The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048761	Campylobacter jejuni strain ZS004 chromosome, complete genome	1665977	354445	407097	1665977	tail,transposase,plate,terminase,tRNA,integrase	Campylobacter_phage(53.12%)	68	353201:353220	414737:414756
353201:353220	attL	GGAAAATCAAGTCTTTTAAA	NA	NA	NA	NA
WP_052782157.1|354445_355405_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002858681.1|355415_356651_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.0	1.1e-86
WP_052797833.1|356660_359123_+	motility protein PflB	NA	NA	NA	NA	NA
WP_070301795.1|359153_359789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167844321.1|359886_361329_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_002895442.1|361377_362724_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002860273.1|362842_363472_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_087692111.1|363458_363749_-	tram-like protein	NA	NA	NA	NA	NA
WP_167842667.1|363745_364744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167842668.1|364740_365319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002858734.1|365462_365747_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_002869932.1|365812_366376_+	CvpA family protein	NA	NA	NA	NA	NA
WP_002854230.1|366377_366851_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_002858694.1|366851_368357_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.2	5.7e-90
WP_052793924.1|368353_369598_+	serine hydroxymethyltransferase	NA	A0A219YB23	Aeromonas_phage	51.7	1.6e-101
WP_002859481.1|369594_370140_+	DUF1882 domain-containing protein	NA	NA	NA	NA	NA
WP_002869928.1|370153_370990_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_052782166.1|370986_371775_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002872729.1|372325_373345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167844322.1|373463_374093_+	S24 family peptidase	NA	A7YG70	Campylobacter_phage	94.7	2.2e-56
WP_002865000.1|374173_374494_+	hypothetical protein	NA	A7YGI4	Campylobacter_phage	100.0	1.3e-52
WP_167844323.1|374503_374698_+	hypothetical protein	NA	A7YG72	Campylobacter_phage	98.4	3.9e-28
WP_002865289.1|374777_375065_+	hypothetical protein	NA	A7YGG4	Campylobacter_phage	100.0	1.9e-47
WP_052823652.1|375094_375910_-	DNA adenine methylase	NA	A7YGG5	Campylobacter_phage	99.6	3.1e-151
WP_002875578.1|376013_376502_-	virion morphogenesis protein	NA	A7YG96	Campylobacter_phage	100.0	1.6e-89
WP_167844324.1|376505_378728_-|tail	phage tail tape measure protein	tail	A7YG97	Campylobacter_phage	99.7	0.0e+00
WP_002784655.1|378769_379075_+	hypothetical protein	NA	A7YG98	Campylobacter_phage	100.0	4.7e-36
WP_167844325.1|379186_379426_-|tail	phage tail assembly protein	tail	A7YGZ3	Campylobacter_phage	60.9	7.0e-11
WP_002865376.1|379578_380088_-|tail	tail protein	tail	A7YG76	Campylobacter_phage	100.0	3.3e-90
WP_167844326.1|380114_381308_-|tail	phage tail sheath family protein	tail	A7YGY2	Campylobacter_phage	98.2	3.2e-197
WP_167844327.1|381326_382334_-	hypothetical protein	NA	A7YGT6	Campylobacter_phage	99.1	4.2e-190
WP_002909498.1|382433_382805_-	DUF1353 domain-containing protein	NA	A7YGA5	Campylobacter_phage	99.2	3.3e-68
WP_002878909.1|382801_383308_-	DUF4376 domain-containing protein	NA	A7YGK2	Campylobacter_phage	100.0	2.0e-87
WP_052782952.1|383332_384364_-|tail	phage tail protein	tail	A7YGK4	Campylobacter_phage	100.0	8.1e-189
WP_002878911.1|384363_384984_-|tail	phage tail protein I	tail	A7YH02	Campylobacter_phage	96.6	2.8e-59
WP_002878912.1|384980_386147_-|plate	baseplate assembly protein	plate	A0A1X9SH02	Bradyrhizobium_phage	25.8	3.3e-13
WP_002795239.1|386143_386434_-|plate	baseplate assembly protein	plate	Q8H9N4	Vibrio_phage	40.8	2.7e-09
WP_002795238.1|386430_386622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032582447.1|386630_387263_-|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	34.6	1.7e-08
WP_002784492.1|387262_387577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784496.1|387688_387937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002854893.1|387933_388275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021034186.1|388285_388675_-	DUF882 domain-containing protein	NA	A0A1X9Q0V8	Human_gokushovirus	46.7	1.7e-22
WP_002784501.1|388823_389258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002876306.1|389259_390075_+	hypothetical protein	NA	A0A2H4JAW3	uncultured_Caudovirales_phage	48.4	2.9e-24
WP_002784505.1|390077_390605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002865469.1|390607_391585_+	hypothetical protein	NA	R9TRN2	Rhizobium_phage	23.4	3.3e-06
WP_002855185.1|391700_392159_+	DUF1320 family protein	NA	NA	NA	NA	NA
WP_002803360.1|392151_392751_+	DUF1804 family protein	NA	NA	NA	NA	NA
WP_167844328.1|392863_394420_+|terminase	phage terminase large subunit	terminase	A0A076FR23	Pseudomonas_phage	42.8	2.8e-92
WP_167844329.1|394429_395800_+	DUF935 family protein	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	26.6	4.5e-17
WP_002865473.1|395801_397040_+	hypothetical protein	NA	A0A0A1IX74	Pseudomonas_phage	28.4	9.6e-19
WP_002784519.1|397164_397539_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002791401.1|397531_397723_+|tail	tail protein	tail	NA	NA	NA	NA
WP_052782948.1|397716_398694_+|tail	phage tail protein	tail	A0A219Y9Y2	Aeromonas_phage	25.7	6.2e-13
WP_167844330.1|398663_399527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052782947.1|399498_399702_-	CJH_07325 family protein	NA	J9SI91	Campylobacter_phage	48.1	1.5e-06
WP_002784523.1|399822_400107_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_002803343.1|400173_400611_-	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_167844331.1|400607_401300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167844332.1|401299_401569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167844333.1|401565_402528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002872701.1|402586_403072_-	host-nuclease inhibitor protein Gam	NA	A0A2K9VGT9	Faecalibacterium_phage	33.3	6.4e-19
WP_002791419.1|403178_403520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167844334.1|403652_403838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002791422.1|403834_404026_-	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_167844335.1|404028_404952_-	AAA family ATPase	NA	A0A2H4JAW1	uncultured_Caudovirales_phage	24.5	3.9e-09
WP_052797570.1|405021_407097_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
414737:414756	attR	GGAAAATCAAGTCTTTTAAA	NA	NA	NA	NA
