The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047630	Lactococcus raffinolactis strain Lr_18_12S chromosome, complete genome	2318892	206211	280847	2318892	tRNA,holin,transposase,protease	Streptococcus_phage(20.0%)	72	NA	NA
WP_167841789.1|206211_206529_+	thioredoxin family protein	NA	A0A0K2FIM3	Achromobacter_phage	33.3	1.2e-05
WP_167841790.1|206560_207184_+|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_031366343.1|207242_207638_+	single-stranded DNA-binding protein	NA	Q0ILF5	Lactococcus_phage	50.9	4.9e-25
WP_167841791.1|207843_208128_+	co-chaperone GroES	NA	A0A221S331	uncultured_virus	35.6	6.6e-08
WP_167841792.1|208186_209818_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.9	1.4e-155
WP_167838359.1|209922_210444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138492029.1|210774_212067_+	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	36.7	2.3e-71
WP_167841793.1|212190_214722_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.7	7.9e-68
WP_167841794.1|214896_215100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138492032.1|215140_216610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841795.1|216566_216971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061773673.1|217009_217321_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_061773674.1|217338_217671_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003137946.1|217834_218125_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_167841796.1|218254_219487_+	peptidase T	NA	NA	NA	NA	NA
WP_167838363.1|219550_219985_-	universal stress protein	NA	NA	NA	NA	NA
WP_061773676.1|220234_220531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842506.1|220668_222720_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_167838364.1|222769_223912_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_167841797.1|223951_225178_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_096039933.1|225196_226606_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	27.9	8.7e-24
WP_167841760.1|227289_228543_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.7	3.8e-63
WP_167841798.1|228674_228980_-	SdpI family protein	NA	NA	NA	NA	NA
WP_096039935.1|229010_230264_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	42.6	3.2e-78
WP_167838376.1|231667_234109_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_167841799.1|234461_235451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061773687.1|235693_236716_+	putrescine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	27.3	1.3e-16
WP_061773688.1|236790_238158_+	amino acid permease	NA	NA	NA	NA	NA
WP_061773689.1|238218_239316_+	agmatine deiminase	NA	M1HCB6	Acanthocystis_turfacea_Chlorella_virus	49.7	2.2e-99
WP_061773690.1|239375_240719_+	phosphatidylserine decarboxylase	NA	A0A2K9L169	Tupanvirus	27.5	9.1e-31
WP_167839688.1|240934_241873_+	carbamate kinase	NA	NA	NA	NA	NA
WP_167841800.1|241927_243013_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_061773693.1|243019_243418_-	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	48.6	6.2e-12
WP_061773694.1|243656_244919_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	41.0	1.3e-84
WP_061773695.1|244908_246192_+	insulinase family protein	NA	NA	NA	NA	NA
WP_061773696.1|246265_247135_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_061773697.1|247142_247700_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_138492049.1|248099_249386_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_096039946.1|249382_249613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061773700.1|249616_249859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841801.1|249882_251625_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L424	Tupanvirus	26.9	2.2e-16
WP_061773702.1|251591_252509_+	YitT family protein	NA	NA	NA	NA	NA
WP_061773703.1|252814_253681_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	39.9	3.7e-49
WP_082785331.1|253826_253931_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_004261195.1|254170_255160_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_167839696.1|255161_256022_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_061773706.1|256232_256673_+	DUF1810 domain-containing protein	NA	A0A2H4UVK5	Bodo_saltans_virus	40.0	1.9e-14
WP_096039951.1|257025_258459_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_167842507.1|258559_259393_+	DNA-formamidopyrimidine glycosylase	NA	G3MA33	Bacillus_virus	35.3	3.3e-31
WP_061773709.1|259513_260686_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	65.3	1.8e-120
WP_061773710.1|260865_261264_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_061773711.1|261764_261962_-	CsbD family protein	NA	NA	NA	NA	NA
WP_061773712.1|262510_263281_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_061773713.1|263273_263846_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_061773714.1|263836_264709_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_061773715.1|264740_265184_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_061773716.1|265484_265874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841802.1|266009_267137_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_061773718.1|267239_268595_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_061773719.1|269012_269489_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_061773720.1|269512_270313_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_061773721.1|270305_271124_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_061773722.1|271125_271554_+	PTS N-acetylglucosamine transporter subunit IIBC	NA	NA	NA	NA	NA
WP_096039959.1|271585_273256_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_167841803.1|273290_274049_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_167841804.1|274381_275104_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_061773726.1|275081_275993_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_061773727.1|276025_277975_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_167841009.1|278123_279611_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.0	8.4e-86
WP_082785332.1|279850_279952_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_138492081.1|280315_280399_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_167841805.1|280745_280847_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 2
