The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	13196	78464	12127650	integrase,transposase	Lactococcus_phage(50.0%)	46	13449:13466	40962:40979
WP_168486688.1|13196_14648_-|transposase	transposase	transposase	NA	NA	NA	NA
13449:13466	attL	CTCGGCGAGGGGCCGGGC	NA	NA	NA	NA
WP_168486690.1|14918_15836_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_168486692.1|15895_16240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168486694.1|16249_16795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168486688.1|16919_18371_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168486696.1|18509_18866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168486699.1|22050_23319_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_168486702.1|23340_24330_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_168486704.1|24326_24470_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_168486706.1|24652_24841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168486708.1|24837_25188_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_168486717.1|25433_26432_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_168486720.1|26542_27499_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168486723.1|27694_27922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168486725.1|28021_28558_-	DUF4240 domain-containing protein	NA	NA	NA	NA	NA
WP_168486727.1|28635_30117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168486729.1|30113_30440_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168486731.1|30439_31558_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168486733.1|33620_34322_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_168500689.1|34622_35246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168486735.1|35683_36256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500690.1|36255_38781_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_168486737.1|39167_39998_+	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_168486739.1|40318_40807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168486741.1|40787_41648_-	hypothetical protein	NA	NA	NA	NA	NA
40962:40979	attR	CTCGGCGAGGGGCCGGGC	NA	NA	NA	NA
WP_168486743.1|42737_43394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097228186.1|44010_44214_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	62.5	6.1e-16
WP_168486746.1|44574_44979_-	DUF2690 domain-containing protein	NA	NA	NA	NA	NA
WP_168500691.1|45013_45520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168486748.1|45617_46871_-	hypothetical protein	NA	A0A141HSE6	Bacillus_phage	25.2	1.6e-08
WP_168500692.1|47118_50913_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168486750.1|51245_51791_+	peptidase inhibitor family I36 protein	NA	NA	NA	NA	NA
WP_168486752.1|51787_52744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168486754.1|53583_55224_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_168500693.1|56644_57472_-	phosphotransferase	NA	NA	NA	NA	NA
WP_168486757.1|60192_60744_-	YciI family protein	NA	NA	NA	NA	NA
WP_168486759.1|61750_61906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168486761.1|63337_63751_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_168486763.1|69130_70432_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_168486765.1|71160_71721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099918406.1|71849_72434_-	DinB family protein	NA	NA	NA	NA	NA
WP_168486767.1|73550_74096_-	DUF1062 domain-containing protein	NA	NA	NA	NA	NA
WP_168500694.1|74372_75449_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168486769.1|75460_76015_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168486772.1|75984_76482_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168500695.1|77843_78464_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	356096	469914	12127650	transposase	Thermobifida_phage(18.18%)	72	NA	NA
WP_168487195.1|356096_357287_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0R8V9X2	Thermobifida_phage	73.3	2.6e-146
WP_168487198.1|357442_358375_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_168487200.1|358371_359229_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_168500717.1|359270_362006_+	alpha-mannosidase	NA	NA	NA	NA	NA
WP_168487202.1|362055_365040_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	34.0	9.4e-137
WP_168487204.1|365297_365873_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168487206.1|365893_366955_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_168487209.1|367297_368125_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168487211.1|368387_369848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168487213.1|370511_370919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168487216.1|371233_371653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168487218.1|371709_375183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168487220.1|375197_375449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168487223.1|375554_376310_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168487227.1|376873_377668_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_168487229.1|377744_384104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168486574.1|384709_390862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168487231.1|391451_391727_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168500718.1|392206_392353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168487235.1|392528_392984_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_168487238.1|392980_394597_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_168500719.1|394991_395987_+	helix-turn-helix domain-containing protein	NA	V9LZQ4	Vibrio_phage	27.6	2.0e-06
WP_168500720.1|395992_397837_+	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_168487239.1|397808_398462_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_168487241.1|398458_399478_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_168487243.1|399481_400600_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.6	8.4e-14
WP_168486769.1|400725_401280_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168487245.1|401249_401852_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168487248.1|403386_403974_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_168487250.1|403989_405111_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168487252.1|405236_406240_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_168487254.1|406360_406870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168486769.1|408300_408855_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168487256.1|416010_417024_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_168487258.1|417077_419468_-	phosphoketolase	NA	NA	NA	NA	NA
WP_168487260.1|419695_420568_-	universal stress protein	NA	NA	NA	NA	NA
WP_168487262.1|420573_421596_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	27.2	2.7e-27
WP_168487264.1|422676_423294_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_168500721.1|423429_424248_-	universal stress protein	NA	NA	NA	NA	NA
WP_168487266.1|424415_424808_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_168487268.1|425939_426419_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_168487270.1|426444_429315_-	HAD-IC family P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	30.6	1.0e-63
WP_168487273.1|429908_430760_+	slipin family protein	NA	NA	NA	NA	NA
WP_168487275.1|431199_432810_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_168487277.1|433161_433854_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_168500722.1|433900_434089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168487279.1|434099_435383_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_168500723.1|435582_436422_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_168500724.1|436375_436876_-	C26 family cysteine hydrolase domain-containing family	NA	NA	NA	NA	NA
WP_168487281.1|436940_437873_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_168487283.1|438132_439413_-|transposase	transposase	transposase	I4AZI9	Saccharomonospora_phage	30.5	4.6e-40
WP_168487285.1|440862_443049_-	recombinase family protein	NA	A0A141DZX2	Streptococcus_phage	25.6	1.6e-05
WP_168487289.1|443655_444222_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_168500725.1|444381_445236_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168487291.1|445495_446371_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168487293.1|446545_447385_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168487296.1|447561_448341_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168487298.1|448415_449255_-	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_168500726.1|449547_450786_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_168487300.1|450815_451805_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_168487302.1|451801_452641_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_168487304.1|452682_454215_+	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_168487306.1|454298_455489_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0R8V9X2	Thermobifida_phage	73.8	3.4e-146
