The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050919	Lactobacillus fermentum strain HFD1 chromosome, complete genome	2101878	38882	154021	2101878	protease,transposase,tRNA,holin	Lactobacillus_phage(15.0%)	92	NA	NA
WP_035430860.1|38882_40976_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.3	1.5e-120
WP_160229816.1|41276_42737_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_168183352.1|43219_46957_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_168183353.1|46963_50977_+	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	22.4	3.3e-12
WP_012390675.1|50976_51840_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	46.4	4.3e-58
WP_168183354.1|52078_53704_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_003682345.1|53997_54354_-	arsenate reductase family protein	NA	NA	NA	NA	NA
WP_168183355.1|54392_55508_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_168183356.1|55500_56211_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	2.7e-26
WP_003682354.1|56566_57541_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	69.0	4.9e-135
WP_003685683.1|57737_59027_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.2	3.9e-71
WP_003685685.1|59353_60736_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003685686.1|61019_61559_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_003682363.1|61677_62409_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_168183357.1|62408_63035_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	38.1	4.8e-35
WP_114698759.1|63302_63701_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.1	1.2e-44
WP_168183358.1|63700_64876_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	54.4	2.4e-112
WP_021350374.1|65213_65606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015638436.1|65748_67287_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_024500604.1|67286_68783_+	accessory Sec system glycosyltransferase Asp1	NA	NA	NA	NA	NA
WP_114684122.1|69192_70035_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015638439.1|70060_71125_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	7.5e-28
WP_003682378.1|71117_71819_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_168183664.1|71944_73093_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_114684120.1|73392_74817_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.9	7.3e-71
WP_070447109.1|76233_77178_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_168183359.1|77295_78588_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_168183360.1|78600_78837_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_012390693.1|78866_80093_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	31.2	2.6e-24
WP_003682392.1|80092_81622_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	25.8	5.3e-35
WP_003682395.1|81636_81768_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_100352082.1|81993_83127_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_168183361.1|83123_86228_+	SMC family ATPase	NA	NA	NA	NA	NA
WP_003682400.1|86515_87814_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.8	6.2e-93
WP_168183362.1|87955_88411_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	3.6e-32
WP_054173696.1|88484_89735_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_168183363.1|90072_90999_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_086031824.1|92291_93578_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_048340426.1|93819_94833_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015638452.1|95090_96344_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.2	7.8e-85
WP_070446833.1|96811_98266_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_070446831.1|98269_99013_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.9	2.0e-32
WP_168183364.1|99333_100707_+	amino acid permease	NA	NA	NA	NA	NA
WP_160229828.1|101292_102216_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	3.9e-33
WP_107504371.1|102523_102613_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_070446795.1|103079_104459_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	49.9	3.9e-122
WP_114684423.1|104470_104665_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_151378529.1|106498_106915_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	71.8	1.8e-46
WP_003684331.1|106911_108075_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	71.7	1.8e-160
WP_070446803.1|108611_109811_+	nucleoside permease	NA	NA	NA	NA	NA
WP_003685735.1|110045_110966_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_168183665.1|111154_111892_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_003682414.1|111910_112846_+	nucleoid occlusion protein	NA	I3NLC2	Bifidobacterium_phage	33.6	6.2e-10
WP_168183365.1|112859_113693_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	33.5	1.8e-16
WP_168183366.1|113705_113906_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_003682418.1|113921_115019_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_168183367.1|115052_115826_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_003685751.1|116180_117323_+	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	32.4	5.7e-58
WP_168183368.1|117671_118673_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168183369.1|118672_119443_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_168183370.1|119459_120200_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_168183371.1|120226_120997_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_137876824.1|121092_121653_+	sugar transferase	NA	NA	NA	NA	NA
WP_084034357.1|121731_122565_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_168183372.1|122856_123699_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	97.5	7.7e-153
WP_168183373.1|123752_124004_-|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	6.0e-37
WP_168183374.1|124181_125216_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_168183375.1|125228_126308_+	EpsG family protein	NA	NA	NA	NA	NA
WP_168183376.1|126331_127030_+	hypothetical protein	NA	H2E9I3	Persea_americana_alphaendornavirus	33.8	1.8e-06
WP_168183377.1|127143_128289_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	97.9	6.5e-155
WP_168183378.1|129065_130532_+	flippase	NA	NA	NA	NA	NA
WP_168183379.1|131776_132742_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	42.9	8.9e-12
WP_168183380.1|132888_134001_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_168183381.1|134211_135399_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.3	3.4e-37
WP_168183382.1|136679_137432_+	glycosyl transferase	NA	L7RBS6	Acanthamoeba_polyphaga_moumouvirus	31.8	1.2e-08
WP_080965008.1|137492_138401_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	29.6	1.9e-11
WP_168183383.1|138337_139036_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	31.4	1.5e-21
WP_014562466.1|139562_140561_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_042513914.1|140754_142041_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_168183384.1|142229_142529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183385.1|142764_143301_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168183386.1|143297_144185_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	41.8	1.1e-32