NZ_CP047630	Lactococcus raffinolactis strain Lr_18_12S chromosome, complete genome	2318892	742448	908938	2318892	tRNA,plate,protease,integrase,capsid,head,tail,terminase,portal,holin,transposase	Lactococcus_phage(20.48%)	178	775009:775068	908990:909755
WP_061773848.1|742448_743717_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.0	2.5e-94
WP_061773849.1|743945_744335_-	DUF956 family protein	NA	NA	NA	NA	NA
WP_061773850.1|744411_745323_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_096040261.1|745342_746152_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_061773852.1|746169_747159_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_167841950.1|747408_748305_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	33.7	1.5e-05
WP_167841951.1|748325_749495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061773855.1|749635_750211_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_096040264.1|750463_750958_+	EbsA family protein	NA	NA	NA	NA	NA
WP_061773857.1|750996_751224_-	ferredoxin	NA	NA	NA	NA	NA
WP_167841206.1|751222_751693_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_167841952.1|751689_752358_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_167841953.1|752409_753663_+	LCP family protein	NA	NA	NA	NA	NA
WP_167841760.1|753887_755141_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.7	3.8e-63
WP_061773861.1|755219_756080_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_061773862.1|756083_757460_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_167841954.1|757625_758849_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_167842518.1|759176_760949_+	alpha-glycosidase	NA	NA	NA	NA	NA
WP_167841955.1|760948_762217_+	alpha-amylase	NA	NA	NA	NA	NA
WP_167841956.1|762438_764055_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_167841957.1|764232_765855_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_167841958.1|766010_768278_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_061773869.1|768279_768942_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_061773870.1|769106_770081_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.6	9.2e-17
WP_167841959.1|770199_770871_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.8	1.5e-26
WP_167841960.1|770907_772263_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.1	5.4e-15
WP_061773943.1|772320_772572_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_167841961.1|772731_773799_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_061773874.1|773812_774481_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	6.3e-33
775009:775068	attL	CCCAAATTGTAAAATGAAGTTAGCCACCTCAGGGAAAAAATTTTCCCACTAAAAAACACC	NA	NA	NA	NA
WP_167838214.1|775119_776070_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.0	3.3e-35
WP_167841962.1|776071_777010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841963.1|777325_778369_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	34.3	3.3e-44
WP_167841964.1|779212_779788_-	hypothetical protein	NA	A0A1X9IGD7	Lactococcus_phage	43.1	3.9e-39
WP_096040070.1|779802_780147_-	helix-turn-helix domain-containing protein	NA	A0A1X9IGD3	Lactococcus_phage	79.8	2.8e-45
WP_138491486.1|780659_781226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031366573.1|781336_781528_+	hypothetical protein	NA	Q9AZF4	Lactococcus_phage	74.6	5.6e-19
WP_138491487.1|781750_782023_-	DUF3892 domain-containing protein	NA	A0A059NT53	Lactococcus_phage	43.7	1.6e-11
WP_167841965.1|782213_782399_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	50.8	1.9e-08
WP_167841966.1|782470_782731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841967.1|782727_782949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061774525.1|783112_783472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841968.1|783504_784761_+	AAA family ATPase	NA	Q5YA97	Bacillus_phage	61.2	1.6e-141
WP_167841969.1|784773_785073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841970.1|785062_786145_+	ATP-binding protein	NA	Q5YA96	Bacillus_phage	47.8	4.0e-85
WP_061774521.1|786768_787029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841971.1|787003_788599_+	DEAD/DEAH box helicase	NA	Q5YA94	Bacillus_phage	67.2	3.0e-206
WP_167841972.1|788604_790902_+	AAA family ATPase	NA	Q5YA88	Bacillus_phage	55.5	5.0e-239
WP_167841973.1|791166_791388_+	hypothetical protein	NA	Q5YA85	Bacillus_phage	46.4	3.7e-14
WP_167841974.1|791380_791539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841975.1|791531_791762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841976.1|791748_792162_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A220G9T0	Streptococcus_phage	41.0	4.0e-22
WP_167841977.1|792164_792395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841978.1|792397_792694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841979.1|792740_793220_+	hypothetical protein	NA	A0A1P8BM80	Lactococcus_phage	45.0	7.0e-26
WP_138491782.1|793382_793808_+	universal stress protein	NA	NA	NA	NA	NA
WP_031366590.1|793865_794297_+|terminase	terminase small subunit	terminase	D7RWC4	Brochothrix_phage	66.2	2.5e-43
WP_167842519.1|794289_795552_+|terminase	PBSX family phage terminase large subunit	terminase	D7RWC5	Brochothrix_phage	83.4	1.1e-206
WP_167841980.1|795566_797021_+|portal	phage portal protein	portal	A0A1S5SAI0	Streptococcus_phage	55.1	1.0e-144
WP_167841981.1|797013_798717_+	hypothetical protein	NA	A0A1P8BLD7	Lactococcus_phage	52.2	1.3e-162
WP_167841982.1|798720_798939_+	hypothetical protein	NA	A0A1P8BLD4	Lactococcus_phage	83.3	1.5e-31
WP_167841983.1|799124_799688_+	scaffolding protein	NA	D2J060	Enterococcus_phage	45.7	1.3e-31
WP_167841984.1|799705_800620_+|capsid	capsid protein	capsid	Q20DD4	Lactobacillus_phage	53.4	1.7e-81
WP_167841985.1|800631_800913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841106.1|800943_801474_+	hypothetical protein	NA	D2J063	Enterococcus_phage	47.2	1.0e-38
WP_096040094.1|801470_801788_+|head,tail	phage head-tail adapter protein	head,tail	A0A1S5S9Y9	Streptococcus_phage	35.6	5.5e-11
WP_031366600.1|801787_802186_+	HK97 gp10 family phage protein	NA	A0A1S5SAB8	Streptococcus_phage	59.4	7.3e-37
WP_167841986.1|802185_802563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841987.1|802563_803184_+	hypothetical protein	NA	A0A1S5S9Y8	Streptococcus_phage	48.2	1.1e-47
WP_167840116.1|803239_803482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841988.1|803478_804000_+	hypothetical protein	NA	D2J068	Enterococcus_phage	27.5	3.2e-08