WP_099925933.1|457249_457585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168487308.1|457639_460543_-	alpha-L-rhamnosidase	NA	NA	NA	NA	NA
WP_168500727.1|460972_462742_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_168487310.1|463737_464310_+	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_168487312.1|464805_465360_-	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_168500728.1|465456_466176_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168487314.1|466833_468048_-|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	36.6	1.1e-54
WP_168487316.1|468100_468529_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	58.3	1.9e-38
WP_168487318.1|468999_469914_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	734499	761394	12127650	tail,transposase	Saccharomonospora_phage(25.0%)	18	NA	NA
WP_168487792.1|734499_735579_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168500751.1|735601_735934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168487793.1|736056_736950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168487794.1|737059_737374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168487795.1|737474_739136_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_168487796.1|739307_739736_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	62.9	5.3e-41
WP_168487797.1|739762_740920_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	44.2	2.0e-66
WP_168487798.1|741038_741422_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_101406866.1|741481_741817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168487799.1|742097_747647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168487800.1|750639_751335_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_168487802.1|751468_752188_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_168487804.1|752184_754281_+	AAA family ATPase	NA	A0A1B2RW50	Lymphocystis_disease_virus	31.4	2.6e-08
WP_168487807.1|754348_755785_-	hydrolase	NA	NA	NA	NA	NA
WP_168487809.1|755877_757299_-	hydrogenase expression protein	NA	NA	NA	NA	NA
WP_168500752.1|757426_759133_-	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_143600028.1|759304_760885_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	34.8	1.3e-65
WP_054230236.1|760950_761394_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	765666	830821	12127650	integrase,plate,tail,transposase	Bacillus_phage(33.33%)	41	797472:797490	833032:833050
WP_054235291.1|765666_766092_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_067374696.1|766107_766836_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_168487813.1|766835_768752_+	VgrG-related protein	NA	NA	NA	NA	NA
WP_075029396.1|768792_769233_+	GPW/gp25 family protein	NA	A0A1D8KR06	Synechococcus_phage	31.6	6.9e-12
WP_168487816.1|769232_771191_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_168487818.1|771187_771745_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_067374690.1|774972_775224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168487821.1|775333_776215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168486576.1|778484_778643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168487823.1|778832_779390_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_168487825.1|782543_782834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168486579.1|783290_783431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168487827.1|783615_784113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168487829.1|785424_786618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168487831.1|786647_787322_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_168487833.1|787507_788284_-	DNA/RNA nuclease SfsA	NA	A0A127AYZ0	Bacillus_phage	42.7	6.4e-45
WP_168487835.1|788408_788783_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_168487837.1|788961_789990_+	WYL domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	26.4	1.8e-07
WP_168500753.1|790567_790798_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_168487839.1|790869_793002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168487842.1|793715_796844_+	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_168487844.1|797431_800191_+	galactosylceramidase	NA	NA	NA	NA	NA
797472:797490	attL	CCGCCGGGCTGTCGGCCGG	NA	NA	NA	NA
WP_168487846.1|800412_803052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168487848.1|803385_803982_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_168487850.1|804594_805062_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168487852.1|805189_806215_-	thaumatin family protein	NA	A0A2K9L018	Tupanvirus	29.9	8.0e-19
WP_168500754.1|806535_807120_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_168487854.1|808436_809300_-	isocitrate lyase/PEP mutase family protein	NA	NA	NA	NA	NA
WP_168487856.1|809956_811459_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_168487858.1|811936_812569_+	glyoxalase	NA	NA	NA	NA	NA
WP_168500755.1|814100_815237_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJA0	Virus_Rctr71	42.4	2.4e-72
WP_168487860.1|815868_816294_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_168487862.1|819066_819828_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_168487864.1|820796_821360_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	41.1	2.6e-27
WP_168487867.1|821349_822552_-	acetylhydrolase	NA	NA	NA	NA	NA
WP_168487869.1|822655_823003_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_168487872.1|822999_823746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168487879.1|824140_825058_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_168487882.1|825092_825518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168487884.1|825514_827686_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_168487886.1|829393_830821_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
833032:833050	attR	CCGCCGGGCTGTCGGCCGG	NA	NA	NA	NA
>prophage 5
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	1118343	1153182	12127650	protease,transposase	Pseudomonas_phage(25.0%)	25	NA	NA
WP_168488272.1|1118343_1118850_+|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
WP_168488274.1|1118991_1119855_+	universal stress protein	NA	NA	NA	NA	NA
WP_168500785.1|1122274_1122805_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_168488276.1|1123021_1123465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488278.1|1123541_1124777_-	MFS transporter	NA	NA	NA	NA	NA
WP_168500786.1|1125083_1125458_-	VOC family protein	NA	NA	NA	NA	NA
WP_168500787.1|1128125_1129910_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.5	2.2e-93
WP_168488280.1|1130507_1131335_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	M4I0N8	Staphylococcus_phage	31.5	7.3e-23
WP_168488282.1|1131622_1132090_+	DUF4232 domain-containing protein	NA	NA	NA	NA	NA
WP_168500788.1|1133205_1134690_+	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_168488285.1|1135018_1135879_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_168488287.1|1136155_1136326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488289.1|1136602_1137088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488291.1|1137325_1138303_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168488294.1|1138242_1139043_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_168488296.1|1140299_1141220_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168488298.1|1143390_1144152_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168488300.1|1144312_1145677_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_168488302.1|1145762_1146725_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_168488304.1|1146724_1147591_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_168488306.1|1147587_1148577_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_168488309.1|1148573_1149545_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_168500789.1|1149622_1150945_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_168488311.1|1151503_1152703_-|transposase	transposase	transposase	A0A220NS37	Mycobacterium_phage	31.3	1.1e-30
WP_168488313.1|1152753_1153182_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	65.9	2.3e-44
>prophage 6
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	1202771	1330630	12127650	integrase,transposase	Enterobacteria_phage(25.0%)	95	1238911:1238970	1306323:1306339
WP_168488420.1|1202771_1202984_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168488423.1|1203402_1203936_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_168488425.1|1203932_1204388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488428.1|1204392_1205274_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_168488437.1|1205883_1206645_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	27.9	2.7e-08