WP_168183387.1|144255_144762_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_035437552.1|144958_145648_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.6	1.8e-35
WP_151130128.1|145845_146988_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	29.8	6.5e-30
WP_168183388.1|146987_148283_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_035437542.1|148616_149477_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003682463.1|149486_149906_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_138464601.1|150100_150472_+	esterase	NA	NA	NA	NA	NA
WP_003682466.1|150814_152002_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_168183389.1|152241_153492_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.0	1.3e-58
WP_054173697.1|153565_154021_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	8.1e-32
>prophage 2
NZ_CP050919	Lactobacillus fermentum strain HFD1 chromosome, complete genome	2101878	174704	209595	2101878	transposase	Lactobacillus_phage(25.0%)	27	NA	NA
WP_003684331.1|174704_175868_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	71.7	1.8e-160
WP_012390758.1|175864_176302_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	71.0	1.4e-49
WP_003682507.1|176516_177212_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_168183394.1|177336_178515_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003682509.1|178627_179632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015638511.1|180122_180494_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_048340198.1|180507_180816_+	copper-binding protein	NA	NA	NA	NA	NA
WP_070447065.1|180815_182747_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.6	2.7e-92
WP_070447063.1|182858_183224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682515.1|183271_183748_-	nucleoside deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	35.2	7.7e-17
WP_151130148.1|189596_190736_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	1.1e-42
WP_012391038.1|191517_192768_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_015638493.1|192841_193297_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	2.8e-32
WP_015638522.1|193863_194058_-	CsbD family protein	NA	NA	NA	NA	NA
WP_003684232.1|195026_196007_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015638518.1|196704_197361_-	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	25.5	9.3e-13
WP_070447091.1|197445_198099_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_111522993.1|198093_198483_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_083276522.1|198608_199244_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_003684235.1|200681_201668_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_083276525.1|201814_203689_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_151130148.1|203734_204874_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	1.1e-42
WP_168183666.1|204975_205476_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_168183395.1|205536_206388_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_168183396.1|206491_207679_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.8	2.2e-36
WP_168183397.1|207815_208271_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	3.6e-32
WP_012391038.1|208344_209595_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
>prophage 3
NZ_CP050919	Lactobacillus fermentum strain HFD1 chromosome, complete genome	2101878	683505	736348	2101878	protease,transposase	Paenibacillus_phage(18.75%)	47	NA	NA
WP_014562466.1|683505_684504_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_003682071.1|684574_684829_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_003682069.1|685074_685344_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_003684331.1|686066_687230_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	71.7	1.8e-160
WP_035430804.1|687831_689631_+	ribonuclease J	NA	NA	NA	NA	NA
WP_003682061.1|689721_690618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682059.1|690798_691989_+	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	28.0	6.6e-33
WP_003682058.1|692159_693467_+	trigger factor	NA	NA	NA	NA	NA
WP_003682055.1|693617_694868_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.1	3.7e-135
WP_012391020.1|694881_695475_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003682052.1|695474_695774_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	51.5	6.9e-24
WP_012391021.1|696040_696187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682049.1|696374_697121_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	1.4e-28
WP_003682047.1|697398_699210_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003682046.1|699274_700582_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003682045.1|700608_701541_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_003682044.1|701561_702401_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_168183435.1|702473_704771_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	2.6e-70
WP_003682042.1|704784_705312_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.0	2.3e-30
WP_003682041.1|705643_706021_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003682040.1|706100_707099_-	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	36.3	7.7e-51
WP_003682039.1|707600_708410_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_054173498.1|708994_709531_+	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_054173497.1|709541_709823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682030.1|709822_710152_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003682029.1|710499_710808_-	membrane protein	NA	NA	NA	NA	NA
WP_041812672.1|711509_711857_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	43.9	2.1e-11
WP_168183436.1|712007_713099_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_003682020.1|713357_713537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070446897.1|713903_714764_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_160229510.1|714763_715324_+	sugar O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	48.1	8.5e-07
WP_083276512.1|715390_715786_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_054173494.1|716293_717058_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_070446900.1|717173_718199_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_054173493.1|718453_719383_+	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
WP_070446902.1|719385_719997_+	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
WP_070446904.1|722942_723308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183437.1|723578_723947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183438.1|724072_725182_-	MFS transporter	NA	NA	NA	NA	NA
WP_127429221.1|725464_726370_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_021815645.1|726306_726921_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	38.0	9.6e-28
WP_003682012.1|727426_729016_-	asparagine synthase B	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	40.3	3.1e-102
WP_114684430.1|730050_731271_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.0	9.0e-94
WP_160229604.1|731655_732666_+	ADP-ribosylglycohydrolase family protein	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	22.7	9.0e-07
WP_054173488.1|732671_734030_+	allantoin permease	NA	NA	NA	NA	NA
