The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050865	Escherichia coli strain 8-3-Ti3 chromosome, complete genome	4899869	138354	253126	4899869	tRNA,terminase,integrase,head,transposase,capsid,tail	Escherichia_phage(22.22%)	94	145195:145254	267066:267837
WP_167839391.1|138354_138906_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	74.1	1.1e-91
WP_167839316.1|138804_139014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000483770.1|139872_141219_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000726695.1|141692_143972_+	acid resistance putative oxidoreductase YdeP	NA	NA	NA	NA	NA
WP_000543382.1|144219_144417_+	two-component system connector SafA	NA	NA	NA	NA	NA
WP_073841002.1|144490_145216_+	acid stress response transcriptional regulator YdeO	NA	NA	NA	NA	NA
145195:145254	attL	GGTAATGACTCCAACTTACTGATAGTGTTTTATGTTCAGATAATGCCCGATGACCTTGTC	NA	NA	NA	NA
WP_073840446.1|146244_147645_+	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_000246019.1|147800_149336_+	acid resistance gamma-aminobutyrate antiporter GadC	NA	NA	NA	NA	NA
WP_000350395.1|149466_150786_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_032359723.1|151162_152545_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.6e-17
WP_072147946.1|152569_154969_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_001285833.1|155226_155808_+	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
WP_032359721.1|155821_157372_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000145111.1|157373_158396_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000979586.1|158392_159289_+	D,D-dipeptide ABC transporter permease	NA	NA	NA	NA	NA
WP_000193559.1|159285_160272_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	5.0e-18
WP_001285537.1|160264_161191_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
WP_001186476.1|162930_164976_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_167839392.1|165223_167341_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_167839393.1|167398_168898_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067509.1|169133_170039_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001325798.1|170210_170540_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|170544_170730_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001543716.1|170726_173366_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|173573_174563_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001298828.1|174673_175096_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|175092_175359_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_032359463.1|175632_179157_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001082294.1|182082_182517_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000555620.1|183880_184795_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983722.1|184794_185622_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_073840967.1|185618_186476_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968134.1|186472_187330_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000551125.1|187530_188154_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	79.1	4.0e-82
WP_134889703.1|188104_189520_-|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	44.5	4.3e-47
WP_073841474.1|189583_190183_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.4e-108
WP_000483770.1|190295_191642_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_167839394.1|191692_195190_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	94.4	0.0e+00
WP_000090878.1|195250_195853_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.1	7.3e-89
WP_000952382.1|196132_197305_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
WP_000544828.1|197304_198102_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
WP_032359447.1|198671_199370_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	88.4	1.2e-119
WP_000024051.1|199369_199708_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_052984281.1|199700_200714_-|tail	phage tail tape measure protein	tail	Q6H9T7	Enterobacteria_phage	39.9	8.9e-55
WP_167839395.1|201512_202457_-|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	35.8	7.5e-40
WP_085948186.1|202535_203691_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000818815.1|203762_203888_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_085948186.1|204021_205177_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000276808.1|205755_205944_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	95.2	6.1e-26
WP_000079604.1|206043_206259_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_167839317.1|206347_206554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073849567.1|208323_209259_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_032359448.1|209387_210761_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|211238_212222_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|212476_213709_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_001046821.1|213729_214293_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000133418.1|215067_215349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835284.1|215422_215965_-|terminase	terminase	terminase	O64316	Escherichia_phage	48.1	2.9e-36
WP_001179421.1|216166_216550_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190777.1|216561_216903_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000228099.1|216912_217953_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	3.0e-66
WP_000197300.1|218590_218842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761761.1|219043_220459_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	58.2	6.9e-114
WP_000810838.1|220455_220755_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001244628.1|220761_220980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001063222.1|220969_221182_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	44.1	7.9e-06
WP_000336174.1|221174_221411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077637288.1|221400_221694_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001352455.1|221626_222817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001352456.1|222869_223058_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	9.1e-14
WP_001352457.1|223425_224655_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.1	1.3e-132
WP_000885454.1|225021_225930_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000444949.1|226105_227416_+	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_073849566.1|227415_228822_+	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_167839396.1|228858_231645_+	p-aminobenzoyl-glutamate transporter	NA	S5FM71	Shigella_phage	50.6	1.0e-105
WP_000945005.1|231699_232215_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
WP_000611911.1|232409_233162_+	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_001262123.1|233313_234264_+	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000605090.1|234313_234571_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_167839397.1|234814_235822_+	low conductance mechanosensitive channel YnaI	NA	NA	NA	NA	NA
WP_001111632.1|237587_238778_+|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
WP_000817693.1|239373_240273_-	DNA-binding transcriptional regulator PgrR	NA	NA	NA	NA	NA
WP_000981718.1|240410_241331_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000680602.1|241330_242263_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_073849797.1|242280_242919_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000219122.1|243228_243957_+	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_001365287.1|243931_244903_-	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_000084384.1|245021_245528_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_032359701.1|245571_247110_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_000138717.1|247257_248319_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_032359703.1|248315_249713_-	YcjX family protein	NA	NA	NA	NA	NA
WP_032359704.1|249867_250866_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_000735257.1|250976_251882_-	monomeric porin OmpG	NA	NA	NA	NA	NA
WP_001111632.1|251935_253126_-|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
267066:267837	attR	GACAAGGTCATCGGGCATTATCTGAACATAAAACACTATCAGTAAGTTGGAGTCATTACCTTACGAGTGATGCGTTACTTTCCGGTAAAAATAAAAACGGTAAATAGAGCGCAATATCGGAAATAACATCGCCAGTTTCATTCAAAATCGCCCCCAGACGTGTTTGCTGATTGCACTCACGCGCCAACATGCCATCCAGCGCATTGAGCGCCATACGGATAAAAAGCACGATGGGCAATAGCAAAAAGAGGATGGGTTGTGCCACCAACACCAACAGCAATCCGGTAAAAAGAGAAAGCGCCAGTGCCGTAAGAGTGATGTGATTCGCTGTAACGTGGTGCTTATAAAGCCAAAACATCGTCGGCCTTAACAGCGACTGAAAGAGCGGTTTTATCTGGTAGAGCGTCATTATCAATCCTTGATAATTCGGTTTGCGCTATGGTGCATCAATTCCCCTGACGGAGATATCGCAACACGCCGCTTCATTAAAAATTCAGAATATATCAAGGTATTGGGGACTCACTGCCAGGAATGATTATCCCCAATTAATCAAATGGTTAAGAAAAATTACGTTGTGGATCAATACAACTCATCAAGTTTTCTCATCGCTTGTTCCCGTATTGCGCGCGTCTTACCGTTAAGCGCCAGCTGGCGGACTAAATCCAGTTCAGGGTTAACAAGCTCTAACGCCAGCAAAGGATCACGTTTCAGCCTCGCCTTTAATACATCAACTGGAAAACGGGGATTATTCATCGCCACAATCCACCACTCG	NA	NA	NA	NA
>prophage 2
NZ_CP050865	Escherichia coli strain 8-3-Ti3 chromosome, complete genome	4899869	369862	377996	4899869	transposase	Acinetobacter_phage(33.33%)	8	NA	NA
WP_001301045.1|369862_371824_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	2.7e-23
WP_000429155.1|371896_372433_-	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001326689.1|372485_373700_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_167840432.1|373739_374897_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1W6JP07	Morganella_phage	96.9	3.5e-188
WP_085948186.1|374847_376004_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_148747804.1|376065_376215_-	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	81.6	6.5e-15
WP_094185360.1|376607_377763_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_073840949.1|377714_377996_+	hypothetical protein	NA	I4AZM1	Saccharomonospora_phage	74.3	2.1e-06
>prophage 3
NZ_CP050865	Escherichia coli strain 8-3-Ti3 chromosome, complete genome	4899869	720889	788229	4899869	transposase,protease,tRNA	Acinetobacter_phage(30.0%)	55	NA	NA
WP_000003671.1|720889_721477_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|721473_722181_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|722199_723993_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|723989_725108_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000375136.1|725828_726488_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_000904442.1|726578_726908_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000048233.1|726904_727183_-	acylphosphatase	NA	NA	NA	NA	NA
WP_073840822.1|727277_728468_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_001295356.1|728525_728843_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000665217.1|728887_729301_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847791.1|729473_730136_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424181.1|730231_730690_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420536.1|730721_732776_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