WP_168488439.1|1206682_1207534_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_168488441.1|1207652_1208624_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168488446.1|1208855_1209830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500794.1|1211297_1211477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500795.1|1212092_1213967_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_168488448.1|1214144_1214381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500796.1|1214833_1215397_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_168488451.1|1216539_1217799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488453.1|1219062_1220421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488455.1|1221258_1221603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488457.1|1221623_1222880_-	amidohydrolase	NA	NA	NA	NA	NA
WP_168488459.1|1222876_1223608_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_168488461.1|1223901_1224180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488463.1|1225202_1225559_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_168488465.1|1225757_1226699_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168488467.1|1227163_1227883_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_168488469.1|1227970_1230130_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_168488471.1|1230196_1230517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488473.1|1230650_1231394_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168500797.1|1231484_1232897_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_168488475.1|1233116_1234088_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_168488477.1|1234551_1234839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488479.1|1235092_1235305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488482.1|1236786_1237269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500798.1|1237308_1238793_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
1238911:1238970	attL	CTACTGATCTTTGACTACGGGCTTGACGCTGGTGGGGCGAGTTCGAGGCCGGTTCCGGCG	NA	NA	NA	NA
WP_168488484.1|1238924_1239536_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
1238911:1238970	attL	CTACTGATCTTTGACTACGGGCTTGACGCTGGTGGGGCGAGTTCGAGGCCGGTTCCGGCG	NA	NA	NA	NA
WP_168487928.1|1239439_1239976_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168488487.1|1241266_1242364_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_168488489.1|1242624_1243458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121413210.1|1243586_1244405_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.9	3.3e-52
WP_143613979.1|1244404_1245685_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	33.7	5.8e-27
WP_168500799.1|1246467_1248594_+	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_168488491.1|1249162_1249753_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_168488493.1|1249826_1249985_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168500800.1|1250839_1251931_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168488495.1|1252273_1252678_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_155057999.1|1252687_1252885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500801.1|1253681_1254113_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168488498.1|1254431_1256177_+	Replication initiation protein	NA	NA	NA	NA	NA
WP_168488500.1|1256173_1256362_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168488502.1|1256358_1257666_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	33.1	4.0e-39
WP_168488484.1|1257692_1258304_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168487928.1|1258207_1258744_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168500802.1|1267080_1271196_+	hypothetical protein	NA	NA	NA	NA	NA
1257679:1258799	attR	CTACTGATCTTTGACTACGGGCTTGACGCTGGTGGGGCGAGTTCGAGGCCGGTTCCGGCGAGGAATGCGGTGAGGAGGTCGGGGTGTCTCTGGATGTAGCGCAGTGCCGCTCGGGCTGTCTCGTGCAGCTCGGTAATCGAACGGAAGGCCCGGTTCGCGAGCCGCTCCTTCGCGTGGGCCCAGAGCAGTTCGACGGGGTTCAACTCCGGGGCGTACGAGGGCAGCTGGACGACGGTGAGCCAGTCGTGCTGCTGCGCGTACTGTTTCACGTGCTTGCTGATGTGGCTGGAGTAGTTGTCCCACACGATGGTCACCGGGCCGTCCAGGCGGCGGTGGAGCAGGGCCAAGAAGCGCGGGAAGTCCTTCTTCGTGTACCCGCCCGCGGGCTTGACCGCGTAGATCAGCCTCGGTTCCTCACCGTGCCTGAAGCAGATCCAGGCGACCATGCTGATCTTGTCGTTGTGCTTCCCGGACAGTCGGAGCACCGGGGTGTGTCCCTTCTTGCCCCAGGTCCGGCGGACCGGTCCGTTCAGCCACGCTCCGGCTTCGTCCTCGAAGCAGATCCATCCTCCGGCGTCCCTGGCCTGCGCGGATGGGAGACCGCCGGCCACGTCTCCGTGCACCAAGCGGCGATCGCCTCCTCGTCGCGCTCGACGGCCCGTCGCGCCGGGACCTGCCAGGACCAGCCGAGGCGGTCCAGCAGCCGCCAGATGCCGGAGATCTCGTACACCACGCCGAAGCGCTCCTCGATCAGGCGGCCGACCCTCGCCAACGTCCAGCGCTGGTCGTCCCAGCCGTGCGCCGTCGGACCCTGCTTCAGCATCCCGTCCAGCTCCGCCACCTGCTCGGCGCTCAGATACGAACGGCCGCCCATGCCCCGCGACAGCAGCGCGTCCCGGCCGCCCTCGCGCCACCGGCGCCGCCACTGATCGGCCGCCTGCCGGGTCACCCCCAGCACCCGCGCGACCTGCGAGGGCCGCATCCCCTGTTCGAATAGATCGGCCGCCATGAGGCGCCGACGCTCCAGATCAACTACGTCTGCCGGCTTGCGACTTCGAACCCCCATACAGCTGTTATGCCACACTTGACCCGGTCAGCAACCGTCCGGTCAAAGATCAGTA	NA	NA	NA	NA
WP_168488504.1|1271141_1271732_-	hypothetical protein	NA	NA	NA	NA	NA
1257679:1258799	attR	CTACTGATCTTTGACTACGGGCTTGACGCTGGTGGGGCGAGTTCGAGGCCGGTTCCGGCGAGGAATGCGGTGAGGAGGTCGGGGTGTCTCTGGATGTAGCGCAGTGCCGCTCGGGCTGTCTCGTGCAGCTCGGTAATCGAACGGAAGGCCCGGTTCGCGAGCCGCTCCTTCGCGTGGGCCCAGAGCAGTTCGACGGGGTTCAACTCCGGGGCGTACGAGGGCAGCTGGACGACGGTGAGCCAGTCGTGCTGCTGCGCGTACTGTTTCACGTGCTTGCTGATGTGGCTGGAGTAGTTGTCCCACACGATGGTCACCGGGCCGTCCAGGCGGCGGTGGAGCAGGGCCAAGAAGCGCGGGAAGTCCTTCTTCGTGTACCCGCCCGCGGGCTTGACCGCGTAGATCAGCCTCGGTTCCTCACCGTGCCTGAAGCAGATCCAGGCGACCATGCTGATCTTGTCGTTGTGCTTCCCGGACAGTCGGAGCACCGGGGTGTGTCCCTTCTTGCCCCAGGTCCGGCGGACCGGTCCGTTCAGCCACGCTCCGGCTTCGTCCTCGAAGCAGATCCATCCTCCGGCGTCCCTGGCCTGCGCGGATGGGAGACCGCCGGCCACGTCTCCGTGCACCAAGCGGCGATCGCCTCCTCGTCGCGCTCGACGGCCCGTCGCGCCGGGACCTGCCAGGACCAGCCGAGGCGGTCCAGCAGCCGCCAGATGCCGGAGATCTCGTACACCACGCCGAAGCGCTCCTCGATCAGGCGGCCGACCCTCGCCAACGTCCAGCGCTGGTCGTCCCAGCCGTGCGCCGTCGGACCCTGCTTCAGCATCCCGTCCAGCTCCGCCACCTGCTCGGCGCTCAGATACGAACGGCCGCCCATGCCCCGCGACAGCAGCGCGTCCCGGCCGCCCTCGCGCCACCGGCGCCGCCACTGATCGGCCGCCTGCCGGGTCACCCCCAGCACCCGCGCGACCTGCGAGGGCCGCATCCCCTGTTCGAATAGATCGGCCGCCATGAGGCGCCGACGCTCCAGATCAACTACGTCTGCCGGCTTGCGACTTCGAACCCCCATACAGCTGTTATGCCACACTTGACCCGGTCAGCAACCGTCCGGTCAAAGATCAGTA	NA	NA	NA	NA
WP_168488506.1|1272066_1272873_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_168500803.1|1272900_1273794_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168488508.1|1276426_1276849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488510.1|1278699_1280013_-	MFS transporter	NA	NA	NA	NA	NA
WP_168488512.1|1280444_1281347_-	ectoine hydroxylase	NA	NA	NA	NA	NA
WP_168488514.1|1281676_1282252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488516.1|1283551_1284577_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_168488518.1|1284585_1285050_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168488521.1|1285146_1285731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488523.1|1289902_1290637_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_168488525.1|1290716_1291688_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_168500804.1|1291721_1292270_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	45.3	1.2e-26
WP_168500805.1|1292437_1293205_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_168488527.1|1293397_1294549_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_168488529.1|1294689_1295013_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168488531.1|1296688_1296934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488533.1|1296917_1297442_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168488535.1|1297616_1297895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488537.1|1298548_1299523_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168488539.1|1303197_1304415_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168488541.1|1304639_1304777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488543.1|1304943_1305834_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_168488545.1|1305908_1307441_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	34.8	1.2e-39
WP_168500806.1|1308398_1308929_-	LamG domain-containing protein	NA	NA	NA	NA	NA
WP_143614204.1|1311888_1313112_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168488547.1|1313586_1313895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095850750.1|1315077_1315266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488549.1|1315344_1315848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488554.1|1315848_1317600_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_168488557.1|1318295_1318598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488560.1|1318620_1318797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488563.1|1319922_1320132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488565.1|1320397_1321300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488567.1|1321376_1322380_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	32.4	5.6e-09
WP_168488570.1|1322581_1323286_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168488573.1|1323405_1323828_-	SsgA family sporulation/cell division regulator	NA	NA	NA	NA	NA