WP_054173487.1|734030_734921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183439.1|735286_736348_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.6	5.9e-33
>prophage 4
NZ_CP050919	Lactobacillus fermentum strain HFD1 chromosome, complete genome	2101878	787962	848230	2101878	tRNA,transposase	Streptococcus_phage(31.25%)	55	NA	NA
WP_015638815.1|787962_788859_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_070447069.1|788869_789835_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_168183443.1|789949_791338_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_080963705.1|791456_792155_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	31.3	1.4e-22
WP_070446813.1|793386_794724_-	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_168183444.1|794732_796427_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_070446815.1|796584_797571_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_070446817.1|797726_799019_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	39.0	1.9e-81
WP_054173466.1|798999_799317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562320.1|799469_800642_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_024271704.1|802295_803258_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_003685171.1|803603_803957_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_070446805.1|803969_804581_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048340330.1|804755_806084_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_048340331.1|806373_807774_-	amino acid permease	NA	NA	NA	NA	NA
WP_054173465.1|808039_808327_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081540415.1|808350_809229_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	5.7e-42
WP_003681906.1|810069_810435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014562321.1|810560_811607_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_014562322.1|811617_812205_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_048340322.1|812241_814098_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	45.7	6.5e-136
WP_003681899.1|814209_815370_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.0	4.8e-20
WP_023465770.1|815775_816324_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_003681896.1|816351_816519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183445.1|816537_817104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183446.1|817311_818151_+	histidinol-phosphatase HisJ	NA	NA	NA	NA	NA
WP_168183447.1|818472_819633_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_168183448.1|819625_820240_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_015638837.1|820241_821525_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_114684280.1|821526_822111_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_012391116.1|822110_822719_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_114684279.1|822715_823441_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_168183449.1|823430_824204_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_070447030.1|824185_824503_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_003681874.1|824504_824825_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_003681872.1|824837_825923_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	23.5	7.6e-12
WP_003685127.1|825990_827823_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.1	2.5e-23
WP_086031824.1|827996_829283_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_070446809.1|829815_830319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681864.1|830354_830978_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_137876809.1|831069_832092_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_015638841.1|832351_833425_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	48.2	5.3e-90
WP_012391124.1|833436_834612_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	41.2	8.4e-89
WP_054173458.1|834751_836503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003685116.1|836540_836996_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_021349417.1|837156_837627_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.9	6.8e-26
WP_048340136.1|837619_838813_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	1.9e-96
WP_003681853.1|838799_839408_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.1	4.7e-27
WP_083276508.1|839407_840466_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.9	3.4e-41
WP_070446807.1|840875_841361_-	flavodoxin	NA	NA	NA	NA	NA
WP_054173519.1|842952_843531_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_168183450.1|843782_844781_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.3e-50
WP_003685099.1|844986_846159_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_012390701.1|846448_846901_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_035168979.1|846979_848230_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.0e-56
>prophage 5
NZ_CP050919	Lactobacillus fermentum strain HFD1 chromosome, complete genome	2101878	883786	930560	2101878	tRNA,transposase	Planktothrix_phage(18.18%)	48	NA	NA
WP_003681786.1|883786_884224_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003681784.1|884530_885019_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_168183461.1|885367_886564_+	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_003681779.1|886538_887666_+	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_070447009.1|888033_888813_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048339923.1|888827_889352_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021349562.1|889373_890117_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_015638885.1|890049_890805_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	6.7e-31
WP_015638886.1|890819_891977_+	amidohydrolase	NA	NA	NA	NA	NA
WP_003688751.1|892371_892659_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012391547.1|892682_893561_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.6e-42
WP_070447011.1|894671_895970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035430774.1|896338_896998_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_057195021.1|896978_897650_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012391164.1|897660_898401_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	4.7e-37
WP_021349555.1|898416_899271_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_070447013.1|899701_900445_+	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_168183462.1|900623_901790_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_168183463.1|901796_902621_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_111523599.1|902954_904328_-	amino acid permease	NA	NA	NA	NA	NA
WP_168183464.1|904454_905387_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_070447017.1|905464_906304_-	phosphotransferase	NA	NA	NA	NA	NA
WP_070447019.1|906305_907175_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	33.3	8.5e-14
WP_023467115.1|907236_908265_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_003681741.1|908641_909937_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_070447021.1|909940_911716_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_021349548.1|912376_913060_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_003684990.1|913173_913362_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_168183668.1|913426_913876_+	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	34.3	5.4e-12