WP_001261235.1|732898_733345_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000875023.1|733354_735517_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_032359025.1|735479_736109_-	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000288710.1|736327_736837_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000750416.1|737193_738234_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877161.1|738309_738762_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156526.1|738947_740708_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227927.1|740776_741295_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000828648.1|741364_741532_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759120.1|741787_742351_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000445541.1|742347_743988_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333176.1|743992_745246_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053099.1|745375_747283_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
WP_001086517.1|747294_749403_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224273.1|749646_750756_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_001295353.1|750752_751295_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_032359028.1|751468_752479_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000730614.1|753815_754358_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001165655.1|754369_755440_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000286316.1|755430_758031_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000845152.1|758055_758757_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000750298.1|758839_759382_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001244320.1|760305_761265_+	aliphatic sulfonate ABC transporter substrate-binding protein SsuA	NA	NA	NA	NA	NA
WP_060773707.1|761261_762407_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_000235203.1|762418_763210_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_001090514.1|763206_763974_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
WP_000193844.1|764180_766793_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_032358579.1|767058_768261_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_073849680.1|768429_769830_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	6.9e-82
WP_000977914.1|770431_771520_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.0	1.1e-98
WP_000462687.1|771704_772895_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109487.1|773116_773764_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|773790_774339_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_073849681.1|774519_776367_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572668.1|776627_781088_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295347.1|781087_781792_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288850.1|781772_783095_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001298300.1|783091_783877_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899599.1|784012_784792_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_085948186.1|785587_786743_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000818815.1|786814_786940_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_085948186.1|787073_788229_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 4
NZ_CP050865	Escherichia coli strain 8-3-Ti3 chromosome, complete genome	4899869	921759	1022751	4899869	plate,terminase,integrase,holin,head,transposase,capsid,protease,tail,portal	Enterobacteria_phage(37.1%)	100	953891:953907	1022196:1022212
WP_000483770.1|921759_923106_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000990177.1|925150_925828_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146357.1|925901_926168_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000849301.1|926432_926693_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_032359353.1|926920_928006_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386542.1|928146_929109_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_032359362.1|929136_931287_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	4.8e-42
WP_001145127.1|931406_931889_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	2.6e-36
WP_000007101.1|932120_933485_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001361582.1|933713_934385_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_072147905.1|934384_935383_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996107.1|935375_937112_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_032359357.1|937104_938238_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|938248_939355_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_032172379.1|939316_939727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073849565.1|939859_940621_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650317.1|940617_941859_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_032359359.1|941858_942815_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_167839419.1|942818_943064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373624.1|943804_944509_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|944645_945098_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598613.1|945099_945345_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|945337_945823_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084639.1|945825_946338_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001295301.1|946359_947349_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|947745_948654_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|948845_950867_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_073849423.1|951445_952123_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246799.1|952115_952871_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118857.1|952857_954012_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
953891:953907	attL	TACTGGCGATCATCCGC	NA	NA	NA	NA
WP_000951213.1|954008_955049_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016244430.1|955135_956425_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	8.5e-18
WP_000767389.1|956483_956960_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_032359430.1|957110_958394_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_032359612.1|963449_964502_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_032360163.1|966457_967453_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_001344347.1|967712_967844_-	hypothetical protein	NA	A0A0C4UR34	Shigella_phage	84.4	8.8e-08
WP_004993624.1|969110_970937_+	invasion protein	NA	NA	NA	NA	NA
WP_134889552.1|971116_971740_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	77.5	6.4e-80
WP_167839420.1|971690_972959_-|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	43.9	1.7e-79
WP_152061593.1|972982_973528_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	76.4	6.4e-76
WP_167839421.1|973530_974739_-|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	71.1	1.8e-147
WP_073841036.1|974725_975316_-	DUF2313 domain-containing protein	NA	Q8W614	Enterobacteria_phage	98.0	7.1e-113
WP_000785589.1|975315_976398_-|plate	baseplate J/gp47 family protein	plate	Q8W615	Enterobacteria_phage	97.5	9.4e-204
WP_000973351.1|976390_976804_-	hypothetical protein	NA	Q8W616	Enterobacteria_phage	95.6	9.5e-72
WP_167839422.1|976809_977343_-|plate	phage baseplate assembly protein	plate	Q8W617	Enterobacteria_phage	95.5	2.4e-91
WP_038341625.1|977342_978398_-|plate	baseplate protein	plate	Q8W618	Enterobacteria_phage	99.1	8.0e-200
WP_000365505.1|978394_979786_-	DNA circularization protein	NA	Q8W619	Enterobacteria_phage	95.9	6.1e-248
WP_000594909.1|979832_980315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785377.1|980382_982332_-|tail	phage tail tape measure protein	tail	Q8W620	Enterobacteria_phage	98.2	0.0e+00
WP_001251341.1|982416_982752_-|tail	phage tail assembly protein	tail	Q8W621	Enterobacteria_phage	98.2	1.2e-51
WP_073841035.1|982751_983108_-|tail	phage tail protein	tail	Q8W622	Enterobacteria_phage	97.5	2.6e-62
WP_167839505.1|984243_985434_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	50.4	3.8e-105
WP_000497744.1|985904_986066_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	76.6	9.2e-15
WP_000779449.1|986075_986639_-	hypothetical protein	NA	Q8W624	Enterobacteria_phage	98.9	2.3e-105
WP_001076765.1|986635_987160_-	hypothetical protein	NA	Q8W625	Enterobacteria_phage	98.9	2.7e-95
WP_000702444.1|987125_987542_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	69.1	9.0e-46
WP_000924703.1|987538_987862_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8W626	Enterobacteria_phage	98.1	8.2e-55
WP_038341736.1|987906_989133_-|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	92.6	3.2e-208
WP_001193631.1|989147_989798_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466011.1|989775_991017_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	93.5	2.2e-228
WP_000478600.1|991016_991199_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	80.0	1.4e-19
WP_073849516.1|991210_992968_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
WP_024166447.1|992967_993450_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001139556.1|993597_993948_-	HNH endonuclease	NA	Q8W633	Enterobacteria_phage	99.1	4.7e-64
WP_141011548.1|994052_994235_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	73.8	2.1e-15
WP_032359927.1|994451_994949_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	97.6	1.4e-90
WP_000284485.1|994948_995164_-|holin	holin	holin	M1FN85	Enterobacteria_phage	91.5	4.2e-31
WP_000640122.1|996343_996898_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	6.5e-68
WP_000228005.1|996894_997185_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	9.6e-47
WP_000940336.1|997184_997784_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	1.7e-106
WP_000687440.1|997822_998110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000952382.1|998430_999603_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
WP_000544828.1|999602_1000400_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
WP_000882657.1|1000493_1000706_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	90.0	4.0e-26
WP_012421537.1|1000876_1001542_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001343130.1|1001710_1002067_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.8e-58
WP_001118169.1|1002124_1002547_-	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	76.6	4.5e-53
WP_000789009.1|1002561_1003308_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.7	2.0e-112
WP_038340159.1|1003314_1004103_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.7	4.6e-43
WP_000702036.1|1004180_1004603_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	3.8e-68
WP_000912291.1|1004586_1004814_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787424.1|1004890_1005298_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	1.7e-28
WP_001091983.1|1005500_1005656_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.8e-07
WP_001005969.1|1005657_1005861_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	6.6e-10
WP_001068999.1|1007408_1007690_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	55.8	2.0e-09
WP_001111632.1|1009751_1010942_-|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
WP_085948186.1|1012123_1013280_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001277359.1|1013421_1013718_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	83.5	6.2e-41
WP_001173292.1|1013723_1014821_+	AAA family ATPase	NA	I6PCV5	Cronobacter_phage	84.7	2.9e-184
WP_000276807.1|1014871_1015060_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	93.5	8.8e-17