WP_168488575.1|1324107_1324497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488577.1|1324669_1324855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488579.1|1324883_1325354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500807.1|1325327_1326470_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_168488581.1|1327935_1328229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488583.1|1328314_1329523_-	acyltransferase family protein	NA	A0A2H4JA46	uncultured_Caudovirales_phage	24.7	1.6e-05
WP_168488585.1|1329578_1329749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488587.1|1329973_1330291_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_168488589.1|1330345_1330630_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	1349596	1406892	12127650	integrase,transposase	Mycobacterium_phage(25.0%)	44	1344124:1344139	1407895:1407910
1344124:1344139	attL	GCCGCCGTCGCGGACC	NA	NA	NA	NA
WP_168488625.1|1349596_1350730_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168488627.1|1350882_1352148_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_168488629.1|1352355_1353408_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_168488631.1|1353711_1354626_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_168488633.1|1359172_1360411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488635.1|1362566_1362776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488637.1|1363028_1363856_+	alpha/beta fold hydrolase	NA	A0A1D8EW21	Mycobacterium_phage	28.3	3.1e-13
WP_168488639.1|1364676_1365543_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_168488641.1|1365817_1367590_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_168488644.1|1370554_1370902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488646.1|1370917_1372003_-	alkene reductase	NA	NA	NA	NA	NA
WP_168488649.1|1372066_1372669_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_168488651.1|1372689_1373697_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_168488653.1|1373804_1374413_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168488655.1|1374706_1375129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488658.1|1376003_1376714_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	37.8	6.3e-23
WP_168488660.1|1377309_1378641_-	cytochrome P450	NA	I6WI04	Cotesia_sesamiae_Mombasa_bracovirus	31.6	6.1e-19
WP_168488662.1|1378911_1379388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500808.1|1379531_1380695_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_168488664.1|1380657_1380951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143614245.1|1381058_1381289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488667.1|1381285_1381510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488669.1|1383829_1385146_-	MFS transporter	NA	NA	NA	NA	NA
WP_168488671.1|1385234_1386215_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168488673.1|1386224_1386593_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168488675.1|1388179_1389487_-	MFS transporter	NA	NA	NA	NA	NA
WP_168488677.1|1389483_1390092_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168488679.1|1390189_1390984_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_168488681.1|1391530_1391872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488683.1|1391937_1392090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488685.1|1392190_1393189_-	DUF3710 domain-containing protein	NA	NA	NA	NA	NA
WP_168488687.1|1394285_1395464_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_168488689.1|1395460_1396129_+	response regulator	NA	NA	NA	NA	NA
WP_168488691.1|1396654_1397899_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	55.1	4.8e-111
WP_168488693.1|1398143_1398827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488695.1|1399188_1399965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488697.1|1400092_1400263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488699.1|1400392_1401775_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_168488702.1|1401823_1402132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500809.1|1402138_1403437_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_168488704.1|1403677_1404061_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168488706.1|1404078_1404816_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_168500810.1|1404966_1406535_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_168500811.1|1406595_1406892_+|transposase	transposase	transposase	NA	NA	NA	NA
1407895:1407910	attR	GGTCCGCGACGGCGGC	NA	NA	NA	NA
>prophage 8
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	1430549	1486362	12127650	protease,transposase	Agrobacterium_phage(40.0%)	49	NA	NA
WP_168488749.1|1430549_1431383_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168488752.1|1431418_1431967_-	exonuclease SbcC	NA	NA	NA	NA	NA
WP_168488754.1|1432395_1433064_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_168488756.1|1433954_1434957_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_168486769.1|1434992_1435547_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168487134.1|1435516_1436119_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168488759.1|1437945_1438968_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168488761.1|1439071_1439659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488763.1|1442409_1443315_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_168488765.1|1443585_1444005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488767.1|1444244_1444406_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168488769.1|1444801_1445644_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_168488771.1|1445815_1446295_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168488773.1|1446827_1447736_+	NmrA family NAD(P)-binding protein	NA	A0A1V0SLC2	Klosneuvirus	26.1	2.4e-11
WP_168488781.1|1447822_1448218_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_168488783.1|1448214_1448607_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_168488785.1|1448760_1449009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500813.1|1449163_1449937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488786.1|1449887_1450091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488788.1|1450590_1451781_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_168488791.1|1452341_1452941_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_168488793.1|1453170_1453662_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168488795.1|1454716_1455991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488797.1|1456927_1457386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488799.1|1457409_1457838_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_168488801.1|1458139_1458736_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_168488803.1|1458777_1459596_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_168488805.1|1459733_1460639_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168488807.1|1461229_1461628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168488809.1|1461713_1462367_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_099920443.1|1462644_1463307_+	type 1 glutamine amidotransferase-like domain-containing protein	NA	NA	NA	NA	NA
WP_168488811.1|1464161_1465442_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	35.4	3.3e-30
WP_168488813.1|1467294_1468350_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168500814.1|1468527_1469325_-	VOC family protein	NA	NA	NA	NA	NA
WP_168500815.1|1469470_1470487_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_168488815.1|1470489_1471779_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_168488817.1|1471875_1472808_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_168488819.1|1472814_1473192_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168488821.1|1473296_1474826_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	38.1	3.2e-64
WP_168488823.1|1475194_1475590_-	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168488825.1|1475645_1476164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168488827.1|1476453_1479870_+	lectin	NA	NA	NA	NA	NA
WP_168488829.1|1480064_1481150_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168488832.1|1481149_1481680_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_168488835.1|1482226_1482724_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168488838.1|1483031_1483514_-	VOC family protein	NA	NA	NA	NA	NA
WP_168488840.1|1483672_1484911_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_168488842.1|1485104_1485758_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	45.5	1.0e-35
WP_168488844.1|1485759_1486362_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.0	6.9e-39
>prophage 9
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	2458454	2481655	12127650	protease,transposase	Bacillus_phage(100.0%)	16	NA	NA