WP_143188716.1|804068_804317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841989.1|804306_806571_+|tail	phage tail protein	tail	A5GYM8	Lactococcus_phage	68.8	9.8e-78
WP_167841990.1|806572_807964_+|plate	phage baseplate protein	plate	B6D7I8	Listeria_phage	25.3	3.5e-25
WP_167841991.1|807960_809004_+	hypothetical protein	NA	Q5K5I4	Oenococcus_phage	33.2	8.0e-43
WP_167841992.1|809015_809801_+	hypothetical protein	NA	A0A1P8BKJ2	Lactococcus_phage	51.2	5.3e-31
WP_167841993.1|809890_810292_+|holin	phage holin family protein	holin	F0PIJ6	Enterococcus_phage	62.3	3.8e-41
WP_167841994.1|810288_811554_+	LysM peptidoglycan-binding domain-containing protein	NA	Q8LTP4	Lactococcus_phage	59.5	1.0e-137
WP_167841995.1|811964_812357_+	hypothetical protein	NA	A0A1P8BKD2	Lactococcus_phage	43.2	1.7e-22
WP_167841996.1|812361_812922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167840107.1|813055_813226_+	hypothetical protein	NA	A0A182BQ76	Lactococcus_phage	61.1	3.1e-05
WP_167841997.1|813242_813566_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_167842520.1|813728_814856_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	54.4	8.0e-113
WP_167842521.1|815085_816279_-	hypothetical protein	NA	A0A141E0C6	Streptococcus_phage	44.1	6.5e-73
WP_167841998.1|816355_817264_-	exonuclease	NA	X2KQX9	Campylobacter_phage	41.9	1.0e-57
WP_167841999.1|817295_817706_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I5R1	Streptococcus_phage	41.1	6.8e-14
WP_167842522.1|817845_818061_+	helix-turn-helix transcriptional regulator	NA	A0A0B5A7F0	Streptococcus_phage	36.2	3.8e-08
WP_167842000.1|818174_818399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167842001.1|818446_818662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842002.1|818662_818887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167842003.1|819007_819235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167842004.1|819336_819582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842005.1|819602_819830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842006.1|820182_820323_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_167842523.1|820475_820661_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	49.2	6.6e-09
WP_031365319.1|820918_821245_+	DUF771 domain-containing protein	NA	Q8LTN9	Lactococcus_phage	38.7	4.4e-16
WP_167842007.1|821288_821672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842008.1|821649_821832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842009.1|821944_822331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842010.1|822499_822787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842011.1|823016_823271_+	hypothetical protein	NA	R4IBV6	Listeria_phage	45.2	3.4e-11
WP_167842012.1|823273_823453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842013.1|823662_824502_+	hypothetical protein	NA	H7BUL9	unidentified_phage	33.3	2.8e-22
WP_167842014.1|824505_824919_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A220G9T0	Streptococcus_phage	51.4	1.6e-31
WP_167841268.1|824929_825373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842015.1|825390_825825_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_138491607.1|825885_826251_+	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	40.6	2.6e-09
WP_138491608.1|826247_826616_+	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	70.7	3.8e-48
WP_167841270.1|826717_827143_+|terminase	P27 family phage terminase small subunit	terminase	A0A1B0T688	Bacillus_phage	65.0	1.6e-45
WP_167841271.1|827139_828864_+|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	84.8	8.8e-297
WP_138491611.1|828877_830083_+|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	73.3	4.4e-170
WP_167842016.1|830045_830627_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J6Z9	uncultured_Caudovirales_phage	69.8	9.6e-70
WP_167842017.1|830626_831958_+|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.6	1.6e-128
WP_138491709.1|831971_832226_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J865	uncultured_Caudovirales_phage	73.2	8.8e-28
WP_138491615.1|832209_832533_+|head,tail	phage head-tail joining protein	head,tail	A0A0N7IRA3	Lactobacillus_phage	51.5	7.3e-19
WP_167842018.1|832522_832864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031365342.1|832853_833219_+	HK97 gp10 family phage protein	NA	A0A2H4JDG0	uncultured_Caudovirales_phage	40.5	7.0e-18
WP_167842019.1|833221_833863_+|tail	phage tail protein	tail	A0A0P0I7R6	Lactobacillus_phage	34.4	1.8e-24
WP_167842020.1|833862_834321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842021.1|834509_836819_+|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	44.6	3.6e-75
WP_167842022.1|836815_837529_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_167842023.1|837525_840141_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A191KBF6	Streptococcus_virus	48.4	3.6e-140
WP_167842024.1|840158_840968_+|plate	BppU family phage baseplate upper protein	plate	Q9AYV5	Lactococcus_phage	29.8	2.1e-22
WP_167842524.1|841287_841533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842025.1|841601_842024_+	hypothetical protein	NA	A0A0D3MSZ6	Lactococcus_phage	48.1	6.8e-33
WP_167842525.1|842043_842439_+|holin	phage holin family protein	holin	F0PIJ6	Enterococcus_phage	60.3	1.3e-38
WP_167842026.1|842439_843768_+	LysM peptidoglycan-binding domain-containing protein	NA	Q8LTP4	Lactococcus_phage	62.2	1.3e-151
WP_167842526.1|844495_845584_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.5	3.7e-30
WP_167842027.1|845570_846566_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_061773880.1|846614_847322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167842028.1|847321_848386_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_167842527.1|848439_849066_+	uridine kinase	NA	A0A2K9L178	Tupanvirus	39.3	7.7e-33
WP_167842029.1|849141_850125_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_167842030.1|850345_851134_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_167842031.1|851173_853531_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	50.1	2.1e-83
WP_167842032.1|853517_854519_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_167842033.1|854676_855822_+	amidohydrolase	NA	NA	NA	NA	NA