WP_073840731.1|1015164_1015389_+	excisionase	NA	C6ZCU6	Enterobacteria_phage	73.2	2.8e-22
WP_073840732.1|1015354_1016401_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	44.8	1.2e-75
WP_032359258.1|1016636_1017455_+	bifunctional pyridoxal phosphate/fructose-1,6-bisphosphate phosphatase	NA	NA	NA	NA	NA
WP_073840733.1|1017455_1018514_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.2	5.7e-20
WP_000604034.1|1018516_1019206_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_032359260.1|1019205_1019979_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|1020144_1020294_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|1020422_1021211_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096869.1|1021278_1022751_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
1022196:1022212	attR	TACTGGCGATCATCCGC	NA	NA	NA	NA
>prophage 5
NZ_CP050865	Escherichia coli strain 8-3-Ti3 chromosome, complete genome	4899869	1408237	1465750	4899869	transposase,holin	Shigella_phage(20.0%)	44	NA	NA
WP_001111632.1|1408237_1409428_+|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
WP_077897157.1|1409468_1410092_-	hydrogen peroxide resistance inhibitor IprA	NA	NA	NA	NA	NA
WP_073849610.1|1410179_1413182_-	autotransporter adhesin EhaB	NA	NA	NA	NA	NA
WP_001295337.1|1413705_1414680_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000004044.1|1414785_1415637_-	taurine dioxygenase	NA	NA	NA	NA	NA
WP_000114607.1|1415633_1416461_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_073840950.1|1416444_1417224_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.7e-26
WP_001317652.1|1417236_1418199_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_167839324.1|1418878_1419103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001316894.1|1420286_1421234_+	DNA-binding transcriptional activator MhpR	NA	NA	NA	NA	NA
WP_000805902.1|1421310_1422393_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
WP_032359991.1|1422515_1425590_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.9	0.0e+00
WP_000291549.1|1425641_1426895_+	lactose permease	NA	NA	NA	NA	NA
WP_001364607.1|1426960_1427572_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
WP_001111632.1|1427913_1429104_+|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
WP_167839435.1|1430734_1430926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131044.1|1431432_1433466_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001299022.1|1433594_1434182_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_073840843.1|1434195_1435668_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159105.1|1435681_1437352_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_073840842.1|1438341_1439010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370404.1|1439252_1439948_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023907.1|1439940_1441368_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_073840841.1|1441378_1442098_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339589.1|1442616_1443471_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_000474077.1|1445130_1445367_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_032359486.1|1445378_1445972_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|1446131_1447001_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_000621018.1|1447249_1448107_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167839436.1|1448227_1452481_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|1453596_1453698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|1454061_1454325_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|1454324_1454465_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|1454499_1454727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|1454899_1456055_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_167839437.1|1456204_1456420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000730972.1|1457520_1458108_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|1458165_1458834_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_073849682.1|1458859_1461385_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_073840926.1|1461374_1463018_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|1462986_1463697_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|1464009_1464339_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_134889602.1|1464333_1464576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|1464593_1465750_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 6
NZ_CP050865	Escherichia coli strain 8-3-Ti3 chromosome, complete genome	4899869	1529484	1552606	4899869	transposase,plate	Acinetobacter_phage(40.0%)	16	NA	NA
WP_001485749.1|1529484_1530621_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000978828.1|1530882_1531332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167839439.1|1531952_1532174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839440.1|1532119_1533673_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	4.0e-22
WP_085948186.1|1533684_1534841_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_073841557.1|1537703_1539845_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.8e-26
WP_032359313.1|1540054_1540573_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037389.1|1541269_1541770_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|1541804_1542029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032359314.1|1542079_1543555_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611742.1|1543561_1543975_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_085948186.1|1544493_1545650_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001111632.1|1548590_1549781_+|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
WP_096836545.1|1549827_1550751_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|1550747_1551272_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_167839441.1|1551274_1552606_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 7
NZ_CP050865	Escherichia coli strain 8-3-Ti3 chromosome, complete genome	4899869	1621928	1712492	4899869	tRNA,integrase,holin,transposase,protease,lysis,tail	Escherichia_phage(22.22%)	83	1657115:1657150	1712570:1712605
WP_073850028.1|1621928_1623353_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
WP_000057067.1|1623482_1625000_-	dGTPase	NA	NA	NA	NA	NA
WP_000689844.1|1625083_1625782_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_001129927.1|1625774_1626575_+	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
WP_073840596.1|1626612_1627236_+	TRIC cation channel family protein	NA	NA	NA	NA	NA
WP_001295564.1|1627282_1627627_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
WP_120795373.1|1627619_1627685_-	protein YadW	NA	NA	NA	NA	NA
WP_032359106.1|1627708_1629130_-	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_000045275.1|1629354_1630635_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_167839446.1|1630669_1632652_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_000015998.1|1632648_1633539_-	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
WP_001158929.1|1633538_1634336_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
WP_073840597.1|1634386_1636630_-	ferrichrome porin FhuA	NA	NA	NA	NA	NA
WP_000918155.1|1636849_1639384_-	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
WP_032359102.1|1639579_1642009_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	1.5e-39
WP_001294692.1|1642082_1642613_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|1642627_1643332_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|1643509_1643965_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937425.1|1644001_1644928_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|1644966_1646385_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000215124.1|1646381_1646861_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_000038438.1|1647230_1647815_+	fimbrial protein	NA	NA	NA	NA	NA
WP_073849453.1|1647919_1648660_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_167839447.1|1649652_1649865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000591057.1|1652088_1652658_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000143205.1|1652672_1653275_+	fimbrial-like protein YadL	NA	NA	NA	NA	NA
WP_000713138.1|1653950_1655225_+	fimbrial-like adhesin	NA	NA	NA	NA	NA
WP_000805451.1|1655337_1656132_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_000905371.1|1656143_1656995_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
1657115:1657150	attL	AATCCCCAGGAGCTTACATAAGTAAGTGACTGGGGT	NA	NA	NA	NA
WP_088895425.1|1658083_1659312_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000621515.1|1659792_1660173_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_073840985.1|1660176_1661406_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000901989.1|1661469_1661910_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_032360045.1|1662014_1662785_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000150637.1|1662781_1663708_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|1663816_1664479_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|1664519_1665056_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_073840986.1|1665261_1667652_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_028132498.1|1667853_1669404_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001295568.1|1669569_1669917_+	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_032360044.1|1670022_1670889_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_000734287.1|1670904_1671699_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_032360043.1|1671736_1672099_-	YacL family protein	NA	NA	NA	NA	NA
WP_001307570.1|1672273_1674871_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_000801163.1|1676774_1678538_+	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_000551126.1|1678717_1679341_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.5	5.4e-79
WP_001343146.1|1679291_1680560_-|tail	tail protein	tail	Q8W611	Enterobacteria_phage	42.9	8.8e-76
WP_032359688.1|1680583_1681129_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	73.6	4.3e-72
WP_085948186.1|1681832_1682989_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_004996416.1|1683139_1683736_-	hypothetical protein	NA	Q9B021	Phage_GMSE-1	65.0	5.1e-18
WP_167839448.1|1683938_1684406_-|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	93.5	2.8e-72
WP_032359927.1|1684402_1684900_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	97.6	1.4e-90
WP_000839570.1|1684899_1685115_-|holin	holin	holin	M1FN85	Enterobacteria_phage	95.8	1.0e-32
WP_001235461.1|1685608_1686232_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000994516.1|1686228_1686417_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_073840903.1|1686413_1686776_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKF0	Enterobacteria_phage	96.7	6.6e-61
WP_001344365.1|1686772_1687543_-	phage antirepressor Ant	NA	A0A2I6PIF5	Escherichia_phage	93.1	5.7e-62
WP_073840904.1|1687868_1688573_-	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	86.8	4.1e-115
WP_024258354.1|1688894_1689224_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	93.1	1.6e-42
WP_000147081.1|1689213_1689522_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	98.0	3.5e-47