WP_168500901.1|2458454_2459543_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168500831.1|2459906_2461613_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_168489873.1|2461849_2462167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500902.1|2462195_2462999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168489874.1|2466464_2468033_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_168500903.1|2468085_2468607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168489875.1|2468954_2470178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500831.1|2472140_2473847_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_168489876.1|2474411_2474972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168489877.1|2475032_2476739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168489878.1|2476735_2478049_+|protease	type VII secretion-associated serine protease mycosin	protease	A0A217EQY2	Bacillus_phage	37.1	4.3e-25
WP_168489879.1|2478050_2478488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168489880.1|2478491_2479739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168489881.1|2479735_2479939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168489882.1|2480365_2480875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168489883.1|2480887_2481655_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	4258760	4334632	12127650	tRNA,protease,transposase	Streptococcus_phage(25.0%)	56	NA	NA
WP_168491450.1|4258760_4261649_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.9	8.3e-215
WP_168501021.1|4262122_4263385_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_168491452.1|4263381_4265001_+	oxidoreductase	NA	NA	NA	NA	NA
WP_168501022.1|4265382_4266480_+	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_010986886.1|4266448_4266682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101405208.1|4266685_4266859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168501023.1|4266928_4268305_-	MFS transporter	NA	NA	NA	NA	NA
WP_168501024.1|4269694_4270315_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_168491454.1|4270428_4270872_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_168491456.1|4271044_4272868_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168491458.1|4272893_4273628_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_095854717.1|4273707_4273869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168491460.1|4274024_4274183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168491462.1|4274286_4275441_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_168491464.1|4275547_4276615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168491467.1|4276759_4277410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095854712.1|4277472_4278759_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	52.5	4.8e-106
WP_168501025.1|4278820_4279300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168501026.1|4279503_4280610_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	38.3	2.0e-55
WP_168491469.1|4280890_4282291_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_168491471.1|4282414_4283620_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_168491473.1|4283833_4285936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101405195.1|4286110_4287610_-	bifunctional cytidylyltransferase/SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_168501027.1|4287803_4288955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168491475.1|4289234_4290776_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_168491476.1|4291151_4292588_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_028802588.1|4292720_4292975_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_006374708.1|4292989_4293310_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_168491479.1|4297884_4298661_-	DUF2344 domain-containing protein	NA	NA	NA	NA	NA
WP_168491481.1|4298709_4299906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168491483.1|4300275_4300860_+	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	46.0	2.1e-40
WP_168491484.1|4300986_4302090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168501028.1|4302222_4304769_-	amino acid permease	NA	NA	NA	NA	NA
WP_168491486.1|4305570_4306935_-	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_168486593.1|4307429_4307618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168491488.1|4308009_4308810_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168491490.1|4308747_4309509_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168491492.1|4309552_4310242_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_168491494.1|4311483_4313016_+	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_168491496.1|4313629_4315600_-	TIGR03960 family B12-binding radical SAM protein	NA	NA	NA	NA	NA
WP_168491498.1|4315681_4317316_-	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_168491500.1|4317759_4318956_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_168491502.1|4318952_4321214_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_101405178.1|4321357_4322023_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_101405177.1|4322036_4322975_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_081217257.1|4323129_4324149_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_054231901.1|4324566_4324980_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	48.5	1.9e-27
WP_168491505.1|4325147_4325501_-	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_168491507.1|4325506_4327048_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_168491509.1|4327427_4330052_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.8	1.6e-143
WP_168491511.1|4330048_4330618_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168491513.1|4330614_4331007_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168491515.1|4331009_4331336_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_168491518.1|4331422_4332415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054231969.1|4332504_4333791_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.3	9.0e-145
WP_054231896.1|4333951_4334632_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	46.9	1.9e-40
>prophage 11
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	9520847	9556985	12127650	transposase	Mycobacterium_phage(25.0%)	32	NA	NA
WP_168497936.1|9520847_9522137_+|transposase	transposase	transposase	I4AZI9	Saccharomonospora_phage	36.0	1.3e-53
WP_168501447.1|9522702_9524397_-	chitinase	NA	M1HYL5	Paramecium_bursaria_Chlorella_virus	29.7	3.1e-20
WP_168497938.1|9524611_9525790_-	ATP-grasp domain protein	NA	NA	NA	NA	NA
WP_168497940.1|9526078_9526987_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_168497943.1|9526934_9527630_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_168497945.1|9527626_9527869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168501448.1|9528150_9529152_+	alpha/beta fold hydrolase	NA	A0A2R4AQZ9	Mycobacterium_phage	31.9	1.4e-20
WP_168497947.1|9529198_9530647_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_101403922.1|9531847_9532378_-	toxin-antitoxin system, toxin component	NA	NA	NA	NA	NA
WP_168497949.1|9532410_9533067_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168497951.1|9533307_9533955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168497953.1|9533986_9534766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168497956.1|9534722_9535550_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168497958.1|9535663_9536701_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	35.8	1.5e-28
WP_168497960.1|9536742_9537951_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_168497962.1|9537961_9538852_+	ABC transporter permease subunit	NA	Q6GZ02	Mycoplasma_phage	30.0	1.2e-10
WP_168497964.1|9538862_9539678_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_168497966.1|9540076_9541247_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	34.3	1.2e-34
WP_168497968.1|9541647_9542574_-	pirin family protein	NA	NA	NA	NA	NA
WP_168501449.1|9542726_9543641_+	glyoxalase	NA	NA	NA	NA	NA
WP_168497970.1|9543622_9543853_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	72.5	4.8e-09
WP_168497972.1|9543923_9544769_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168497974.1|9544785_9546426_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_168497976.1|9547770_9547941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168497978.1|9549073_9549583_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168497980.1|9549719_9549866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168501450.1|9550452_9550998_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_168497982.1|9551400_9551820_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_168497984.1|9552020_9552287_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_168501451.1|9552385_9553237_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_168497986.1|9553678_9555271_+	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	32.5	3.7e-39
