60.0	2.7e-37
WP_016530349.1|3206051_3206795_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	83.0	1.7e-111
WP_016530350.1|3206803_3207205_-|tail	minor tail family protein	tail	K7PHM6	Enterobacterial_phage	75.6	2.7e-55
WP_016530351.1|3207201_3207780_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	81.2	1.7e-79
WP_023342887.1|3207783_3208059_-	hypothetical protein	NA	K7PH43	Enterobacteria_phage	57.1	1.1e-23
WP_016530353.1|3208051_3208378_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.7	8.1e-34
WP_032428174.1|3208461_3210489_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	82.1	0.0e+00
WP_023342889.1|3210433_3211936_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.0	2.8e-246
WP_023342890.1|3211935_3212148_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	80.0	2.9e-24
WP_040234925.1|3212144_3214247_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	84.0	0.0e+00
WP_023342892.1|3214246_3214735_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	87.7	1.3e-72
WP_032417434.1|3214966_3215386_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.3	1.1e-40
WP_023342894.1|3215385_3215703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017898986.1|3217751_3218102_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
WP_064824462.1|3218098_3218596_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.3e-78
WP_017880269.1|3218595_3218811_-|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_023342896.1|3220234_3220837_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.1	2.4e-76
WP_023342897.1|3220853_3221885_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.3	2.1e-96
WP_023342898.1|3222084_3222477_-	hypothetical protein	NA	K7PHB4	Enterobacterial_phage	36.6	4.7e-12
WP_077253592.1|3222517_3222808_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	1.4e-16
WP_023342900.1|3222819_3223053_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	68.4	2.1e-23
WP_048975050.1|3223680_3224499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048975055.1|3225465_3227232_-	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	33.2	9.1e-71
WP_048975057.1|3227427_3227868_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_075253243.1|3227881_3228346_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	68.6	5.9e-62
WP_065811835.1|3228338_3229322_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	56.4	4.3e-46
WP_017898969.1|3229373_3229928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004147982.1|3229930_3230152_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	75.3	1.2e-28
WP_064081464.1|3230287_3230677_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	64.3	3.2e-37
WP_016160636.1|3231494_3231689_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3231731_3232076_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_064184756.1|3232217_3234356_+	exonuclease	NA	S4TNL0	Salmonella_phage	43.0	5.0e-100
WP_012542206.1|3234408_3234654_+	excisionase	NA	NA	NA	NA	NA
WP_014228877.1|3234634_3235762_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	3.3e-119
WP_004150800.1|3235879_3237130_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
3236796:3236810	attR	CGGATGCCGCCGCCG	NA	NA	NA	NA
WP_032434335.1|3237370_3238021_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150802.1|3238037_3238496_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3238552_3239659_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP050843	Klebsiella pneumoniae strain Bckp186 chromosome, complete genome	5330280	3476312	3485775	5330280	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_032434221.1|3476312_3478034_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3478078_3478780_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3479133_3479352_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3479471_3481751_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3481781_3482099_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3482424_3482646_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3482722_3484663_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_004191152.1|3484659_3485775_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 8
NZ_CP050843	Klebsiella pneumoniae strain Bckp186 chromosome, complete genome	5330280	3970000	4016188	5330280	tRNA,head,terminase,transposase	Cronobacter_phage(23.53%)	66	NA	NA
WP_064141438.1|3970000_3972478_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.1	5.1e-197
WP_038989545.1|3972464_3972860_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	56.3	1.2e-36
WP_004178860.1|3972856_3973327_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	9.6e-28
WP_038989546.1|3973326_3973803_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.4	6.7e-37
WP_038989547.1|3973845_3977241_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	74.4	0.0e+00
WP_032428681.1|3977300_3977714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023297299.1|3977811_3978192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023297298.1|3978308_3978824_-	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	70.7	5.0e-62
WP_038989548.1|3979040_3979754_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	52.8	1.2e-61
WP_038989549.1|3979822_3980587_-	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.2	2.3e-39
WP_038989550.1|3980646_3980868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038989551.1|3980870_3981254_-	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	30.9	6.4e-06
WP_038989552.1|3981250_3981619_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	82.8	8.5e-48
WP_038989553.1|3981621_3981984_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	48.3	1.6e-19
WP_032443486.1|3981983_3982157_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	49.1	5.1e-11
WP_032443487.1|3982156_3982540_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	76.4	2.3e-48
WP_038989554.1|3982542_3982797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038989555.1|3982806_3983904_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	73.0	3.6e-150
WP_038989556.1|3983915_3984347_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.4e-41