WP_167842528.1|856089_857040_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_167842034.1|857039_859070_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_096040280.1|859099_859342_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_157738531.1|859776_860394_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_167842035.1|860424_861921_+	gluconate kinase	NA	NA	NA	NA	NA
WP_167842036.1|862002_863994_+	transketolase	NA	NA	NA	NA	NA
WP_061773891.1|864260_865619_+	APC family permease	NA	NA	NA	NA	NA
WP_003139174.1|865883_866966_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_061773894.1|867334_868216_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_167842037.1|868393_870112_+	ribonuclease J	NA	NA	NA	NA	NA
WP_061773896.1|870381_870906_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_167842038.1|870906_872187_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.4	1.4e-60
WP_167372318.1|872344_873274_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HQL8	Paramecium_bursaria_Chlorella_virus	32.8	7.2e-27
WP_061773900.1|873358_874447_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.6	8.6e-56
WP_167842039.1|874446_877635_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_167842040.1|877841_879638_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	32.0	2.1e-67
WP_167842041.1|879886_880672_+	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_167842042.1|880671_881613_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_167842043.1|881605_882316_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_167842044.1|882412_882817_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_167842045.1|883336_884488_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_167842046.1|884489_886196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842047.1|886416_887139_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	39.7	1.1e-43
WP_167842048.1|887143_890860_+	phosphoribosylformylglycinamidine synthase	NA	NA	NA	NA	NA
WP_167841760.1|891039_892293_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.7	3.8e-63
WP_167842049.1|892575_893526_-	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_061773911.1|893568_894321_-	ATP-binding cassette domain-containing protein	NA	R4TX06	Phaeocystis_globosa_virus	27.1	3.9e-07
WP_167842050.1|894317_895274_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_167842051.1|895274_896231_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	45.8	6.4e-71
WP_061773914.1|896516_897197_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_001048115.1|897316_898315_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014571824.1|898449_898737_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167842509.1|898739_899618_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.1	1.2e-31
WP_096040294.1|899740_900448_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_061773916.1|900444_901110_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_167842052.1|901228_903139_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.7	4.6e-52
WP_167842053.1|903144_904278_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	61.7	5.7e-135
WP_167842054.1|904359_904992_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_167842055.1|905040_906306_+	dihydroorotase	NA	NA	NA	NA	NA
WP_061773921.1|906381_906969_+	DUF1054 family protein	NA	NA	NA	NA	NA
WP_167842056.1|907081_908014_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_167842057.1|908080_908938_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.4	9.3e-29
908990:909755	attR	GGTGTTTTTTAGTGGGAAAATTTTTTCCCTGAGGTGGCTAACTTCATTTTACAATTTGGGGAAATATTATTTCTTTTTTCAAAAAAATAAATAAACTATTGAAATTATAATTCTGTTGATGTATAATATACTTATAAACATGAAATAATATTTCAAAGGAGGTAAAACATGTATGGTTTCTCGATTTTTATGAACTCAGATTTAGACGAGGCAAAGCGTTCATACATTACGAAAATGGTCAATAGTGGCTTTAAGGGTATCTTTACCTCGATGCATATTCCTGAGGATGATATCAAGCTCTATAAAAAAAGATTGATAGATTTAGGAAATTTTGCGCAAACGCATCATTTGAAGTTAAATATAATAAACCTTCAAAATTAAAATCAGTCTTAAAATCAATTTCAAATATTTTTGTTCCAATGATTCCAGCTTTTGTCGGAACAGGGATTGTTGCAGGTATTGCGGCTGTTCTATCAAATTTAGTTGTTGCAGGTGATCTCAATGCAGCAACATGGCAGCAGTATATTGATATCATGAATATCTTGAAAAATGCTTTATTTGCGTACCTGACGATTTATGTCGGCATTGATGCTAAAAATACTGTTGATAAAGGACAAGTACTCTTAACTATCCAACCATAATATTTATTAAATAGAAGAGGTTGGTTTATGCCAGCCTCTTTGTTATAATTAAATAAGGAATGGAGGCGTAATGGATACTTTACTGTTAATAAGAGAAAGATATTCTAGTCTAAGCGCTGTCGAAA	NA	NA	NA	NA
>prophage 3
NZ_CP047630	Lactococcus raffinolactis strain Lr_18_12S chromosome, complete genome	2318892	916551	927682	2318892		Prochlorococcus_phage(28.57%)	14	NA	NA
WP_167842063.1|916551_917871_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	35.0	1.5e-30
WP_061773934.1|918233_919187_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_167842064.1|919179_920136_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_167842065.1|920136_920514_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_061773937.1|920664_921687_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	39.1	1.8e-55
WP_061773938.1|921683_922232_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.7	2.0e-29
WP_167842066.1|922303_922489_+	hypothetical protein	NA	A0A097BYE2	Leuconostoc_phage	46.7	7.6e-05
WP_167842067.1|922518_922821_+	hypothetical protein	NA	A0A097BYE2	Leuconostoc_phage	35.0	1.6e-07
WP_167838789.1|922841_923348_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_167842068.1|923367_923829_-	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	34.2	2.9e-13
WP_167842069.1|923795_924062_-	aminoglycoside 6-adenylyltransferase	NA	NA	NA	NA	NA
WP_167842070.1|924108_924777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163604839.1|924978_926433_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_167842071.1|926695_927682_+	GMP reductase	NA	G3MBI2	Bacillus_virus	77.0	4.5e-144
>prophage 4
NZ_CP047630	Lactococcus raffinolactis strain Lr_18_12S chromosome, complete genome	2318892	1021103	1122822	2318892	protease,bacteriocin,integrase,transposase	Streptococcus_phage(20.69%)	98	1095145:1095160	1126247:1126262
WP_157738534.1|1021103_1022054_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_138491432.1|1022403_1023327_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_167838726.1|1023323_1024250_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	52.9	6.2e-87
WP_167842117.1|1024401_1025022_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	61.6	2.1e-67
WP_138491434.1|1025021_1027448_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	66.5	1.8e-311
WP_096040410.1|1027486_1028701_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_096040409.1|1028884_1029295_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	46.6	1.1e-30