WP_168487209.1|9556157_9556985_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	10554444	10618836	12127650	protease,transposase	Lactococcus_phage(33.33%)	47	NA	NA
WP_168499312.1|10554444_10555719_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_168499314.1|10556795_10558310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168499316.1|10558537_10559659_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168499318.1|10559704_10560235_-	chloramphenicol phosphotransferase CPT	NA	NA	NA	NA	NA
WP_168499320.1|10560607_10561261_+	DUF1707 domain-containing protein	NA	NA	NA	NA	NA
WP_168499323.1|10561946_10562336_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_168501538.1|10562745_10563051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168499325.1|10563071_10563425_-	YdhR family protein	NA	NA	NA	NA	NA
WP_168499326.1|10564383_10565310_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168499327.1|10566155_10566755_-	cation transporter	NA	NA	NA	NA	NA
WP_168499328.1|10567688_10568822_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_168499329.1|10569822_10570635_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_144314448.1|10572790_10574179_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_168499330.1|10575321_10576617_-	inositol phosphorylceramide synthase	NA	NA	NA	NA	NA
WP_168499332.1|10578230_10578767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168499334.1|10579401_10579743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168499336.1|10580515_10581040_-	VOC family protein	NA	NA	NA	NA	NA
WP_168501539.1|10581324_10581678_+	VOC family protein	NA	NA	NA	NA	NA
WP_168499338.1|10581796_10582642_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_168501540.1|10583112_10583604_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_168501541.1|10583821_10584463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060899524.1|10584832_10585036_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	62.7	3.6e-16
WP_168499340.1|10585228_10585708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168499342.1|10585803_10587966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168499344.1|10588189_10588642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168499346.1|10588859_10589363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168499348.1|10589332_10590751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168499350.1|10590747_10592175_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	31.2	9.7e-31
WP_075030117.1|10592234_10593347_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_168501542.1|10593460_10596229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168499352.1|10596260_10597613_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_168499354.1|10597925_10600904_+	aminotransferase	NA	NA	NA	NA	NA
WP_168499355.1|10600912_10601944_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_168499356.1|10602017_10603145_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_168499357.1|10603189_10604179_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_168499358.1|10604365_10604722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168499359.1|10604879_10605617_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_168499360.1|10605631_10606141_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	45.8	6.1e-12
WP_168499361.1|10606337_10608287_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_168499363.1|10609850_10610996_+	ROK family protein	NA	NA	NA	NA	NA
WP_168499365.1|10611270_10612599_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_168499367.1|10612718_10613630_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_168499369.1|10613626_10614529_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_168499371.1|10614531_10616250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168497310.1|10616645_10617716_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168497312.1|10617756_10618122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168499373.1|10618449_10618836_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	11040493	11114270	12127650	integrase,transposase	Moumouvirus(20.0%)	55	11045013:11045029	11113705:11113721
WP_168497310.1|11040493_11041564_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168497312.1|11041604_11041970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168499872.1|11042578_11042782_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_168499874.1|11042801_11043734_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168501593.1|11044840_11045902_-	alpha/beta hydrolase fold domain-containing protein	NA	A0A2P1EM31	Moumouvirus	35.8	2.5e-52
11045013:11045029	attL	AGGGAGGCGAAGTCGTG	NA	NA	NA	NA
WP_168501594.1|11049385_11050498_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168499876.1|11050857_11053602_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_168501595.1|11053717_11054452_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_168499878.1|11054697_11055948_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_168499881.1|11056060_11056954_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_168501596.1|11057028_11057781_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_168499883.1|11057893_11058232_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_168499885.1|11059079_11060765_-	MFS transporter	NA	NA	NA	NA	NA
WP_168499887.1|11060932_11061670_-	DUF1275 family protein	NA	NA	NA	NA	NA
WP_168499888.1|11061650_11062175_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_028804950.1|11062218_11062881_-	hydrolase	NA	NA	NA	NA	NA
WP_168499890.1|11063008_11064898_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_168499892.1|11065318_11066290_+	alpha/beta hydrolase fold domain-containing protein	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	38.2	2.0e-56
WP_143609746.1|11066310_11067030_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_168499894.1|11067091_11068234_-	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_168499897.1|11068296_11069664_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168499899.1|11069895_11070471_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_168499901.1|11070499_11071069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168499903.1|11071351_11072104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168499905.1|11072406_11073087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168499907.1|11073097_11075842_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_168499909.1|11077441_11077945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168499911.1|11079064_11079583_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168499913.1|11079579_11080134_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168499915.1|11082678_11085024_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_168499917.1|11085020_11085713_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.8	7.5e-29
WP_168499918.1|11085709_11086234_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168499920.1|11088927_11089221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030978521.1|11089609_11089903_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_168499922.1|11090288_11091146_-	PhzF family phenazine biosynthesis isomerase	NA	NA	NA	NA	NA
WP_168499924.1|11091133_11092027_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_168499926.1|11092414_11092840_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168501597.1|11092733_11093147_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_168499928.1|11093131_11095411_-	PHP domain-containing protein	NA	A0A0K1Y9G6	Streptomyces_phage	29.0	2.1e-59
WP_168499931.1|11096265_11097081_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168499933.1|11097155_11098067_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_168499934.1|11098141_11099155_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_168499935.1|11099263_11099854_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168486661.1|11100257_11100443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168499936.1|11100474_11100633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168499937.1|11100876_11102103_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_168499938.1|11103556_11104306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168486663.1|11104733_11104958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168499939.1|11105724_11106537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168501598.1|11107287_11107584_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168499940.1|11109358_11110093_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_168499941.1|11110113_11110497_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168501599.1|11111023_11111374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168499943.1|11112419_11112965_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_168499945.1|11113022_11114270_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	73.3	3.1e-166
11113705:11113721	attR	CACGACTTCGCCTCCCT	NA	NA	NA	NA
>prophage 14