WP_014562357.1|914023_915007_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	49.3	9.2e-49
WP_012391175.1|915006_915480_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_003681724.1|915457_915856_+	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_003681722.1|915869_916775_+	GTPase Era	NA	NA	NA	NA	NA
WP_003681720.1|916887_917706_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003681718.1|917973_918948_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_023467105.1|918947_921026_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003684978.1|921177_923073_+	DNA primase	NA	A0A1S5RFD7	Helicobacter_phage	32.1	5.6e-42
WP_003681711.1|923072_924215_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	36.6	1.9e-37
WP_003681709.1|924421_924616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070447022.1|924675_925518_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.2	3.7e-155
WP_012391066.1|925571_925823_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	4.6e-37
WP_021349446.1|926118_926679_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003681705.1|926690_926876_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_003681703.1|926903_927446_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003681701.1|927460_927712_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003681696.1|927723_927864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562466.1|928081_929080_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_042513914.1|929273_930560_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP050919	Lactobacillus fermentum strain HFD1 chromosome, complete genome	2101878	1019360	1060395	2101878	integrase,transposase,capsid	Bacillus_phage(18.18%)	40	1011747:1011764	1069591:1069608
1011747:1011764	attL	AGAAAACGTGGTCAATAA	NA	NA	NA	NA
WP_107760586.1|1019360_1020245_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_083276535.1|1020328_1021807_-	amino acid permease	NA	NA	NA	NA	NA
WP_003684880.1|1021964_1022996_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_054173423.1|1023632_1024274_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_053069019.1|1025029_1025542_-	Fic family protein	NA	NA	NA	NA	NA
WP_021349906.1|1025933_1026491_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_053069020.1|1026834_1028205_+	MFS transporter	NA	NA	NA	NA	NA
WP_014562398.1|1029446_1030583_+	aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	24.3	2.0e-10
WP_003683065.1|1030782_1030923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683063.1|1031123_1031333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183478.1|1031341_1032238_+|capsid	capsid protein	capsid	U3PFU0	Lactobacillus_phage	46.8	4.3e-61
WP_168183479.1|1032766_1033657_-	alpha/beta hydrolase	NA	Q854G2	Mycobacterium_phage	26.8	5.7e-13
WP_003683058.1|1033675_1034200_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003683057.1|1034311_1034494_-	DUF2316 family protein	NA	NA	NA	NA	NA
WP_046025697.1|1034547_1035474_+	YdcF family protein	NA	NA	NA	NA	NA
WP_024271964.1|1035507_1036380_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.1	9.4e-53
WP_015638975.1|1036472_1036958_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_048339965.1|1036973_1037804_-	pyridoxal kinase	NA	NA	NA	NA	NA
WP_012391233.1|1040005_1041085_+	tyrosine recombinase XerS	NA	A0A0E3XA96	Gordonia_phage	30.0	1.6e-06
WP_003683043.1|1041086_1042013_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_160229547.1|1042040_1043219_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_012391236.1|1043644_1044697_+	2,3-butanediol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	25.9	7.9e-14
WP_168183480.1|1044789_1045749_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_168183481.1|1045764_1046394_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_021816094.1|1046390_1047158_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	6.8e-23
WP_003683036.1|1047138_1047783_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003684836.1|1047933_1048836_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046025694.1|1048977_1049427_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003683030.1|1049464_1049890_-	OsmC family protein	NA	NA	NA	NA	NA
WP_070446973.1|1049889_1050426_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054173422.1|1050503_1051097_-	flavodoxin	NA	NA	NA	NA	NA
WP_160229548.1|1051866_1052490_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003683018.1|1052571_1053192_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	35.3	3.0e-21
WP_021349263.1|1053488_1054268_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_160229564.1|1054251_1054674_-	triphosphoribosyl-dephospho-CoA synthetase	NA	NA	NA	NA	NA
WP_014562705.1|1054772_1055960_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_114684404.1|1057122_1057959_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003683009.1|1058022_1059144_-	NAD(P)-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.9	7.6e-23
WP_081540415.1|1059205_1060084_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	5.7e-42
WP_054173465.1|1060107_1060395_-|transposase	transposase	transposase	NA	NA	NA	NA
1069591:1069608	attR	TTATTGACCACGTTTTCT	NA	NA	NA	NA
>prophage 7
NZ_CP050919	Lactobacillus fermentum strain HFD1 chromosome, complete genome	2101878	1106107	1159684	2101878	transposase	Erysipelothrix_phage(29.41%)	39	NA	NA
WP_168183489.1|1106107_1107358_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	8.1e-58
WP_168183490.1|1107577_1108765_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	7.5e-37
WP_003682943.1|1109719_1109992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183491.1|1110132_1111245_-	acyltransferase	NA	NA	NA	NA	NA
WP_168183492.1|1111724_1112555_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012391286.1|1114489_1115674_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_048340145.1|1115825_1116314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021815645.1|1117077_1117692_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	38.0	9.6e-28
WP_168183493.1|1118358_1124127_-	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_046949115.1|1124255_1125281_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.1	1.3e-42
WP_048340052.1|1125297_1125543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048340053.1|1126314_1126608_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_035426165.1|1126698_1126983_-	membrane protein	NA	NA	NA	NA	NA
WP_015639063.1|1128410_1129742_-	guanine deaminase	NA	NA	NA	NA	NA
WP_087908060.1|1129863_1131015_-	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_168161909.1|1131275_1131425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046948998.1|1131927_1132344_-	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	36.6	1.1e-14
WP_012390701.1|1132764_1133217_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_003684310.1|1133295_1134546_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_168183494.1|1135112_1135541_-	NADH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003682915.1|1135655_1136162_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003682913.1|1136213_1136981_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_003682911.1|1136973_1137615_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.6	5.5e-18