WP_004260832.1|1029422_1029560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842118.1|1029595_1030465_+	glutathione-dependent reductase	NA	NA	NA	NA	NA
WP_167842509.1|1030598_1031477_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.1	1.2e-31
WP_014571824.1|1031479_1031767_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001048115.1|1031901_1032900_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_167372353.1|1033015_1033975_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	67.1	1.1e-123
WP_061774285.1|1034095_1036249_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.4	5.2e-254
WP_061774284.1|1036253_1036610_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	D9J0S1	Brochothrix_phage	35.2	3.7e-16
WP_061774283.1|1036606_1036825_-	glutaredoxin-like protein NrdH	NA	A0A1W6JHV4	Lactococcus_phage	47.6	1.3e-11
WP_061774282.1|1036929_1037571_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_096040406.1|1037670_1038363_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SD15	Streptococcus_phage	50.0	1.4e-64
WP_061774280.1|1038484_1040302_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	37.2	1.7e-88
WP_167842119.1|1040542_1042165_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_138491438.1|1042446_1043607_+	MFS transporter	NA	NA	NA	NA	NA
WP_138491439.1|1043623_1043938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842120.1|1044100_1044583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061774273.1|1044694_1045471_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_167838734.1|1045467_1046814_-	Mur ligase family protein	NA	NA	NA	NA	NA
WP_138491442.1|1046863_1047739_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_061774270.1|1047827_1048331_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_167372352.1|1048569_1049568_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	8.6e-18
WP_167842121.1|1050380_1051166_+	multidrug ABC transporter permease	NA	NA	NA	NA	NA
WP_061774267.1|1051209_1052079_+	PEP-utilizing enzyme, TIM barrel domain protein	NA	NA	NA	NA	NA
WP_167842122.1|1052115_1052835_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_167842123.1|1052857_1053169_+	DUF3784 domain-containing protein	NA	NA	NA	NA	NA
WP_167372351.1|1053257_1053761_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_061774264.1|1053992_1054520_+	flavodoxin	NA	NA	NA	NA	NA
WP_167842535.1|1055687_1058036_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_167842536.1|1058331_1058946_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_167842124.1|1058938_1059109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842125.1|1059452_1060205_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167842126.1|1060188_1061238_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	51.2	1.1e-84
WP_167842127.1|1061292_1062516_+	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_167842128.1|1062528_1063611_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_167842129.1|1063603_1065421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842130.1|1065417_1065867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842131.1|1066289_1067401_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_014571824.1|1068831_1069119_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167842509.1|1069121_1070000_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.1	1.2e-31
WP_001048115.1|1070111_1071110_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_167842132.1|1071201_1071789_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	34.2	4.5e-19
WP_109833736.1|1071791_1072097_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_167842133.1|1072342_1072672_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_167842134.1|1073046_1074855_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_167842135.1|1075350_1076031_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	97.8	8.4e-126
WP_167842136.1|1076387_1077668_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_167838214.1|1077806_1078757_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.0	3.3e-35
WP_167842137.1|1078851_1079703_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096040511.1|1079990_1080713_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	6.6e-36
WP_096039590.1|1080727_1081399_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_096039589.1|1081468_1082296_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_167842138.1|1082462_1083554_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_096039587.1|1083654_1084500_+	nitrate reductase	NA	NA	NA	NA	NA
WP_096039586.1|1084520_1085480_+	C-terminal binding protein	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	28.7	4.4e-19
WP_096039585.1|1085472_1087113_+	peptidase M20	NA	NA	NA	NA	NA
WP_167842139.1|1087109_1088192_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_096039583.1|1088208_1089465_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	29.3	8.5e-31
WP_096039582.1|1089457_1090147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842537.1|1090269_1090854_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_047916692.1|1090947_1091628_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	5.0e-110
WP_167842140.1|1092172_1093291_+	aminotransferase	NA	NA	NA	NA	NA
WP_001048115.1|1093624_1094623_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_167842141.1|1094970_1096857_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I6C7	Streptococcus_phage	32.2	8.7e-80
1095145:1095160	attL	GTCTATGTGGATGATC	NA	NA	NA	NA
WP_096814544.1|1097121_1097562_+	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_094783929.1|1097783_1098026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842142.1|1098108_1098411_+	cytoplasmic protein	NA	NA	NA	NA	NA
WP_096814541.1|1098410_1098878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842143.1|1098892_1100563_+	hypothetical protein	NA	A0A1S5SFB5	Streptococcus_phage	32.5	6.6e-47