WP_001254220.1|1689563_1689740_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_000736913.1|1689736_1690177_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_073840460.1|1690254_1693161_-	replication protein P	NA	A0A0P0ZC72	Stx2-converting_phage	99.1	0.0e+00
WP_000140459.1|1694058_1695255_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_167840431.1|1695780_1696080_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	97.0	2.4e-48
WP_024196828.1|1696218_1696443_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	86.3	8.3e-30
WP_001344358.1|1696587_1697262_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	83.9	9.0e-104
WP_000885926.1|1697299_1697641_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_000035314.1|1698172_1698364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073849761.1|1699168_1699573_+	antitermination protein	NA	G9L671	Escherichia_phage	100.0	1.6e-63
WP_001198866.1|1701382_1701523_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	100.0	3.3e-21
WP_038341317.1|1701515_1701659_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	95.7	3.0e-17
WP_020241285.1|1701734_1702031_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_073840457.1|1702036_1702822_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.1e-148
WP_167839450.1|1703495_1703609_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	72.5	1.1e-09
WP_001111632.1|1703659_1704850_+|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
WP_073840456.1|1705076_1705850_+	DUF551 domain-containing protein	NA	G3CFH2	Escherichia_phage	59.5	3.6e-88
WP_000247838.1|1705928_1706651_+	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	70.1	6.3e-87
WP_052994181.1|1706981_1707605_+	antirepressor	NA	A0A0P0ZAZ7	Stx2-converting_phage	86.5	4.1e-95
WP_001303849.1|1707689_1707908_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_085948186.1|1707996_1709152_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_073849439.1|1709164_1710223_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	8.6e-194
WP_000102485.1|1711067_1712492_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
1712570:1712605	attR	ACCCCAGTCACTTACTTATGTAAGCTCCTGGGGATT	NA	NA	NA	NA
>prophage 8
NZ_CP050865	Escherichia coli strain 8-3-Ti3 chromosome, complete genome	4899869	2675560	2687356	4899869	transposase	Enterobacteria_phage(25.0%)	8	NA	NA
WP_000587764.1|2675560_2676493_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_001213834.1|2676706_2677903_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_073840672.1|2677912_2678938_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001111632.1|2679044_2680235_+|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
WP_000544828.1|2681027_2681825_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
WP_000952382.1|2681824_2682997_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
WP_000334086.1|2683994_2685824_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_032358874.1|2685985_2687356_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.3	2.6e-33
>prophage 9
NZ_CP050865	Escherichia coli strain 8-3-Ti3 chromosome, complete genome	4899869	3155571	3215464	4899869	transposase,protease,tRNA	Enterobacteria_phage(16.67%)	46	NA	NA
WP_085948186.1|3155571_3156727_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_016232304.1|3156843_3160701_-|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.3	4.1e-225
WP_073849754.1|3161061_3161337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000544828.1|3161381_3162179_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
WP_000952382.1|3162178_3163351_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
WP_000878026.1|3170624_3171644_-|transposase	IS110-like element ISEc11 family transposase	transposase	NA	NA	NA	NA
WP_001188520.1|3173131_3173707_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_032360099.1|3173743_3175441_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|3175416_3175755_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|3175870_3177172_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000069437.1|3177289_3178726_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|3179062_3179539_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_073849476.1|3179554_3180811_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|3181086_3181380_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3181423_3183070_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|3183207_3183561_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_073840742.1|3183753_3184623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940506.1|3185012_3186041_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|3186082_3186649_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|3186700_3186826_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|3186936_3187083_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_039021648.1|3187257_3187575_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238369.1|3187571_3188105_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_005111907.1|3188193_3189327_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_000609663.1|3189389_3189749_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|3189759_3190155_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|3190165_3190900_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_001192973.1|3190892_3192701_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|3193025_3194003_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_000342867.1|3196552_3196867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032359830.1|3196863_3197178_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236850.1|3197206_3200530_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934912.1|3200551_3201520_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_073840666.1|3201616_3202669_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_032359828.1|3202763_3203309_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	1.0e-28
WP_010723271.1|3204050_3204104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294204.1|3204086_3205226_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_072147964.1|3205224_3206772_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|3206743_3207205_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_032359827.1|3207223_3208561_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_032359826.1|3208570_3210418_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280339.1|3210410_3211361_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3211446_3211755_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|3211831_3213112_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|3213197_3214457_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3214459_3215464_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 10
NZ_CP050865	Escherichia coli strain 8-3-Ti3 chromosome, complete genome	4899869	3917676	3999738	4899869	plate,tRNA,integrase,head,transposase,protease,tail	Shigella_phage(54.35%)	93	3917591:3917609	3982979:3982997
3917591:3917609	attL	GAACAAACCGCCGCCGCGA	NA	NA	NA	NA
WP_000084590.1|3917676_3918576_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_005136380.1|3919542_3920073_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	61.7	3.1e-35
WP_001310454.1|3920262_3920511_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289280.1|3920512_3922603_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	46.9	1.7e-164
WP_000129789.1|3922685_3923618_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000257932.1|3923620_3923842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|3923854_3924109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|3924110_3924392_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049428.1|3924388_3924661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049310.1|3924665_3924959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129558.1|3924970_3925501_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	2.5e-48
WP_000564272.1|3925646_3926180_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	68.4	3.7e-68
WP_000465565.1|3926179_3926695_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	3.1e-48
WP_000977057.1|3926698_3927250_+	SANT/Myb domain-containing protein	NA	NA	NA	NA	NA
WP_000633433.1|3927246_3927576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103721777.1|3927530_3927923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000021232.1|3927938_3928247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000687317.1|3928208_3928619_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_001077937.1|3928683_3929196_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	48.3	1.8e-27
WP_000852372.1|3929266_3929689_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125309.1|3929760_3930261_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.3e-26
WP_123058433.1|3930295_3930724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005136374.1|3930707_3930926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342742.1|3930936_3931164_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_033816661.1|3931144_3931453_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279080.1|3931449_3931740_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
WP_000360580.1|3931742_3932324_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	4.2e-49
WP_000255658.1|3932334_3932583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030249.1|3932582_3934247_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.4	1.6e-231
WP_000532598.1|3934246_3935836_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	58.1	1.4e-168
WP_000191774.1|3935819_3937151_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.7	1.1e-153
WP_000094810.1|3937272_3937746_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	1.7e-37
WP_000850814.1|3937923_3939048_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	46.5	5.0e-75
WP_001142987.1|3939047_3939995_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	7.1e-123
WP_001002062.1|3940038_3940392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104953.1|3940388_3940808_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	54.3	6.1e-34
WP_000627434.1|3940804_3941368_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.1	6.3e-42
WP_167839349.1|3941371_3941596_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_001111632.1|3941557_3942748_-|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
WP_000606777.1|3942953_3944456_+|tail	tail protein	tail	A0A0C4UQS0	Shigella_phage	51.1	1.2e-132
WP_000015465.1|3944464_3944830_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000213223.1|3944844_3945324_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	49.2	2.3e-21
WP_001107490.1|3945451_3947509_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	38.9	1.1e-75
WP_000168761.1|3947495_3948854_+	DMT family permease	NA	A0A0C4UR32	Shigella_phage	29.3	1.7e-45
WP_000098566.1|3948837_3949962_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	47.4	4.8e-94
WP_072105406.1|3949951_3950566_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.3	2.5e-52
WP_000763299.1|3950558_3950996_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	56.9	7.7e-40
WP_001146839.1|3950995_3952078_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	8.2e-99
WP_000301581.1|3952068_3952629_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	49.7	6.0e-45
WP_000469166.1|3952628_3953510_+	hypothetical protein	NA	C9DGQ8	Escherichia_phage	43.9	3.5e-31