WP_070955615.1|1138009_1139692_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_168183495.1|1140250_1140790_-	DUF4256 domain-containing protein	NA	NA	NA	NA	NA
WP_130125205.1|1141145_1141898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015639076.1|1142080_1142641_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_168183496.1|1142988_1145979_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	70.8	0.0e+00
WP_168183669.1|1145999_1147829_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	58.3	4.8e-200
WP_072534687.1|1147925_1148648_-	DUF4391 family protein	NA	A0A2K5B2C0	Erysipelothrix_phage	50.9	5.9e-69
WP_168183497.1|1148648_1151906_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	80.7	0.0e+00
WP_002403339.1|1151952_1152153_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	55.6	2.4e-12
WP_168183498.1|1152980_1154147_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	2.5e-37
WP_168183499.1|1154181_1155402_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
WP_168183500.1|1155850_1156183_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	40.0	1.2e-11
WP_127429488.1|1156179_1156545_-	CrcB family protein	NA	NA	NA	NA	NA
WP_004563103.1|1156669_1157062_+	glyoxalase	NA	NA	NA	NA	NA
WP_003683563.1|1157136_1157694_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_168183501.1|1157968_1159684_+	AarF/ABC1/UbiB kinase family protein	NA	M4QMK7	Micromonas_pusilla_virus	29.7	1.1e-28
>prophage 8
NZ_CP050919	Lactobacillus fermentum strain HFD1 chromosome, complete genome	2101878	1246800	1290585	2101878	transposase	Streptococcus_phage(22.22%)	43	NA	NA
WP_042513934.1|1246800_1247256_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	1.8e-31
WP_012391038.1|1247329_1248580_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_003683372.1|1248837_1249701_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_168183509.1|1249957_1251349_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_024500988.1|1251364_1252606_+	MFS transporter	NA	NA	NA	NA	NA
WP_003683364.1|1252769_1254158_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_168183510.1|1254344_1255571_+	MFS transporter	NA	NA	NA	NA	NA
WP_070955650.1|1255702_1255990_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168183511.1|1255962_1256151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114684108.1|1256318_1256585_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168183512.1|1256604_1257726_-	lipolytic protein G-D-S-L family protein	NA	NA	NA	NA	NA
WP_021350286.1|1257780_1258800_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_003683354.1|1258828_1260235_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.8	7.3e-47
WP_021350287.1|1260241_1261576_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_014562491.1|1261591_1262569_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_014562492.1|1262571_1263663_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003683348.1|1264615_1264942_-	branched-chain amino acid transporter AzlD	NA	NA	NA	NA	NA
WP_168183513.1|1264938_1265640_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_168183514.1|1265647_1267156_-	threonine synthase	NA	NA	NA	NA	NA
WP_014562494.1|1267270_1268548_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_003683341.1|1268557_1269418_+	homoserine kinase	NA	NA	NA	NA	NA
WP_004563200.1|1269649_1270174_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_168183515.1|1270274_1270916_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_024500994.1|1271038_1271695_+	HD domain-containing protein	NA	A0A1S5V2G8	Saudi_moumouvirus	27.9	2.9e-06
WP_168183516.1|1271691_1272435_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_168183517.1|1272708_1273320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049184895.1|1273316_1274195_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	38.2	1.2e-15
WP_168183518.1|1274385_1276092_+	fibronectin/fibrinogen-binding protein	NA	M1I5P2	Paramecium_bursaria_Chlorella_virus	36.2	2.5e-09
WP_003684310.1|1276246_1277497_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_151130340.1|1277791_1278949_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.3e-37
WP_003617037.1|1279093_1279729_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_048340116.1|1279921_1282426_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_015639171.1|1282427_1283510_-	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_054173511.1|1283539_1284415_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_021350105.1|1284455_1284893_-	signal peptidase II	NA	NA	NA	NA	NA
WP_003683310.1|1284892_1285327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003683308.1|1285339_1285741_+	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_004563210.1|1285896_1286499_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003683304.1|1286722_1287586_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012391396.1|1287799_1288489_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_080662961.1|1288575_1289274_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003688751.1|1289395_1289683_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168183672.1|1289706_1290585_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	34.9	1.4e-40
>prophage 9
NZ_CP050919	Lactobacillus fermentum strain HFD1 chromosome, complete genome	2101878	1370136	1456968	2101878	protease,plate,integrase,portal,tail,tRNA,head,capsid,terminase,transposase	Lactobacillus_phage(75.93%)	97	1389013:1389031	1445605:1445623
WP_003683834.1|1370136_1371087_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	32.7	1.5e-11
WP_021349886.1|1371109_1373527_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_015639220.1|1373498_1374728_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	37.5	1.5e-48
WP_003686267.1|1374798_1375083_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003683827.1|1375079_1375700_-	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	38.9	2.2e-11
WP_035423994.1|1375892_1376210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003684331.1|1376343_1377507_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	71.7	1.8e-160
WP_003686264.1|1378120_1379815_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003683822.1|1379832_1380282_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003683820.1|1380295_1381111_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_003683815.1|1381120_1381996_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003683813.1|1381995_1382289_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_003683812.1|1382288_1383737_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.7	2.8e-33
WP_003683810.1|1383737_1384595_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.9	8.4e-38
WP_003683805.1|1384772_1385192_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_003683803.1|1385191_1385632_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_070447166.1|1385722_1386799_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_003683800.1|1386884_1387166_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003683798.1|1387189_1387513_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003683797.1|1387525_1387834_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_012391458.1|1387997_1388639_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