WP_167842144.1|1100846_1102079_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_096814538.1|1102151_1102433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841311.1|1102653_1103247_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_167842145.1|1103365_1107523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842146.1|1107801_1108536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167842147.1|1108689_1109136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842148.1|1109154_1109307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842149.1|1109284_1110529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094783918.1|1110535_1110775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842150.1|1110779_1111181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842151.1|1111152_1113657_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_167842152.1|1113672_1116021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842153.1|1116017_1117076_+	CHAP domain-containing protein	NA	Q4Z9D9	Staphylococcus_phage	41.5	6.5e-08
WP_167842154.1|1117086_1117515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842155.1|1117529_1117868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842156.1|1117864_1118680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841304.1|1118714_1119233_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	44.2	1.4e-32
WP_167842157.1|1119258_1120200_+	DNA (cytosine-5-)-methyltransferase	NA	H7BVD3	unidentified_phage	58.7	1.4e-99
WP_167842158.1|1120196_1120598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138491703.1|1120609_1120828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842159.1|1120833_1121034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138491701.1|1121214_1121442_+	DNA-binding protein	NA	Q9AZF3	Lactococcus_phage	53.4	6.9e-16
WP_138491673.1|1121541_1122822_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZF9	Lactococcus_phage	27.9	6.9e-28
1126247:1126262	attR	GTCTATGTGGATGATC	NA	NA	NA	NA
>prophage 5
NZ_CP047630	Lactococcus raffinolactis strain Lr_18_12S chromosome, complete genome	2318892	1421431	1429943	2318892	transposase	Paramecium_bursaria_Chlorella_virus(16.67%)	8	NA	NA
WP_167842251.1|1421431_1422601_-	nucleotide sugar dehydrogenase	NA	M1HV26	Paramecium_bursaria_Chlorella_virus	50.0	2.0e-95
WP_167841760.1|1422988_1424242_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.7	3.8e-63
WP_061774454.1|1424370_1424841_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	52.9	1.2e-41
WP_167838826.1|1424855_1427159_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.2	1.1e-92
WP_031365773.1|1427371_1427608_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_096039268.1|1427791_1428715_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.0	2.8e-87
WP_061774457.1|1428957_1429182_-	DUF4059 family protein	NA	NA	NA	NA	NA
WP_167842252.1|1429181_1429943_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	2.0e-30
>prophage 6
NZ_CP047630	Lactococcus raffinolactis strain Lr_18_12S chromosome, complete genome	2318892	1636405	1673836	2318892	tRNA,transposase,integrase	Streptococcus_phage(25.0%)	38	1644616:1644632	1682867:1682883
WP_096039434.1|1636405_1637164_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_096040498.1|1637278_1639273_-	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	37.1	2.7e-31
WP_167842298.1|1639413_1639728_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_167838914.1|1639727_1640456_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_167842299.1|1640784_1642626_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_061775042.1|1643173_1643785_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_167842300.1|1643953_1644688_-	RNA methyltransferase	NA	NA	NA	NA	NA
1644616:1644632	attL	TACGATTTTTCTTTTTA	NA	NA	NA	NA
WP_167842301.1|1644813_1645089_+	acylphosphatase	NA	NA	NA	NA	NA
WP_096039437.1|1645099_1645441_+	YrdB family protein	NA	NA	NA	NA	NA
WP_061775038.1|1645590_1646460_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_167842302.1|1646529_1648140_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	37.5	2.3e-28
WP_061775036.1|1648187_1648781_-	hypothetical protein	NA	A0A1W6JSC2	Bacillus_phage	38.5	1.2e-19
WP_061775035.1|1648819_1649803_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_167842303.1|1649808_1651062_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	56.6	1.0e-105
WP_003137233.1|1651051_1651678_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.5	2.0e-20
WP_167838921.1|1651670_1652486_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_061775032.1|1652482_1653550_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003137230.1|1653546_1654620_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_096039441.1|1654689_1655202_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_167838923.1|1655230_1655800_-	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	53.2	6.5e-47
WP_167842304.1|1655943_1657122_-|integrase	site-specific integrase	integrase	A0A1B1IMP1	Lactococcus_phage	31.4	1.3e-36
WP_157738473.1|1657223_1657412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001015311.1|1657473_1658154_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_167842305.1|1658625_1658973_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	40.2	5.2e-15
WP_130124643.1|1658969_1659404_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_167842306.1|1659418_1661134_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_167842307.1|1661151_1662813_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_167842308.1|1662827_1663901_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_167838214.1|1663995_1664946_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.0	3.3e-35
WP_001048115.1|1665342_1666341_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_167842309.1|1666455_1666674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001048115.1|1667023_1668022_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_167839170.1|1668546_1669200_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_031367081.1|1669227_1669506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031367082.1|1669523_1669751_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_167841725.1|1669830_1671681_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.7	1.1e-103
WP_031367084.1|1671948_1672527_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_001015311.1|1673155_1673836_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
1682867:1682883	attR	TAAAAAGAAAAATCGTA	NA	NA	NA	NA
>prophage 7
NZ_CP047630	Lactococcus raffinolactis strain Lr_18_12S chromosome, complete genome	2318892	1774427	1780763	2318892		Streptococcus_phage(83.33%)	8	NA	NA
WP_061775218.1|1774427_1775354_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	73.9	6.3e-124