WP_000421093.1|3953541_3954063_-|tail	tail protein	tail	A0A0U2QV64	Escherichia_phage	49.1	8.6e-46
WP_077762423.1|3954114_3954438_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000904914.1|3954553_3955126_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	76.9	1.3e-74
WP_001284083.1|3955211_3957266_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	65.1	1.1e-234
WP_000143468.1|3957410_3957593_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	52.6	5.0e-09
WP_001114100.1|3957628_3957883_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000571916.1|3958050_3958311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014334043.1|3958600_3958801_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_167839350.1|3958754_3959492_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	77.3	4.1e-102
WP_001175648.1|3961702_3962599_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_032358689.1|3962762_3963620_+	HTH-type transcriptional regulator MurR	NA	NA	NA	NA	NA
WP_000517431.1|3963748_3964540_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
WP_000290222.1|3964710_3965727_+	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000458420.1|3965726_3966560_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|3966559_3967435_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021040.1|3967424_3968522_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001295461.1|3968655_3969567_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	7.7e-58
WP_167839351.1|3969755_3970526_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_000719924.1|3971299_3971674_-	YfeK family protein	NA	NA	NA	NA	NA
WP_001111632.1|3972332_3973523_+|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
WP_000522247.1|3973975_3974485_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_032359485.1|3974525_3976253_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
WP_000487600.1|3976297_3976555_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|3976938_3977910_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|3978094_3978856_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001297862.1|3979085_3980072_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443665.1|3980142_3982158_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
WP_000410201.1|3982159_3982378_+	DUF3820 domain-containing protein	NA	NA	NA	NA	NA
WP_000765604.1|3982374_3983373_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
3982979:3982997	attR	GAACAAACCGCCGCCGCGA	NA	NA	NA	NA
WP_001109794.1|3983462_3984389_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000201411.1|3984379_3984721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695655.1|3985652_3987068_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001341599.1|3987119_3987491_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001296278.1|3987513_3987858_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000497400.1|3988377_3990567_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_001111632.1|3990616_3991807_-|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
WP_000376337.1|3991920_3993123_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_000186359.1|3993458_3994697_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_000490072.1|3994837_3995164_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_016240160.1|3995278_3996535_-	ion channel protein	NA	NA	NA	NA	NA
WP_000170352.1|3996738_3997704_+	glucokinase	NA	NA	NA	NA	NA
WP_000038456.1|3997922_3998249_+	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
WP_001111632.1|3998547_3999738_-|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
>prophage 11
NZ_CP050865	Escherichia coli strain 8-3-Ti3 chromosome, complete genome	4899869	4273780	4357743	4899869	tRNA,terminase,integrase,holin,transposase,protease,lysis,tail,portal	Enterobacteria_phage(62.5%)	75	4290564:4290584	4333728:4333748
WP_000968208.1|4273780_4274476_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_032358675.1|4274472_4274871_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_001264873.1|4275109_4276057_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000691708.1|4276429_4276513_-	protein YohP	NA	NA	NA	NA	NA
WP_167839359.1|4276646_4278173_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079521.1|4278225_4278987_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001296821.1|4279116_4279695_-	DedA family protein	NA	NA	NA	NA	NA
WP_001295454.1|4279864_4280452_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_001295432.1|4280625_4281558_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_073840589.1|4281596_4283312_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_032358679.1|4283507_4285805_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_167839360.1|4286015_4286933_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000221808.1|4286939_4288097_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569358.1|4288089_4289016_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G9BWD6	Planktothrix_phage	34.6	9.7e-24
WP_000783120.1|4289020_4289752_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4289732_4289840_-	protein YohO	NA	NA	NA	NA	NA
WP_029208330.1|4289899_4290601_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.0e-102
4290564:4290584	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063647.1|4290621_4291908_-|integrase	site-specific integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	99.1	2.5e-251
WP_167839310.1|4292372_4292609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001197745.1|4295032_4295209_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	85.7	1.5e-23
WP_001300492.1|4295230_4295590_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001141116.1|4295591_4295879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072147912.1|4295843_4296797_+	peptidase	NA	K7PLX4	Enterobacteria_phage	65.6	1.7e-103
WP_000618005.1|4296793_4297027_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	52.8	1.7e-14
WP_085948186.1|4297277_4298434_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_039072146.1|4299228_4300107_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.8	7.0e-141
WP_152066920.1|4300103_4301495_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	95.7	3.6e-256
WP_001064799.1|4301491_4301749_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	93.8	1.1e-33
WP_000111769.1|4301843_4302044_+	protein ninH	NA	A0A088CC23	Shigella_phage	74.2	1.1e-20
WP_000839570.1|4303219_4303435_+|holin	holin	holin	M1FN85	Enterobacteria_phage	95.8	1.0e-32
WP_001300760.1|4303438_4304068_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	56.9	3.6e-30
WP_001274722.1|4304133_4304667_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	1.6e-100
WP_000952382.1|4304850_4306023_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
WP_000544828.1|4306022_4306820_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
WP_167839497.1|4306851_4307256_+|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	92.0	1.0e-54
WP_004996416.1|4307458_4308055_+	hypothetical protein	NA	Q9B021	Phage_GMSE-1	65.0	5.1e-18
WP_000187853.1|4308051_4308264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205133.1|4308362_4308539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373425.1|4308896_4309391_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_073840795.1|4309390_4311493_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	94.1	0.0e+00
WP_096854639.1|4311489_4311702_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	87.1	1.1e-26
WP_073849815.1|4311701_4313207_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	87.8	2.4e-258
WP_167839361.1|4313151_4315212_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	93.7	0.0e+00
WP_001097044.1|4315298_4315622_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	97.2	2.7e-50
WP_001283156.1|4315614_4315890_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.9e-44
WP_000677136.1|4315901_4316486_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	89.2	7.6e-91
WP_073840798.1|4316482_4316884_+|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	97.7	1.2e-71
WP_073840799.1|4316894_4317635_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	94.7	9.2e-126
WP_000478927.1|4317693_4318080_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	92.2	1.4e-61
WP_001161009.1|4318088_4318418_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_073849553.1|4318389_4321431_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	85.6	0.0e+00
WP_000447385.1|4321430_4321760_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	93.5	2.9e-55
WP_001152598.1|4321759_4322458_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.1	1.5e-125
WP_000194736.1|4322462_4323206_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	3.0e-145
WP_000090878.1|4323142_4323745_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.1	7.3e-89
WP_167839362.1|4323805_4327285_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.4	0.0e+00
WP_001233104.1|4327352_4327952_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	3.6e-104
WP_167839378.1|4328015_4329431_+|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	45.1	8.6e-48
WP_000551126.1|4329381_4330005_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.5	5.4e-79
WP_005136793.1|4330184_4331828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122999955.1|4332143_4332812_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001261936.1|4333253_4333502_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	97.6	4.1e-38
WP_001295431.1|4334016_4335702_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
4333728:4333748	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|4335698_4336418_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|4336464_4336935_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|4336974_4337436_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_073849644.1|4337560_4339561_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_167839364.1|4339557_4340694_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
WP_001111632.1|4342498_4343689_-|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
WP_073840948.1|4343739_4344270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073849756.1|4344280_4345369_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636939.1|4345674_4345992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111632.1|4346680_4347871_+|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
WP_073841061.1|4347867_4350990_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_073849807.1|4355709_4357743_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.8	1.4e-54
>prophage 12
NZ_CP050865	Escherichia coli strain 8-3-Ti3 chromosome, complete genome	4899869	4379120	4420172	4899869	plate,tRNA,terminase,integrase,holin,head,transposase,capsid,lysis,tail,portal	Escherichia_phage(41.46%)	47	4384209:4384235	4415848:4415874
WP_001111632.1|4379120_4380311_-|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
WP_000844219.1|4380426_4381467_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|4381566_4382346_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807361.1|4382427_4383327_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001318299.1|4383731_4384049_+	hypothetical protein	NA	NA	NA	NA	NA
4384209:4384235	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_089583656.1|4384314_4385328_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	8.3e-194