1389013:1389031	attL	TGGTGCACATTTGGTGCAC	NA	NA	NA	NA
WP_168183349.1|1389052_1389274_+	hypothetical protein	NA	E9LUK5	Lactobacillus_phage	96.0	1.8e-05
WP_168183523.1|1389383_1391999_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_168183524.1|1391998_1394008_-	site-specific DNA-methyltransferase	NA	H6W8D6	Escherichia_phage	32.4	8.2e-44
WP_021349944.1|1394292_1394451_-	hypothetical protein	NA	A0A0A7NU07	Lactobacillus_phage	80.8	3.4e-14
WP_168183525.1|1394486_1395611_-	LysM peptidoglycan-binding domain-containing protein	NA	U3PJ04	Lactobacillus_phage	42.4	3.4e-39
WP_168183526.1|1395610_1396018_-	hypothetical protein	NA	A0A0A1ELI5	Lactobacillus_phage	50.0	1.6e-23
WP_168183527.1|1396020_1396299_-	hypothetical protein	NA	D2KRC5	Lactobacillus_phage	72.8	2.8e-27
WP_168183528.1|1396359_1397049_-	hypothetical protein	NA	E9LUK0	Lactobacillus_phage	70.9	5.6e-69
WP_168183529.1|1397062_1398184_-|plate	BppU family phage baseplate upper protein	plate	E9LUJ9	Lactobacillus_phage	88.2	2.7e-177
WP_168183530.1|1398197_1399271_-	SGNH/GDSL hydrolase family protein	NA	E9LUJ8	Lactobacillus_phage	83.8	4.5e-174
WP_168183531.1|1399283_1399538_-	hypothetical protein	NA	E9LUJ7	Lactobacillus_phage	86.9	1.3e-31
WP_168183532.1|1399540_1399723_-	hypothetical protein	NA	E9LUJ6	Lactobacillus_phage	81.7	2.5e-16
WP_168183533.1|1399715_1405073_-	hypothetical protein	NA	E9LUJ5	Lactobacillus_phage	76.6	6.5e-205
WP_168183534.1|1405020_1406865_-	peptidoglycan DD-metalloendopeptidase family protein	NA	E9LUJ4	Lactobacillus_phage	35.1	1.4e-111
WP_168183535.1|1406865_1407699_-|tail	phage tail family protein	tail	A0A0M7RF73	Lactobacillus_phage	35.7	6.6e-40
WP_168183536.1|1407716_1413392_-|tail	phage tail tape measure protein	tail	F8J1C3	Lactobacillus_phage	50.3	9.0e-88
WP_046948826.1|1413613_1414018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112296905.1|1414180_1414834_-|tail	phage tail protein	tail	E9LUQ8	Lactobacillus_phage	57.8	1.5e-55
WP_168183537.1|1414826_1415222_-	DUF806 family protein	NA	NA	NA	NA	NA
WP_114684067.1|1415221_1415665_-	hypothetical protein	NA	F8J1B8	Lactobacillus_phage	33.6	3.1e-12
WP_168183538.1|1415657_1416014_-|head,tail	head-tail adaptor protein	head,tail	E9LUQ5	Lactobacillus_phage	47.9	4.4e-25
WP_168183539.1|1415976_1416360_-|head,tail	phage gp6-like head-tail connector protein	head,tail	F8J1B6	Lactobacillus_phage	42.9	1.7e-14
WP_146624324.1|1416375_1416558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183540.1|1416623_1417763_-|capsid	phage major capsid protein	capsid	A0A0C5AEH1	Paenibacillus_phage	59.1	4.7e-113
WP_046948832.1|1417764_1418532_-|protease	Clp protease ClpP	protease	F8J1B3	Lactobacillus_phage	58.8	1.5e-67
WP_168183541.1|1418479_1419772_-|portal	phage portal protein	portal	F8J1B2	Lactobacillus_phage	48.3	2.0e-107
WP_168183542.1|1419973_1421764_-|terminase	terminase large subunit	terminase	F8J1B1	Lactobacillus_phage	65.1	4.3e-238
WP_046948834.1|1421738_1422203_-|terminase	phage terminase small subunit P27 family	terminase	F8J1A9	Lactobacillus_phage	43.6	7.5e-25
WP_168183543.1|1422635_1422971_-	HNH endonuclease	NA	F8J1B0	Lactobacillus_phage	40.7	6.0e-16
WP_168183544.1|1423043_1424213_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_168183673.1|1424605_1425367_-	site-specific DNA-methyltransferase	NA	A0A2P0ZL38	Lactobacillus_phage	55.5	4.5e-67
WP_057194918.1|1425772_1425979_+	CsbD family protein	NA	NA	NA	NA	NA
WP_165844496.1|1426053_1427025_-	hypothetical protein	NA	Q7Y4L3	Streptococcus_phage	30.0	2.1e-05
WP_168183545.1|1427516_1428035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114684078.1|1428103_1428553_-	hypothetical protein	NA	A0A0A1ERD2	Lactobacillus_phage	63.2	2.8e-45
WP_168183546.1|1428715_1428973_-	hypothetical protein	NA	A0A2K9VD68	Lactobacillus_phage	39.0	6.2e-05
WP_168183547.1|1428984_1429305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183548.1|1429328_1429811_-	DUF1064 domain-containing protein	NA	A0A1I9KKZ1	Lactobacillus_phage	40.0	7.0e-26
WP_023467091.1|1429813_1430011_-	helix-turn-helix transcriptional regulator	NA	Q6SE98	Lactobacillus_prophage	41.3	1.6e-05
WP_168183549.1|1430742_1430898_-	hypothetical protein	NA	D2KRE6	Lactobacillus_phage	76.6	4.0e-15
WP_168183550.1|1431045_1431837_-	ATP-binding protein	NA	E9LUM7	Lactobacillus_phage	59.1	3.7e-80
WP_168183551.1|1431851_1432622_-	replication protein	NA	A0A1W6JNI1	Staphylococcus_phage	56.3	3.2e-65
WP_168183552.1|1432618_1433317_-	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	50.2	4.2e-56
WP_168183553.1|1433320_1433959_-	single-stranded DNA-binding protein	NA	E9LUM5	Lactobacillus_phage	64.2	9.3e-34
WP_168183554.1|1433959_1434808_-	hypothetical protein	NA	E9LUM4	Lactobacillus_phage	93.3	7.7e-161
WP_168183555.1|1434800_1435814_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	78.0	1.6e-133
WP_168183556.1|1435783_1435993_-	hypothetical protein	NA	E9LUM2	Lactobacillus_phage	72.5	4.1e-23
WP_168183557.1|1436029_1436188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183558.1|1436180_1436318_-	hypothetical protein	NA	E9LUM0	Lactobacillus_phage	62.2	3.0e-06
WP_057727928.1|1436329_1436656_-	hypothetical protein	NA	E9LUL9	Lactobacillus_phage	97.2	2.3e-57
WP_168183559.1|1436715_1436982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183560.1|1437102_1437885_-	phage regulatory protein	NA	E9LUL6	Lactobacillus_phage	84.0	5.2e-119
WP_168183561.1|1437881_1438112_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168183562.1|1438293_1438623_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	51.0	1.9e-19
WP_168183563.1|1438632_1439022_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_168183564.1|1439071_1439404_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_168183565.1|1439415_1439730_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_168183566.1|1439785_1440313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046949114.1|1441041_1441587_+	DUF5067 domain-containing protein	NA	H9A0K2	Staphylococcus_phage	34.2	6.8e-09
WP_168183350.1|1441724_1442279_+	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	92.5	1.6e-26
WP_168183567.1|1442285_1442489_+	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	69.2	4.5e-19
WP_168183568.1|1442567_1443602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057727945.1|1443562_1444441_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_168183569.1|1444515_1445604_+|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	98.3	1.3e-200
WP_014562466.1|1446247_1447246_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
1445605:1445623	attR	TGGTGCACATTTGGTGCAC	NA	NA	NA	NA
WP_168183570.1|1447439_1448726_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003683795.1|1448766_1449300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183571.1|1449292_1450261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003686245.1|1450253_1451147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003686242.1|1451716_1453069_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_015639231.1|1453267_1454191_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003683779.1|1454289_1454466_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_003686239.1|1454645_1455065_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_096494315.1|1455089_1456052_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_003683770.1|1456069_1456306_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_069775653.1|1456302_1456968_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 10