WP_167830281.1|3984350_3985715_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	65.0	1.9e-164
WP_167830282.1|3985786_3986755_-|transposase	IS5-like element IS903 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.8	2.6e-181
WP_052263182.1|3987108_3988134_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.8	1.1e-116
WP_038989559.1|3988096_3989518_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	69.3	1.6e-182
WP_038989560.1|3989529_3991089_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	88.4	4.5e-292
WP_038989561.1|3991085_3991574_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	74.4	3.9e-48
WP_038989597.1|3991604_3992252_-	hypothetical protein	NA	I6S676	Salmonella_phage	76.8	8.1e-94
WP_087842501.1|3992360_3993353_+	acyltransferase	NA	C6ZR20	Salmonella_phage	25.3	1.2e-06
WP_038989563.1|3993420_3993705_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	64.9	4.1e-26
WP_167830283.1|3994392_3994548_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	82.4	3.2e-17
WP_038989565.1|3995461_3995851_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	48.4	4.5e-23
WP_038989566.1|3995847_3996345_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	85.5	5.1e-80
WP_032729783.1|3996322_3996526_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	84.1	1.0e-26
WP_038989567.1|3997252_3997942_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.2	8.4e-57
WP_087842500.1|3997938_3998079_-	YlcG family protein	NA	NA	NA	NA	NA
WP_038989568.1|3998075_3998306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038989569.1|3998302_3998941_-	bacteriophage Lambda NinG protein	NA	H6WRY9	Salmonella_phage	68.4	2.7e-73
WP_038989570.1|3998933_3999104_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	7.4e-15
WP_038989571.1|3999103_3999559_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	4.7e-56
WP_072039913.1|3999839_4000061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038989572.1|4000053_4000359_-	hypothetical protein	NA	K7PJS3	Enterobacterial_phage	63.0	3.3e-29
WP_052263183.1|4000355_4001015_-	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	39.7	3.5e-12
WP_038989573.1|4001011_4001527_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	75.8	6.5e-70
WP_052263184.1|4001526_4002090_-	hypothetical protein	NA	Q5G8U8	Enterobacteria_phage	34.9	2.2e-07
WP_102047170.1|4002318_4002846_-	hypothetical protein	NA	G8C7U8	Escherichia_phage	47.3	7.9e-31
WP_038989574.1|4003063_4003363_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038989575.1|4003359_4004229_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	68.9	5.8e-95
WP_038989576.1|4004213_4005068_-	replication protein	NA	K7PGT1	Enterobacteria_phage	54.8	2.8e-62
WP_001548453.1|4005153_4005375_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004178811.1|4005414_4005648_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_072039915.1|4005752_4006442_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	71.1	1.6e-87
WP_038989577.1|4006734_4007277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038989578.1|4007264_4008041_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_012542634.1|4008075_4008252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074182943.1|4008558_4008684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151303.1|4008676_4008871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038989579.1|4008959_4009244_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	61.7	2.0e-28
WP_038989580.1|4009260_4010007_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	68.3	8.2e-66
WP_038989581.1|4010003_4010627_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	1.1e-58
WP_038989603.1|4010655_4011183_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	62.2	2.9e-57
WP_038989582.1|4011179_4011398_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	2.1e-09
WP_038989583.1|4011399_4011618_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	51.4	2.0e-12
WP_029497251.1|4011617_4011857_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	47.4	2.4e-11
WP_071531921.1|4011869_4012205_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004143017.1|4013676_4014543_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|4014544_4014757_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_032434111.1|4014802_4016188_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	7.9e-46
>prophage 1
NZ_CP050844	Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence	223022	18550	87429	223022	protease,transposase	Salmonella_phage(31.58%)	42	NA	NA
WP_064669678.1|18550_18913_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.0	1.0e-13
WP_007372130.1|23190_23370_+	hypothetical protein	NA	A0A1B2IAL0	Erwinia_phage	60.7	6.8e-11
WP_167829913.1|23639_24608_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	1.6e-178
WP_101989880.1|25445_27044_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.9	4.3e-19
WP_077253754.1|27135_27249_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	81.1	4.7e-10
WP_080876690.1|30086_31952_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_080876678.1|32155_33712_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.6	7.1e-104
WP_080876679.1|33708_34950_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_080876680.1|35066_38183_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.1	4.1e-26
WP_023279773.1|38278_39247_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.9e-180
WP_004883460.1|39556_40960_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_004883463.1|40988_41621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167830403.1|41847_43194_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_167830398.1|43628_44597_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.8e-185
WP_029497499.1|46029_46554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032435691.1|48095_48560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102097429.1|49344_50313_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.3e-172
WP_048335769.1|50432_50807_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	55.3	2.6e-20