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	11262171	11328479	12127650	transposase	Virus_Rctr71(33.33%)	45	NA	NA
WP_168501613.1|11262171_11263317_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJA0	Virus_Rctr71	43.2	1.8e-75
WP_168500085.1|11265218_11266222_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_168500087.1|11268165_11269206_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168500089.1|11272321_11273836_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_168500091.1|11274214_11274553_-	MerR family DNA-binding protein	NA	NA	NA	NA	NA
WP_168500093.1|11274973_11275633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500095.1|11275629_11277084_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_168500097.1|11277085_11277442_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_168500099.1|11277378_11277747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500101.1|11283258_11284041_+	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_168501614.1|11284370_11285597_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_168500103.1|11285870_11286692_+	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_168500106.1|11286931_11287237_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_168500108.1|11287236_11287473_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_168500110.1|11287548_11287713_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_168500112.1|11287718_11287976_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_168500114.1|11287972_11289148_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
WP_168500116.1|11289270_11289510_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_168500118.1|11289588_11290314_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_168500120.1|11290310_11291360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168501526.1|11294815_11295805_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_168499225.1|11295873_11296287_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168500122.1|11297693_11297888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500124.1|11297945_11300330_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_168500126.1|11300410_11300893_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_168500128.1|11301324_11302230_-	bile acid:sodium symporter family protein	NA	NA	NA	NA	NA
WP_168500130.1|11302403_11303618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168501615.1|11304512_11305487_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.2	1.7e-18
WP_168501616.1|11306084_11308415_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_168500132.1|11308585_11308909_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168500134.1|11309074_11309521_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_168500136.1|11309598_11309910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168501617.1|11310032_11311847_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_168500138.1|11311901_11313395_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.4	3.8e-38
WP_168500140.1|11313679_11314522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500142.1|11314822_11315875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500144.1|11316272_11316842_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_143609712.1|11317413_11318475_+	DUF2776 family protein	NA	NA	NA	NA	NA
WP_143609713.1|11318804_11320169_+	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_168500146.1|11320611_11321289_-	GAP family protein	NA	NA	NA	NA	NA
WP_168500148.1|11321697_11322360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500150.1|11322477_11323830_+	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_168500152.1|11323886_11325017_+	catalase family protein	NA	NA	NA	NA	NA
WP_168500154.1|11325310_11326933_+	MFS transporter	NA	NA	NA	NA	NA
WP_168500156.1|11327369_11328479_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	11492813	11515414	12127650	transposase	Megavirus(33.33%)	21	NA	NA
WP_168500295.1|11492813_11493410_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168500296.1|11494692_11495331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500297.1|11495588_11496131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500298.1|11497084_11497711_-	TetR/AcrR family transcriptional regulator C-terminal ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_168500299.1|11497820_11498618_+	acetoacetate decarboxylase	NA	NA	NA	NA	NA
WP_168500300.1|11498761_11499163_+	tautomerase	NA	NA	NA	NA	NA
WP_168500301.1|11499482_11500007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500302.1|11499990_11500155_+	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_168500303.1|11500605_11501559_+	immunity 49 family protein	NA	NA	NA	NA	NA
WP_168500304.1|11501760_11502027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500305.1|11502039_11503014_-	alpha/beta hydrolase fold domain-containing protein	NA	K7YHC8	Megavirus	40.9	2.2e-63
WP_168501637.1|11503421_11504093_+	transcriptional repressor LexA	NA	A0A2K9V3G4	Faecalibacterium_phage	37.4	4.3e-13
WP_168500306.1|11504555_11505023_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_168487254.1|11507895_11508405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500307.1|11508525_11509528_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_168501638.1|11511071_11511320_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168500308.1|11511350_11512451_-	LUD domain-containing protein	NA	NA	NA	NA	NA
WP_168500309.1|11512601_11513540_+	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
WP_168500310.1|11513683_11513896_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.8	3.3e-12
WP_168500311.1|11513899_11514361_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_168500312.1|11514574_11515414_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	11622826	11704957	12127650	transposase	Thermobifida_phage(40.0%)	52	NA	NA
WP_168500376.1|11622826_11623672_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_168500377.1|11623679_11624231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168501657.1|11624459_11624915_+	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_168498000.1|11625652_11626909_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_168500378.1|11627155_11628346_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168501658.1|11628403_11629246_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	50.2	3.0e-72
WP_168500379.1|11629792_11630422_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168500380.1|11630579_11630837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500381.1|11631060_11631786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500382.1|11632331_11632958_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_168500383.1|11632890_11633802_-	SigE family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_168500384.1|11634117_11635182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500385.1|11635253_11635697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500386.1|11637267_11637663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500387.1|11638067_11638877_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_168500388.1|11640540_11640930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500389.1|11641000_11641915_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_168501659.1|11642087_11642378_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168486670.1|11642376_11642640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500390.1|11643234_11643624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500391.1|11644114_11645134_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	NA	NA	NA	NA
WP_168500392.1|11646986_11648036_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_168500393.1|11648111_11648648_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168500394.1|11651145_11652072_+	recombinase family protein	NA	NA	NA	NA	NA
WP_168500395.1|11652115_11652619_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_168500396.1|11652691_11653078_-	glyoxalase	NA	NA	NA	NA	NA
WP_168500397.1|11653183_11653954_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_168501660.1|11654262_11654745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500398.1|11654893_11655658_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_168500399.1|11656692_11657235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500400.1|11657194_11657737_-	phosphotransferase	NA	NA	NA	NA	NA
WP_168500401.1|11660102_11661215_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168500402.1|11661265_11662126_+	AfsR/SARP family transcriptional regulator	NA	NA	NA	NA	NA
WP_168500403.1|11662790_11663786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500404.1|11664314_11664857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500405.1|11665157_11665580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500406.1|11665946_11666759_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_168500407.1|11673787_11674612_+	AfsR/SARP family transcriptional regulator	NA	NA	NA	NA	NA