NZ_CP050919	Lactobacillus fermentum strain HFD1 chromosome, complete genome	2101878	1773795	1830825	2101878	integrase,transposase	Bacillus_phage(12.5%)	50	1770411:1770432	1827635:1827656
1770411:1770432	attL	GCAGGCCGTATGGCTAAGCTAG	NA	NA	NA	NA
WP_046949115.1|1773795_1774821_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.1	1.3e-42
WP_168183612.1|1774974_1775769_+	acetoin reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.6	1.2e-11
WP_168183613.1|1776149_1776470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183614.1|1776471_1777257_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	32.1	1.5e-17
WP_168183677.1|1777294_1778275_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168183615.1|1779513_1779807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183616.1|1780736_1781354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183617.1|1781573_1782803_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	45.6	3.8e-92
WP_003681444.1|1783412_1784000_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	41.6	2.8e-24
WP_012391637.1|1784220_1786179_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_031284350.1|1786327_1787338_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003681441.1|1787859_1789332_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	23.6	3.7e-17
WP_168183618.1|1789344_1790721_+	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_004562894.1|1791000_1791909_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003681437.1|1791945_1792815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681434.1|1792885_1793491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183619.1|1793737_1795234_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_012391644.1|1795651_1796572_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_168183620.1|1796916_1798170_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_160229759.1|1798310_1798859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070447503.1|1799038_1800070_+	lactonase family protein	NA	NA	NA	NA	NA
WP_087907893.1|1800162_1800750_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003681416.1|1800746_1801058_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_168183621.1|1801066_1804063_-	DEAD/DEAH box helicase	NA	Q6VT37	Vibrio_phage	27.3	6.3e-16
WP_003681411.1|1804075_1804492_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_070447497.1|1804544_1805090_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168183622.1|1805230_1806664_+	MFS transporter	NA	NA	NA	NA	NA
WP_003681402.1|1806649_1806865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681399.1|1807189_1807918_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_003681397.1|1808020_1808254_+	cytochrome b5	NA	NA	NA	NA	NA
WP_003681394.1|1808637_1809114_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003681392.1|1809174_1810290_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	40.9	2.7e-73
WP_168183623.1|1810721_1811102_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_014562645.1|1811170_1812181_-	aspartate--ammonia ligase	NA	NA	NA	NA	NA
WP_003681382.1|1812374_1812971_+	glycoside hydrolase family 73 protein	NA	A0A0A7RUS8	Clostridium_phage	43.4	5.3e-23
WP_004562874.1|1812989_1813511_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_168183624.1|1813807_1815328_+	LytTR family transcriptional regulator	NA	O64031	Bacillus_phage	25.5	2.5e-32
WP_003681375.1|1815324_1815783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004562871.1|1816028_1816451_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003681371.1|1816727_1817462_+	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_003681368.1|1818480_1818909_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003681367.1|1818880_1820269_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_168183625.1|1820255_1821005_+	5-oxoprolinase subunit PxpA	NA	NA	NA	NA	NA
WP_024501183.1|1821017_1822229_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_168183626.1|1823684_1824140_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	8.1e-32
WP_168183627.1|1824213_1825464_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.5	6.2e-58
WP_087908372.1|1826194_1827526_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	1.5e-22
WP_003681362.1|1827679_1827994_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	39.6	1.4e-14
1827635:1827656	attR	CTAGCTTAGCCATACGGCCTGC	NA	NA	NA	NA
WP_035168979.1|1829043_1830294_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.0e-56
WP_012390701.1|1830372_1830825_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
>prophage 11
NZ_CP050919	Lactobacillus fermentum strain HFD1 chromosome, complete genome	2101878	1860167	1912628	2101878	integrase,transposase	Streptococcus_phage(30.77%)	43	1847581:1847601	1890840:1890860
1847581:1847601	attL	TAAAGCAGGCCGTGGGCTAAG	NA	NA	NA	NA
WP_168183626.1|1860167_1860623_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	8.1e-32
WP_168183627.1|1860696_1861947_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.5	6.2e-58
WP_168183633.1|1862349_1863624_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	24.1	8.4e-18
WP_168183634.1|1863616_1863823_-	DUF3173 family protein	NA	NA	NA	NA	NA
WP_081540359.1|1863989_1865129_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	1.0e-43
WP_160229773.1|1867028_1868027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151130441.1|1868069_1868255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160229774.1|1868314_1869631_-	DUF3450 domain-containing protein	NA	NA	NA	NA	NA
WP_168183635.1|1870373_1870805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015639502.1|1872302_1873856_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.0	3.0e-17
WP_015639503.1|1874168_1874780_+	PpGpp synthetase/hydrolase catalytic subunit	NA	NA	NA	NA	NA
WP_168183636.1|1874793_1875465_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.6	1.2e-18
WP_168183637.1|1875477_1876731_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_100184299.1|1877045_1877969_-	type I pantothenate kinase	NA	NA	NA	NA	NA
WP_168183638.1|1878079_1878631_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_168183639.1|1878850_1879600_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_168183640.1|1879888_1881982_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.3	6.8e-150
WP_168183641.1|1882215_1883121_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003685331.1|1883213_1885508_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003681298.1|1885690_1886347_+	membrane protein	NA	NA	NA	NA	NA
WP_003685336.1|1886471_1887116_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_168183642.1|1887137_1888415_+	GTPase HflX	NA	NA	NA	NA	NA
WP_048339996.1|1888636_1889746_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_070447851.1|1889807_1890530_-	nicotinamide mononucleotide transporter	NA	G3BLP7	Salmonella_phage	24.3	1.5e-11