WP_125337164.1|50940_51438_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_087794475.1|51588_52735_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	7.8e-148
WP_167830399.1|52853_53822_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	1.3e-183
WP_025999313.1|55195_55678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900939.1|55953_56358_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_040238691.1|57087_58170_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	97.8	1.9e-188
WP_167830400.1|58277_61352_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_167830401.1|61403_62657_+	lactose permease	NA	NA	NA	NA	NA
WP_000227969.1|63929_65006_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001572456.1|65618_66140_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_070584980.1|66136_67090_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_020325014.1|67176_69501_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_167829911.1|69545_70448_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|70444_71443_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_070584978.1|71439_72396_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004152282.1|72396_73164_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_070083105.1|73262_73556_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	6.8e-48
WP_167830404.1|73886_74129_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427620.1|74426_75431_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_167829910.1|77206_80266_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.1	0.0e+00
WP_167830402.1|80317_81571_+	lactose permease	NA	NA	NA	NA	NA
WP_004026565.1|83353_83806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026564.1|84308_85244_-|protease	omptin family outer membrane protease Kop	protease	NA	NA	NA	NA
WP_088765928.1|86308_87429_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 2
NZ_CP050844	Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence	223022	106527	173853	223022	holin,integrase,transposase	Salmonella_phage(30.43%)	46	122857:122916	129935:130002
WP_023288366.1|106527_107544_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_085163625.1|108794_109331_+	plasmid transfer protein	NA	NA	NA	NA	NA
WP_017900946.1|111625_112636_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
WP_023287153.1|113365_114532_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.2	7.5e-223
WP_004117790.1|114531_115503_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_004215130.1|117000_117441_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
WP_004189161.1|117437_117788_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004902302.1|117818_119411_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_135733226.1|119679_120648_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.4	6.2e-13
122857:122916	attL	TGCGTTGTCGGGAAGATGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCA	NA	NA	NA	NA
WP_020477096.1|122976_123420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186937.1|123429_123837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135733260.1|123879_124839_+	DNA replication protein	NA	NA	NA	NA	NA
WP_074168518.1|124928_125897_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	8.7e-185
WP_167830405.1|125940_126660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|126656_126980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213829.1|127131_127449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048322233.1|127514_128651_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_048322234.1|128828_129083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077255812.1|130441_131410_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.5	9.1e-182
129935:130002	attR	TGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGCATCTTCCCGACAACGCATGACCTGC	NA	NA	NA	NA
WP_167829921.1|133449_134547_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	43.7	7.6e-60
WP_032437437.1|136809_137346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032437439.1|137361_137922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080876712.1|139403_139973_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_167829920.1|140031_140727_+	molecular chaperone	NA	NA	NA	NA	NA
WP_167829919.1|140738_143132_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_032437452.1|143152_144172_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_101984609.1|146458_147193_+	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	34.3	2.7e-29
WP_135733212.1|147789_149328_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	2.2e-278
WP_000612626.1|149376_149724_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_102054792.1|149720_150125_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	97.0	8.1e-68
WP_101984415.1|152418_152796_-	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_102054677.1|153494_154553_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_101984514.1|154635_155460_-	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_101984517.1|155603_157367_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_167829925.1|158893_160066_+	MFS transporter	NA	NA	NA	NA	NA
WP_101984513.1|160082_160787_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_101984512.1|160899_161775_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_167829918.1|163048_164416_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	1.3e-32
WP_135733226.1|165696_166665_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.4	6.2e-13
WP_077268341.1|166674_166851_-|transposase	transposase	transposase	Q76S41	Shigella_phage	63.5	5.2e-11
WP_017880269.1|168252_168468_+|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_064824462.1|168467_168965_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.3e-78
WP_017898986.1|168961_169312_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
WP_167829917.1|171059_172010_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.8	4.9e-180
WP_004114612.1|173170_173518_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
WP_135733211.1|173514_173853_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	80.2	1.5e-46