WP_061775217.1|1775487_1776099_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	57.1	4.0e-66
WP_061775224.1|1776294_1777131_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_167372337.1|1777254_1778115_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	67.2	6.1e-97
WP_096040505.1|1778114_1778441_-	DUF972 family protein	NA	M1PFV3	Streptococcus_phage	41.9	4.4e-16
WP_061775215.1|1778452_1779223_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_167842335.1|1779265_1780129_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	47.1	3.6e-65
WP_061775213.1|1780115_1780763_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	60.0	7.6e-68
>prophage 8
NZ_CP047630	Lactococcus raffinolactis strain Lr_18_12S chromosome, complete genome	2318892	1800021	1842434	2318892	protease,integrase,tRNA,transposase	Streptococcus_phage(26.67%)	40	1799006:1799020	1832305:1832319
1799006:1799020	attL	TATGAAAATCATCAA	NA	NA	NA	NA
WP_040087761.1|1800021_1800567_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.9	3.1e-30
WP_138492025.1|1800660_1802064_-	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_167841814.1|1802338_1803757_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	58.0	2.9e-144
WP_096039504.1|1803824_1806125_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	32.9	2.1e-115
WP_167842339.1|1806325_1807240_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_096039505.1|1807263_1808388_-	teicoplanin resistance protein VanZ	NA	NA	NA	NA	NA
WP_061774869.1|1808487_1809813_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	81.2	9.4e-198
WP_167842340.1|1810028_1810595_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_167842341.1|1810685_1813130_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.4	1.4e-122
WP_061774879.1|1813158_1813602_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_167842342.1|1813988_1814690_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SD15	Streptococcus_phage	48.1	1.6e-55
WP_167842343.1|1814736_1816182_+	Y-family DNA polymerase	NA	Q6DMX4	Streptococcus_phage	58.6	6.3e-155
WP_167842344.1|1816178_1816349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061774864.1|1816384_1816786_+	YbgA family protein	NA	NA	NA	NA	NA
WP_061774863.1|1816769_1817132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003140218.1|1817220_1817703_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_138492412.1|1817794_1819438_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_061774878.1|1819571_1820156_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_061774860.1|1820499_1821012_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.1	2.0e-31
WP_167842345.1|1821013_1823239_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.4	6.5e-74
WP_138492410.1|1823235_1823967_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	38.7	5.9e-08
WP_138492409.1|1823963_1824905_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_061774856.1|1825203_1826100_-	SPFH domain-containing protein	NA	A0A1V0SL90	Klosneuvirus	36.7	4.1e-35
WP_138492408.1|1826096_1826771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138492407.1|1826745_1828011_-	GTPase HflX	NA	NA	NA	NA	NA
WP_138492406.1|1827997_1828909_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_061774852.1|1829080_1830244_-|integrase	site-specific integrase	integrase	C9E2L6	Enterococcus_phage	36.2	6.8e-51
WP_061774851.1|1830297_1830522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167842346.1|1830627_1831143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167842347.1|1831146_1832208_-	CHAP domain-containing protein	NA	Q4Z9D9	Staphylococcus_phage	35.1	1.5e-12
WP_167842348.1|1832320_1834738_-	hypothetical protein	NA	NA	NA	NA	NA
1832305:1832319	attR	TTGATGATTTTCATA	NA	NA	NA	NA
WP_156470241.1|1834734_1834908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167842349.1|1834929_1837413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031367045.1|1837417_1837792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003137046.1|1837793_1838024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167842350.1|1838025_1839243_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_096039816.1|1839497_1839995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003139569.1|1840040_1840325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167838214.1|1840482_1841433_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.0	3.3e-35
WP_167842057.1|1841576_1842434_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.4	9.3e-29
>prophage 9
NZ_CP047630	Lactococcus raffinolactis strain Lr_18_12S chromosome, complete genome	2318892	2250400	2292466	2318892	tRNA,holin,transposase	uncultured_virus(27.27%)	45	NA	NA
WP_061775288.1|2250400_2251423_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_061775287.1|2251422_2252061_+	HD domain-containing protein	NA	A0A1S5XYU7	Kurlavirus	32.4	1.8e-13
WP_167372340.1|2252161_2252896_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	34.0	2.7e-13
WP_138492446.1|2253158_2253914_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_061775285.1|2254034_2255210_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_138492447.1|2255870_2256107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167842483.1|2256334_2258422_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	31.7	4.4e-64
WP_167842484.1|2258475_2259629_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.6	8.9e-43
WP_156470234.1|2259825_2259963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061775290.1|2260090_2261482_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_167842485.1|2261742_2261958_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_167372358.1|2261957_2262755_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_138492449.1|2262951_2264346_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011669094.1|2264333_2265002_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.9	1.2e-36
WP_167842486.1|2265295_2265733_+	type I restriction endonuclease	NA	NA	NA	NA	NA
WP_167841608.1|2265842_2266430_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	37.1	1.8e-20
WP_040526183.1|2266422_2266689_-	DUF3781 domain-containing protein	NA	NA	NA	NA	NA