WP_041807893.1|1890878_1892477_-	APC family permease	NA	NA	NA	NA	NA
1890840:1890860	attR	CTTAGCCCACGGCCTGCTTTA	NA	NA	NA	NA
WP_168183643.1|1892585_1893575_-	D-2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	33.7	8.4e-42
WP_168183644.1|1893638_1894751_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.2	3.9e-27
WP_168183678.1|1894750_1895854_-	beta-glucanase	NA	NA	NA	NA	NA
WP_168183679.1|1895907_1897215_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_168183645.1|1897214_1897385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183646.1|1897384_1898251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183647.1|1898476_1901188_-	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_048340276.1|1901226_1901763_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012391698.1|1901988_1903032_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_015639517.1|1903284_1904202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021350176.1|1904213_1904693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681269.1|1904793_1905243_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_003681268.1|1905283_1905868_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	29.9	5.9e-11
WP_003685361.1|1905867_1906284_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003681266.1|1906384_1907773_+	amino acid permease	NA	NA	NA	NA	NA
WP_014562675.1|1908259_1910656_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_012391038.1|1910848_1912099_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_168183648.1|1912172_1912628_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	48.6	8.9e-31
>prophage 12
NZ_CP050919	Lactobacillus fermentum strain HFD1 chromosome, complete genome	2101878	1975257	2040198	2101878	transposase,tRNA	Paenibacillus_phage(30.77%)	53	NA	NA
WP_168183383.1|1975257_1975956_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	31.4	1.5e-21
WP_080965008.1|1975892_1976801_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	29.6	1.9e-11
WP_014562701.1|1977100_1978111_-	nickel transporter NixA	NA	NA	NA	NA	NA
WP_021349213.1|1978139_1978967_-	ATP-dependent sacrificial sulfur transferase LarE	NA	NA	NA	NA	NA
WP_012391743.1|1978991_1979702_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_012391744.1|1979703_1981068_-	nickel pincer cofactor biosynthesis protein LarC	NA	NA	NA	NA	NA
WP_012391745.1|1981067_1981826_-	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	47.2	3.7e-21
WP_012391746.1|1981833_1983117_-	nickel-dependent lactate racemase	NA	NA	NA	NA	NA
WP_023466300.1|1983357_1984029_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_014562705.1|1986113_1987301_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_101888892.1|1988566_1990288_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_003681137.1|1990475_1991804_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_012391750.1|1991818_1992214_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_168183654.1|1992237_1993155_-	ribokinase	NA	NA	NA	NA	NA
WP_014562707.1|1993400_1994360_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012391752.1|1994463_1995117_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_003685477.1|1995130_1996147_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003685479.1|1996180_1997128_+	ribokinase	NA	NA	NA	NA	NA
WP_014562709.1|1997187_1998612_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_014562710.1|1998809_1999814_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_021350294.1|2000367_2001873_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_003681120.1|2002332_2002767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014562712.1|2003046_2005446_-	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_012391758.1|2005651_2006449_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003685491.1|2006455_2007184_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003681115.1|2007327_2007828_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_003681114.1|2007831_2008575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100184165.1|2008634_2010071_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_014562716.1|2010306_2011119_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_014562717.1|2011384_2011900_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_003685499.1|2011909_2012437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681106.1|2012585_2013971_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003681105.1|2014057_2014522_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_035430687.1|2014766_2015198_-	VOC family protein	NA	NA	NA	NA	NA
WP_048340025.1|2015390_2016560_+	MFS transporter	NA	NA	NA	NA	NA
WP_003685507.1|2017050_2018532_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	36.9	4.0e-72
WP_023467422.1|2018716_2020156_+	NADP-dependent phosphogluconate dehydrogenase	NA	E3SPS4	Prochlorococcus_phage	30.2	1.1e-29
WP_003685511.1|2020521_2020995_-	universal stress protein	NA	NA	NA	NA	NA
WP_048340441.1|2021156_2021612_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_048340442.1|2021770_2022538_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.5	1.6e-16
WP_160229794.1|2022554_2023556_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_168183655.1|2023827_2025636_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003681091.1|2025638_2026931_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_003681090.1|2027178_2027850_+	membrane protein	NA	NA	NA	NA	NA
WP_114684234.1|2028254_2029323_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.6	1.3e-35
WP_114684233.1|2029504_2031184_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_107760586.1|2031319_2032204_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_050755181.1|2032191_2032812_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.9	7.4e-28
WP_004562986.1|2033478_2034138_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	8.1e-41
WP_003685528.1|2035886_2036468_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	34.9	1.7e-21
WP_168183656.1|2036796_2037468_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	1.9e-29
WP_003685525.1|2037472_2038519_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_168183657.1|2039010_2040198_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
>prophage 13
NZ_CP050919	Lactobacillus fermentum strain HFD1 chromosome, complete genome	2101878	2056222	2065310	2101878		Brazilian_cedratvirus(16.67%)	9	NA	NA
WP_003682216.1|2056222_2057161_+	hypothetical protein	NA	A0A2R8FDS8	Brazilian_cedratvirus	33.2	7.0e-30
WP_003682220.1|2057162_2057645_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003682221.1|2057861_2058656_+	nicotinamide mononucleotide transporter	NA	A0A0C5K6M3	Enterococcus_phage	33.1	5.8e-25
WP_003685559.1|2058762_2059272_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	50.0	1.9e-37
WP_021353558.1|2059280_2061185_-	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.8	3.4e-71
WP_003685564.1|2061321_2062632_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.7	1.0e-47
WP_003685567.1|2062728_2063022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183681.1|2063014_2064175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114807157.1|2064167_2065310_-	AAA domain-containing protein	NA	A0A141HRX4	Bacillus_phage	31.1	2.9e-22