WP_001306384.1|4385443_4385743_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|4385857_4386133_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|4386143_4386314_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217671.1|4386310_4386811_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_000557703.1|4386874_4387099_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001512913.1|4387098_4387401_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	95.0	1.2e-44
WP_001113271.1|4387400_4387625_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	97.3	8.5e-35
WP_000027674.1|4387621_4387897_+	DUF5405 family protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
WP_167839366.1|4390131_4391379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021577682.1|4391365_4393198_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000038165.1|4393543_4394578_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	4.2e-201
WP_130061326.1|4394577_4396350_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
WP_001512805.1|4396523_4397378_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_167839367.1|4397436_4398510_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.2	6.3e-200
WP_001593490.1|4398513_4399257_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	99.2	3.5e-125
WP_000988633.1|4399356_4399866_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|4399865_4400069_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|4400072_4400354_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|4400353_4400851_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_167839368.1|4400865_4401291_+	protein lysA	NA	U5N096	Enterobacteria_phage	96.5	2.1e-58
WP_023281159.1|4401278_4401704_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	97.2	3.2e-67
WP_023281163.1|4401811_4402279_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.1	1.3e-80
WP_001001780.1|4402271_4402724_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_053921172.1|4402790_4403426_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	1.5e-113
WP_000127164.1|4403422_4403770_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121478.1|4403774_4404683_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
WP_020240769.1|4404675_4405206_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	99.4	1.5e-101
WP_000104730.1|4405216_4407427_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	93.5	0.0e+00
WP_001164090.1|4407430_4407958_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	95.4	6.2e-92
WP_001286744.1|4409143_4410334_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	4.0e-224
WP_001251414.1|4410346_4410865_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	98.8	2.7e-92
WP_001031307.1|4410921_4411197_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|4411229_4411349_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_167839369.1|4411341_4413789_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	98.2	0.0e+00
WP_000978883.1|4413803_4414283_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	4.3e-84
WP_167839370.1|4414282_4415446_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	1.8e-205
WP_000468308.1|4415527_4415746_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|4416018_4417380_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
4415848:4415874	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000929408.1|4417526_4417859_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|4418049_4418772_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675150.1|4418768_4420172_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 13
NZ_CP050865	Escherichia coli strain 8-3-Ti3 chromosome, complete genome	4899869	4549057	4626312	4899869	plate,terminase,integrase,head,transposase,capsid,tail,portal	Enterobacteria_phage(60.47%)	90	4572747:4572806	4621739:4623003
WP_073840510.1|4549057_4550266_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	7.0e-208
WP_000334599.1|4550305_4550977_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	2.1e-81
WP_000790504.1|4551083_4551317_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000118901.1|4551313_4552519_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_001295642.1|4552705_4553119_+	lipoprotein	NA	NA	NA	NA	NA
WP_001245699.1|4553152_4554640_-	alpha-amylase	NA	NA	NA	NA	NA
WP_001015022.1|4554717_4555083_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000270663.1|4555082_4555493_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000146781.1|4555517_4556924_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000079722.1|4557189_4558947_+	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_001087467.1|4559266_4559986_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_032359814.1|4560031_4560583_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_001295643.1|4560670_4561471_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032359813.1|4561575_4562562_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001158220.1|4562576_4563245_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001272994.1|4563241_4563994_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	41.4	6.0e-32
WP_000106474.1|4565789_4566014_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_000590347.1|4566000_4566177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611335.1|4566472_4567129_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_001283421.1|4567125_4568958_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_001160187.1|4569014_4569563_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000157344.1|4570252_4570633_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_073840871.1|4570632_4571259_-	iron-sulfur cluster assembly scaffold protein SufA	NA	NA	NA	NA	NA
WP_000078917.1|4571558_4571699_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	3.5e-18
WP_000488107.1|4571890_4572151_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
4572747:4572806	attL	CTGAGGTAGCCTGAGTTTAACGGACACTCCTTCCTGAAATAGAATGGCATCAGAAGGAGC	NA	NA	NA	NA
WP_085948186.1|4572811_4573967_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_167839373.1|4573964_4574570_-	late control protein D	NA	A0A0A7NQ97	Enterobacteria_phage	95.7	2.8e-96
WP_000005455.1|4574727_4575912_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.2	1.6e-220
WP_073820629.1|4575911_4576424_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	6.0e-92
WP_073820627.1|4576478_4576844_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	95.9	1.6e-54
WP_000333495.1|4576852_4577008_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_134889557.1|4576994_4579802_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.1	0.0e+00
WP_073820621.1|4579814_4580303_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.1	6.1e-86
WP_073820653.1|4580312_4580504_+|tail	phage tail protein	tail	A0A222YXY8	Escherichia_phage	100.0	4.1e-22
WP_073820619.1|4580532_4581060_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	100.0	7.8e-95
WP_073849660.1|4581061_4583098_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	77.7	0.0e+00
WP_000071707.1|4583100_4583631_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	95.7	1.2e-90
WP_001756433.1|4583623_4584520_-|plate	baseplate J-like family protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.0	1.2e-156
WP_000213442.1|4584523_4584874_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	96.6	1.9e-57
WP_073849659.1|4584870_4585452_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	94.8	2.2e-98
WP_000356353.1|4585448_4586084_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	3.4e-113
WP_000920573.1|4586076_4586544_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	1.7e-85
WP_000868436.1|4586615_4587089_-	hypothetical protein	NA	A0A0A7NPY2	Enterobacteria_phage	38.9	1.3e-13
WP_032156155.1|4587085_4587631_-	lysozyme	NA	A0A0H4TH14	Yersinia_phage	42.5	2.2e-28
WP_000256050.1|4587614_4587917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052979930.1|4587910_4588108_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	95.4	1.8e-28
WP_000063076.1|4588107_4588602_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	9.2e-90
WP_000632369.1|4588703_4589504_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	85.7	3.7e-120
WP_001055080.1|4589549_4590602_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	96.0	5.2e-191
WP_021573190.1|4590625_4591462_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.6	1.5e-148
WP_000613763.1|4591616_4593368_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	99.0	0.0e+00
WP_000087812.1|4593367_4594414_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000071295.1|4595105_4595345_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	82.3	7.5e-29
WP_000759756.1|4595341_4595866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167839374.1|4595926_4596238_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	79.6	2.6e-37
WP_073849657.1|4596242_4597202_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	3.2e-179
WP_167839375.1|4597278_4600119_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	85.3	0.0e+00
WP_000567052.1|4600115_4600505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072121019.1|4600501_4601119_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	39.8	1.7e-08
WP_167839376.1|4601128_4601683_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000216188.1|4601673_4601985_-	DUF4406 domain-containing protein	NA	O64365	Escherichia_phage	56.2	2.6e-21
WP_001300412.1|4601981_4602944_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	46.0	2.6e-64
WP_000801171.1|4602940_4603180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152075469.1|4603176_4603707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609702.1|4603944_4604367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001011823.1|4604434_4604650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001225585.1|4604655_4604898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|4605310_4605514_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_134889554.1|4605585_4605681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052987430.1|4605796_4606210_+	helix-turn-helix transcriptional regulator	NA	A4JWR8	Burkholderia_virus	40.2	1.3e-12
WP_000290340.1|4606228_4606876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052987431.1|4607081_4607339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005135673.1|4607365_4608367_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.6	3.4e-107
WP_000847902.1|4608723_4609389_+	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_000797573.1|4609450_4610662_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000377225.1|4610852_4611092_+	YecH family protein	NA	NA	NA	NA	NA
WP_000917208.1|4611129_4611627_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_001237866.1|4612573_4612897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723106.1|4613159_4613246_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_000082127.1|4613360_4613612_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_000179469.1|4613690_4614194_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_073849621.1|4614990_4615980_+	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_032360070.1|4616049_4617564_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_077897159.1|4617578_4618565_+	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_032360071.1|4618731_4619532_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_032360073.1|4619506_4620931_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_032360074.1|4620937_4621366_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_085948186.1|4621803_4622959_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001295647.1|4623412_4623763_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