WP_047916728.1|2266799_2267144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167842487.1|2267362_2267530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068876876.1|2267744_2267849_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_167842488.1|2268238_2268622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842489.1|2268971_2269523_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_047916766.1|2269543_2269732_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_047916767.1|2269741_2270302_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_047916768.1|2270331_2270571_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_167842490.1|2270726_2271395_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	82.4	3.6e-105
WP_167842491.1|2271662_2273138_+	alpha-amylase	NA	NA	NA	NA	NA
WP_047916692.1|2273852_2274533_-|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	5.0e-110
WP_167842492.1|2274886_2275342_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_167842493.1|2275354_2277820_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.5	1.9e-103
WP_002294571.1|2277901_2278108_+	copper chaperone TcrZ	NA	NA	NA	NA	NA
WP_167842494.1|2278246_2280349_+	copper-translocating P-type ATPase TcrB	NA	A0A218MNH6	uncultured_virus	29.8	1.2e-58
WP_167842495.1|2280498_2280729_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167842489.1|2281596_2282148_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_047916766.1|2282168_2282357_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_047916767.1|2282366_2282927_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_047916768.1|2282956_2283196_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_047916768.1|2283268_2283508_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_167842491.1|2284758_2286234_-	alpha-amylase	NA	NA	NA	NA	NA
WP_021464853.1|2286544_2287213_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_167842496.1|2287357_2287561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096040590.1|2288447_2289203_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047916006.1|2289217_2289553_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_013793612.1|2290785_2291550_+	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_047916692.1|2291785_2292466_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	5.0e-110
>prophage 1
NZ_CP047632	Lactococcus raffinolactis strain Lr_18_12S plasmid pLr18_12S_2, complete sequence	27236	0	19526	27236	transposase	Streptococcus_phage(42.86%)	17	NA	NA
WP_031366962.1|98_737_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_167842570.1|2178_2643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031366965.1|2801_2996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842571.1|3113_3611_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_072353685.1|3657_4539_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_167842572.1|4724_5801_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_167842573.1|5784_6450_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	8.8e-27
WP_167842574.1|6446_7643_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_167842575.1|8062_8347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167842576.1|8348_9149_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	32.4	4.0e-34
WP_167842577.1|9260_10487_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_167842578.1|10875_12327_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	59.9	7.0e-154
WP_167362614.1|12323_12494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842579.1|14180_14861_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.5	1.3e-110
WP_031367202.1|14945_15194_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	50.0	2.0e-13
WP_031367203.1|15970_18640_+	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	32.0	1.2e-93
WP_167842579.1|18845_19526_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.5	1.3e-110
>prophage 2
NZ_CP047632	Lactococcus raffinolactis strain Lr_18_12S plasmid pLr18_12S_2, complete sequence	27236	22538	24047	27236		Bacillus_phage(100.0%)	1	NA	NA
WP_167842583.1|22538_24047_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	25.8	1.4e-11
>prophage 1
NZ_CP047631	Lactococcus raffinolactis strain Lr_18_12S plasmid pLraf_18_12S_1, complete sequence	32083	0	23259	32083	bacteriocin,transposase	Streptococcus_phage(40.0%)	21	NA	NA
WP_167842557.1|1964_3041_+	response regulator	NA	W8CYM9	Bacillus_phage	37.6	3.6e-38
WP_167842558.1|3037_4447_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	34.6	9.2e-42
WP_002328833.1|4995_5229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094518286.1|5273_6113_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_167842559.1|6156_6549_-	peptidoglycan DD-metalloendopeptidase family protein	NA	W8ED04	Mycobacterium_phage	54.3	8.6e-06
WP_002328836.1|6865_7072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167842568.1|7121_7733_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_048728504.1|8046_8337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167842560.1|8510_10613_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.1	1.8e-57
WP_002294571.1|10751_10958_-	copper chaperone TcrZ	NA	NA	NA	NA	NA
WP_167842493.1|11039_13505_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.5	1.9e-103
WP_167842492.1|13517_13973_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_167842561.1|14154_14445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109833736.1|14615_14921_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_167839029.1|14923_15511_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	37.2	4.1e-20
WP_167842562.1|15902_17699_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	31.9	1.8e-74
WP_096040587.1|18479_18692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072353682.1|18796_19639_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	47.9	4.8e-54
WP_096040586.1|19756_21040_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_072353702.1|21382_21802_-	helix-turn-helix transcriptional regulator	NA	A0A0D4DD29	Staphylococcus_phage	35.3	4.4e-08
WP_047916692.1|22578_23259_-|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	5.0e-110
>prophage 2
NZ_CP047631	Lactococcus raffinolactis strain Lr_18_12S plasmid pLraf_18_12S_1, complete sequence	32083	26412	29685	32083	transposase	Streptococcus_phage(100.0%)	2	NA	NA
WP_167842564.1|26412_28065_+	relaxase/mobilization nuclease domain-containing protein	NA	A0A1B0RXG0	Streptococcus_phage	41.2	1.2e-05
WP_167842565.1|28413_29685_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	5.9e-64