4621739:4623003	attR	CTGAGGTAGCCTGAGTTTAACGGACACTCCTTCCTGAAATAGAATGGCATCAGAAGGAGCTAATAATGAGCAGAAAAACCCAACGTTACTCTAAAGAGTTCAAAGCCGAAGCTGTCAGAACGGTTCTTGAAAATCAACTTTCGATCAGTGAAGGCGCTTCCCGATTATCTCTTCCTGAAGGCACTTTAGGACAATGGGTTACCGCCGCCAGAAAAGGGCTCGGTACTCCTGGTTCCCGCACGGTGGCTGAACTGGAATCTGAAATTCTGCAACTGCGTAAGGCGTTAAATGAAGCTCGCCTTGAGCGAGATATATTAAAAAAAGCAACAGCGTATTTTGCACAGGAGTCGCTGAAAAATACGCGTTAATCGAACAATGGCGACAACAATTTCCCATTGAAGCGATGTGTCAGGTATTTGGTGTATCCAGGAGCGGTTATTACAACTGGGTACAGCATGAACCCTCAGACAGAAAACAAAGTGATGAGCGGCTAAAACTGGAGATTAAGGTGGCACATATCCGCACTCGCGAAACATATGGAACCCGGCGGCTCCAGACGGAGCTGGCAGAGAATGGCATCATCGTTGGTCGTGACCGACTGGCACGTCTTCGTAAGGAGCTAAGGCTACGCTGTAAGCAGAAACGCAAGTTCAGAGCGACTACGAACTCGAACCACAATCTGCCAGTTGCGCCAAATCTGCTGAACCAGACGTTCGCTCCTACAGCACCAAATCAGGTCTGGGTGGCGGACCTGACGTATGTTGCCACACAGGAGGGATGGTTGTACCTCGCTGGCATCAAAGATGTTTATACGTGCGAAATTGTCGGCTACGCCATGGGAGAGCGCATGACAAAAGAGCTGACAGGTAAAGCCCTGTTTATGGCGCTCAGGAGCCAGCGCCCACCTGCCGGGCTAATCCACCACTCTGATCGAGGTTCACAGTACTGCGCATACGATTACCGGGTCATACAGGAGCAGTTTGGTCTGAAAACATCAATGTCGCGTAAAGGTAACTGTTACGACAACGCTCCGATGGAAAGCTTCTGGGGAACGCTGAAAAATGAGAGCCTGAGCCACTATCGTTTTAATAACCGGGATGAAGCCATCTCAGTAATACGGGAATACATTGAGATTTTCTACAATCGTCAGCGTCGTCACTCTCGTCTGGGGAATATCTCCCCGGCAGCCTTCAGGGAAAAATATCATCAGATGGCTGCTTAAAAAAAGAACAAATGGTAGTGTCCGCTATTGCCAGTACACCTCA	NA	NA	NA	NA
WP_001111632.1|4625121_4626312_-|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
>prophage 14
NZ_CP050865	Escherichia coli strain 8-3-Ti3 chromosome, complete genome	4899869	4637982	4764083	4899869	tRNA,terminase,integrase,holin,transposase,capsid,protease,lysis,tail,portal	Enterobacteria_phage(27.27%)	132	4655381:4655440	4743685:4744950
WP_000878026.1|4637982_4639002_-|transposase	IS110-like element ISEc11 family transposase	transposase	NA	NA	NA	NA
WP_032359432.1|4640082_4641888_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001259583.1|4641887_4642280_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_032359433.1|4643176_4643665_-	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_023308062.1|4643841_4645575_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
WP_001300190.1|4645790_4646357_+	VOC family protein	NA	NA	NA	NA	NA
WP_032294177.1|4646370_4647117_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214312.1|4647504_4648605_+	cytochrome c	NA	NA	NA	NA	NA
WP_073849799.1|4648629_4651059_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564746.1|4651223_4652195_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|4652191_4652935_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|4652975_4653371_-	membrane protein	NA	NA	NA	NA	NA
WP_046880181.1|4653423_4654194_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
4655381:4655440	attL	TTGAGGTAGCCTGAGTTTAACGGACACTCCTTCCTGAAATAGAATGGCATCAGAAGGAGC	NA	NA	NA	NA
WP_085948186.1|4655445_4656601_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000867913.1|4656710_4657004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001197745.1|4657851_4658028_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	85.7	1.5e-23
WP_001300492.1|4658049_4658409_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001141116.1|4658410_4658698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072147912.1|4658662_4659616_+	peptidase	NA	K7PLX4	Enterobacteria_phage	65.6	1.7e-103
WP_000618005.1|4659612_4659846_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	52.8	1.7e-14
WP_001247839.1|4659832_4660741_+	hypothetical protein	NA	Q8W642	Enterobacteria_phage	97.4	2.0e-61
WP_039072146.1|4660751_4661630_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.8	7.0e-141
WP_152066920.1|4661626_4663018_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	95.7	3.6e-256
WP_001064800.1|4663014_4663272_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	95.0	4.9e-34
WP_001215511.1|4663271_4663646_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.3	4.9e-35
WP_000762890.1|4663642_4664464_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	6.1e-78
WP_000871291.1|4665058_4665394_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874243.1|4665654_4665843_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001323614.1|4665839_4666001_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	91.3	5.4e-15
WP_005014140.1|4666150_4666366_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	97.2	7.7e-33
WP_000193253.1|4666370_4666901_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	52.6	3.7e-36
WP_001101166.1|4667222_4667756_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.2e-98
WP_001300378.1|4667976_4668090_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	97.3	8.7e-12
WP_073840897.1|4668091_4668529_+|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	89.7	1.5e-62
WP_001028468.1|4668731_4669253_+	DNA-binding protein	NA	H6WRZ8	Salmonella_phage	99.4	7.2e-101
WP_001205133.1|4669392_4669569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373425.1|4669926_4670421_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_073840795.1|4670420_4672523_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	94.1	0.0e+00
WP_096854639.1|4672519_4672732_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	87.1	1.1e-26
WP_073849815.1|4672731_4674237_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	87.8	2.4e-258
WP_167839361.1|4674181_4676242_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	93.7	0.0e+00
WP_001097044.1|4676328_4676652_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	97.2	2.7e-50
WP_001283156.1|4676644_4676920_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.9e-44
WP_000677136.1|4676931_4677516_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	89.2	7.6e-91
WP_073840798.1|4677512_4677914_+|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	97.7	1.2e-71
WP_073840799.1|4677924_4678665_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	94.7	9.2e-126
WP_085948186.1|4678882_4680039_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001161009.1|4680385_4680715_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_085948186.1|4682801_4683958_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000447385.1|4684994_4685324_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	93.5	2.9e-55
WP_001152598.1|4685323_4686022_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.1	1.5e-125
WP_000194736.1|4686026_4686770_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	3.0e-145
WP_000090878.1|4686706_4687309_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.1	7.3e-89
WP_073850003.1|4690863_4691463_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.0	1.4e-103
WP_000952382.1|4691574_4692747_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
WP_000544828.1|4692746_4693544_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
WP_167839378.1|4693660_4695076_+|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	45.1	8.6e-48
WP_134889552.1|4695026_4695650_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	77.5	6.4e-80
WP_134889547.1|4695829_4697581_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_000140459.1|4697829_4699026_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001217553.1|4699630_4699879_-	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_073849802.1|4700233_4700773_-	hydrolase	NA	NA	NA	NA	NA
WP_032359833.1|4701082_4702855_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001300367.1|4702972_4703425_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907248.1|4703453_4704194_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|4704228_4704750_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024929.1|4704751_4705354_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_073841050.1|4705423_4705501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|4706404_4707016_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|4707024_4708035_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571464.1|4708084_4708870_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|4708866_4709622_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|4709700_4710633_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_167839379.1|4710648_4711971_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448381.1|4712090_4713062_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091148.1|4713192_4714635_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056694.1|4714762_4715632_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_032359397.1|4715969_4717445_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001687627.1|4717679_4719491_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|4719527_4720169_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_032359393.1|4720224_4721403_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257738.1|4721536_4721827_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|4721893_4722250_+	protein YebF	NA	NA	NA	NA	NA
WP_032359392.1|4722576_4723236_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_167839380.1|4723444_4725505_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944256.1|4725501_4726164_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_032359391.1|4726187_4726844_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|4726945_4727176_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_066018956.1|4727314_4727689_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879298.1|4727692_4728565_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_073849646.1|4728577_4728919_+	YebY family protein	NA	NA	NA	NA	NA
WP_052993702.1|4729300_4730377_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	8.2e-99
WP_005127484.1|4730342_4730624_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.4	9.8e-12
WP_000276808.1|4730730_4730919_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	95.2	6.1e-26
WP_001336454.1|4732712_4732931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000935258.1|4733133_4733346_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_000929754.1|4733513_4733792_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	43.8	2.4e-10
WP_001265248.1|4733793_4734852_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	2.6e-89
WP_073849795.1|4734852_4735218_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.3	9.3e-39
WP_032359563.1|4735214_4735898_+	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	8.9e-59
WP_000839570.1|4736698_4736914_+|holin	holin	holin	M1FN85	Enterobacteria_phage	95.8	1.0e-32
WP_032359927.1|4736913_4737411_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	97.6	1.4e-90
WP_000092288.1|4737407_4737878_+|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	93.5	1.4e-71
WP_011069285.1|4737966_4738479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118113.1|4738673_4739438_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	53.8	5.9e-11
WP_001300443.1|4739388_4740792_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	1.2e-187
WP_000113499.1|4740791_4742258_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.2	3.3e-260
WP_000184977.1|4742148_4742892_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	84.4	5.3e-89
WP_085948186.1|4743749_4744905_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001066732.1|4745386_4745893_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.9	3.7e-70
4743685:4744950	attR	TTGAGGTAGCCTGAGTTTAACGGACACTCCTTCCTGAAATAGAATGGCATCAGAAGGAGCTAATAATGAGCAGAAAAACCCAACGTTACTCTAAAGAGTTCAAAGCCGAAGCTGTCAGAACGGTTCTTGAAAATCAACTTTCGATCAGTGAAGGCGCTTCCCGATTATCTCTTCCTGAAGGCACTTTAGGACAATGGGTTACCGCCGCCAGAAAAGGGCTCGGTACTCCTGGTTCCCGCACGGTGGCTGAACTGGAATCTGAAATTCTGCAACTGCGTAAGGCGTTAAATGAAGCTCGCCTTGAGCGAGATATATTAAAAAAAGCAACAGCGTATTTTGCACAGGAGTCGCTGAAAAATACGCGTTAATCGAACAATGGCGACAACAATTTCCCATTGAAGCGATGTGTCAGGTATTTGGTGTATCCAGGAGCGGTTATTACAACTGGGTACAGCATGAACCCTCAGACAGAAAACAAAGTGATGAGCGGCTAAAACTGGAGATTAAGGTGGCACATATCCGCACTCGCGAAACATATGGAACCCGGCGGCTCCAGACGGAGCTGGCAGAGAATGGCATCATCGTTGGTCGTGACCGACTGGCACGTCTTCGTAAGGAGCTAAGGCTACGCTGTAAGCAGAAACGCAAGTTCAGAGCGACTACGAACTCGAACCACAATCTGCCAGTTGCGCCAAATCTGCTGAACCAGACGTTCGCTCCTACAGCACCAAATCAGGTCTGGGTGGCGGACCTGACGTATGTTGCCACACAGGAGGGATGGTTGTACCTCGCTGGCATCAAAGATGTTTATACGTGCGAAATTGTCGGCTACGCCATGGGAGAGCGCATGACAAAAGAGCTGACAGGTAAAGCCCTGTTTATGGCGCTCAGGAGCCAGCGCCCACCTGCCGGGCTAATCCACCACTCTGATCGAGGTTCACAGTACTGCGCATACGATTACCGGGTCATACAGGAGCAGTTTGGTCTGAAAACATCAATGTCGCGTAAAGGTAACTGTTACGACAACGCTCCGATGGAAAGCTTCTGGGGAACGCTGAAAAATGAGAGCCTGAGCCACTATCGTTTTAATAACCGGGATGAAGCCATCTCAGTAATACGGGAATACATTGAGATTTTCTACAATCGTCAGCGTCGTCACTCTCGTCTGGGGAATATCTCCCCGGCAGCCTTCAGGGAAAAATATCATCAGATGGCTGCTTAAAAAAAGAACAAATGGTAGTGTCCGCTATTGCCAGTACACCTCAC	NA	NA	NA	NA
WP_000627472.1|4745904_4746846_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.6	1.8e-155
WP_162147612.1|4746842_4747076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073840768.1|4747074_4747482_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.1	5.7e-69
WP_000008721.1|4747478_4748033_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	71.7	4.7e-66
WP_001142480.1|4748019_4748409_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	2.5e-66
WP_000503649.1|4748383_4748947_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.1	6.4e-79
WP_073840769.1|4748950_4750096_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.2	3.4e-159
WP_000109251.1|4750106_4750547_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
WP_000393947.1|4750550_4751003_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	73.8	4.0e-55
WP_073840770.1|4751180_4753133_+	lytic transglycosylase catalytic	NA	A0A0M4REK7	Salmonella_phage	63.3	5.5e-162
WP_000346976.1|4753132_4753783_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	65.3	1.8e-61
WP_000648662.1|4753786_4754089_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	5.7e-26
WP_000042295.1|4754091_4755132_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	52.7	1.3e-98
WP_000719142.1|4756179_4756521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001145369.1|4756629_4757382_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	64.0	3.7e-90
WP_001270635.1|4757381_4757735_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	1.2e-54
WP_073840772.1|4757763_4758960_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.0	6.6e-182
WP_038341129.1|4758956_4759637_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_073840773.1|4759636_4760893_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	65.8	4.7e-114
WP_167839381.1|4760948_4761185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001343146.1|4762240_4763509_+|tail	tail protein	tail	Q8W611	Enterobacteria_phage	42.9	8.8e-76
WP_000551126.1|4763459_4764083_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.5	5.4e-79
>prophage 1
NZ_CP050866	Escherichia coli strain 8-3-Ti3 plasmid unnamed1, complete sequence	233800	1954	85139	233800	protease,transposase	Escherichia_phage(50.0%)	53	NA	NA
WP_073849842.1|1954_3142_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_077897189.1|3141_3507_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019158.1|4955_5228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167839512.1|6131_6976_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	49.1	2.2e-22
WP_038341697.1|7400_8855_+	type 3 secretion system effector OspC2	NA	NA	NA	NA	NA
WP_000198523.1|9303_10512_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000019158.1|10492_10765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073849842.1|11116_12304_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_077897189.1|12303_12669_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011378983.1|14666_14804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005005342.1|15765_16713_+|protease	omptin family outer membrane protease IcsP	protease	NA	NA	NA	NA
WP_001046939.1|18259_19126_+	type 3 secretion system effector OspB	NA	A0A0P0ZCT1	Stx2-converting_phage	32.7	9.4e-29
WP_000850660.1|19454_20195_+	phosphatase PAP2 family protein	NA	A0A1B1IUP6	uncultured_Mediterranean_phage	28.9	2.6e-11
WP_073691583.1|20295_20478_-	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	86.0	5.5e-16
WP_004976019.1|24281_25991_-	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_001121865.1|26422_27142_-	type III secretion system effector phosphothreonine lyase	NA	NA	NA	NA	NA
WP_000868562.1|28152_28731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000026472.1|32452_33130_+	type 3 secretion system effector OspD1	NA	NA	NA	NA	NA
WP_011114726.1|33641_33956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000901798.1|34237_34804_+	type III secretion effector IpgB2	NA	NA	NA	NA	NA
WP_005031026.1|36672_37695_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	97.4	2.6e-195
WP_000200287.1|39200_40400_+	ParA family protein	NA	Q71TL9	Escherichia_phage	75.1	2.0e-175
WP_000431558.1|40399_41380_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	58.2	5.0e-95
WP_073849729.1|42409_43588_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-28
WP_072147963.1|43637_44057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011310396.1|45590_47315_-	T3SS effector E3 ubiquitin-protein ligase IpaH4.5	NA	NA	NA	NA	NA
WP_010921637.1|47742_49440_-	T3SS effector E3 ubiquitin-protein ligase IpaH7.8	NA	NA	NA	NA	NA
WP_073804581.1|50844_51876_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_094110422.1|51990_52835_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_167839513.1|53011_54220_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_073861145.1|54200_54473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167839514.1|54551_54779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000597727.1|55541_57269_-	T3SS effector E3 ubiquitin-protein ligase IpaH1.4	NA	NA	NA	NA	NA
WP_011114782.1|58576_58729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000957844.1|61011_61200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139266572.1|64123_64534_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	96.3	9.1e-51
WP_005116773.1|64475_65264_-	AraC family invasion system transcriptional regulator VirF	NA	NA	NA	NA	NA
WP_001063816.1|65762_66890_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_000957713.1|67786_68053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140459.1|68423_69620_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000483533.1|70084_70396_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	95.1	5.0e-49
WP_000865087.1|70395_70683_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	88.4	1.7e-40
WP_073849842.1|71221_72409_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_077897189.1|72408_72774_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000174726.1|72792_73188_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	40.4	3.1e-11
WP_001224621.1|74339_75215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000981089.1|75222_75999_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_038339555.1|76167_78429_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001020414.1|78497_79673_+	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_000019158.1|82536_82809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001146936.1|82994_83339_+	addiction module killer protein	NA	A0A141GEX6	Brucella_phage	44.3	4.5e-11
WP_000127482.1|83325_83676_+	addiction module antitoxin	NA	NA	NA	NA	NA
WP_167839515.1|83930_85139_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP050866	Escherichia coli strain 8-3-Ti3 plasmid unnamed1, complete sequence	233800	88791	129279	233800	integrase,protease,transposase	Stx2-converting_phage(25.0%)	32	81374:81418	106671:106715
81374:81418	attL	ACCGCCCCCGGTATCCCGCTCATGCTGGCGAACCCAGACACGCAG	NA	NA	NA	NA
WP_000063140.1|88791_89478_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	3.5e-55
WP_032334832.1|89770_90553_+	DUF3100 domain-containing protein	NA	NA	NA	NA	NA
WP_000351991.1|90568_91027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073849670.1|91042_92212_+	amidohydrolase	NA	NA	NA	NA	NA
WP_000753476.1|93730_94222_+	F4 (K88) fimbria minor subunit FaeF	NA	NA	NA	NA	NA
WP_167839516.1|94459_95260_+	cshE pilin	NA	NA	NA	NA	NA
WP_001346177.1|95480_96278_+	F4 (K88) fimbria minor subunit FaeH	NA	NA	NA	NA	NA
WP_000758117.1|96307_97060_+	F4 (K88) fimbria minor subunit FaeI	NA	NA	NA	NA	NA
WP_000017084.1|97384_98611_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.7	1.7e-60
WP_000502855.1|98595_99234_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	3.1e-53
WP_005038443.1|99872_100346_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_086020993.1|100785_101650_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	48.6	1.4e-19
WP_071587773.1|101837_102095_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_001026854.1|102992_104405_+	type 3 secretion system effector OspC1	NA	NA	NA	NA	NA
WP_001343187.1|104733_106431_+	type III secretion system effector OspD3	NA	NA	NA	NA	NA
WP_000019158.1|106833_107106_+	hypothetical protein	NA	NA	NA	NA	NA
106671:106715	attR	ACCGCCCCCGGTATCCCGCTCATGCTGGCGAACCCAGACACGCAG	NA	NA	NA	NA
WP_088895425.1|107226_108454_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_042189544.1|108461_109631_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000544828.1|111487_112285_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
WP_000952382.1|112284_113457_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
WP_000501969.1|115006_115492_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011114751.1|115479_115764_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_001346193.1|116665_116830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004967149.1|117083_118685_-|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.5	4.9e-148
WP_089519923.1|118704_118887_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	71.2	2.5e-16
WP_000878026.1|119200_120220_-|transposase	IS110-like element ISEc11 family transposase	transposase	NA	NA	NA	NA
WP_004967157.1|120529_121204_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_000701114.1|121575_123030_+	T3SS effector OspC family protein	NA	NA	NA	NA	NA
WP_134889401.1|123368_124524_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	8.9e-67
WP_000140459.1|124754_125951_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000255972.1|126142_127147_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.1	5.3e-185
WP_005059304.1|128499_129279_+|protease	type III secretion system effector cysteine protease IpaJ	protease	NA	NA	NA	NA