WP_168500408.1|11674949_11675768_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_168500409.1|11677500_11677836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500410.1|11680961_11681897_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_168500411.1|11682075_11682654_+|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	36.2	8.7e-23
WP_168500412.1|11684300_11684471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101403454.1|11688539_11689127_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054229253.1|11690607_11691018_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_075032275.1|11691146_11691914_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	2.0e-19
WP_168500413.1|11691947_11692448_+	3-hydroxylacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_168500414.1|11692430_11693621_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0R8V9X2	Thermobifida_phage	71.9	7.1e-144
WP_168500415.1|11695044_11695560_+	hydroxymyristoyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_168500416.1|11700469_11701336_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_168501661.1|11701462_11702455_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_168500417.1|11703766_11704957_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0R8V9X2	Thermobifida_phage	72.5	1.4e-144
>prophage 18
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	11756018	11815134	12127650	transposase	Propionibacterium_phage(25.0%)	40	NA	NA
WP_168500458.1|11756018_11757176_-|transposase	transposase	transposase	A0A1D8ETH9	Propionibacterium_phage	47.5	1.4e-80
WP_168500459.1|11758257_11758719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500460.1|11759812_11760172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500461.1|11761413_11763171_+	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_168500462.1|11765640_11765808_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_168500463.1|11769237_11769813_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	37.0	9.3e-25
WP_168500464.1|11770197_11770671_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_168500465.1|11770813_11771737_+	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_168500466.1|11772047_11772782_-	DUF1345 domain-containing protein	NA	NA	NA	NA	NA
WP_075030175.1|11773176_11773356_+	hydrophobic protein	NA	NA	NA	NA	NA
WP_168500467.1|11773690_11774545_-	NmrA family NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_168500468.1|11774766_11775702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500469.1|11775881_11776394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500470.1|11776741_11777125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168501663.1|11780191_11781187_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_168500471.1|11781326_11781935_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168500472.1|11782258_11783224_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_168500473.1|11783483_11783900_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_168500474.1|11784634_11784799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500475.1|11784837_11786448_+	benzoylformate decarboxylase	NA	NA	NA	NA	NA
WP_168500476.1|11786500_11787262_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_168500477.1|11787359_11787689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500478.1|11788389_11789220_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_168500479.1|11789389_11789758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500480.1|11790088_11790433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168501664.1|11791176_11791431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500481.1|11795426_11795696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500482.1|11795695_11796589_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	35.8	1.1e-32
WP_168500483.1|11796697_11797318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500484.1|11797540_11799169_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168500485.1|11801176_11801749_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_168500486.1|11803073_11803454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500487.1|11803587_11804004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052067739.1|11804297_11804519_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_168500488.1|11804515_11805223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500489.1|11806856_11807408_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168501665.1|11810834_11812217_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_168500490.1|11812275_11813856_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_097285068.1|11813942_11814197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500491.1|11814411_11815134_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	34.0	2.8e-26
>prophage 19
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	11825739	11872688	12127650	transposase	uncultured_Caudovirales_phage(33.33%)	41	NA	NA
WP_168500498.1|11825739_11826918_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168500499.1|11826962_11828081_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_168500500.1|11828833_11829010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500501.1|11830020_11831061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500502.1|11832373_11832706_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	43.3	9.5e-06
WP_168500503.1|11832702_11833449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168501666.1|11834193_11834499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500504.1|11834495_11834756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168501667.1|11834853_11835255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500505.1|11835439_11835961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168501668.1|11836413_11836632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500506.1|11836780_11837617_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_168500507.1|11838829_11839540_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_143615159.1|11840907_11841207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168501669.1|11841334_11841634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500508.1|11841919_11842330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500509.1|11842469_11842784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500510.1|11842732_11843782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500511.1|11843961_11844156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500512.1|11844234_11844834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168487928.1|11844964_11845501_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168487930.1|11845544_11846015_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168500513.1|11847359_11847905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168486692.1|11847914_11848259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168486690.1|11848318_11849236_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_168486688.1|11849506_11850958_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168500514.1|11851126_11852215_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_168486685.1|11853240_11853687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500515.1|11854128_11854734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500516.1|11856399_11857095_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168500517.1|11858199_11859459_+	MFS transporter	NA	NA	NA	NA	NA
WP_168500518.1|11859538_11860393_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168500519.1|11862456_11862981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500520.1|11863284_11863956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500521.1|11864884_11865934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500522.1|11866019_11866619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500523.1|11866822_11867446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500524.1|11868575_11870051_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	33.5	5.8e-47
WP_168500525.1|11870233_11870689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500526.1|11870762_11871329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500527.1|11871473_11872688_+|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	37.5	5.5e-59
>prophage 20
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	11893467	11956707	12127650	protease,transposase	Streptococcus_phage(22.22%)	59	NA	NA
WP_168500537.1|11893467_11893773_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	38.1	2.1e-07
WP_168500538.1|11894661_11894871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500539.1|11895108_11896584_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_168500540.1|11897034_11898294_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_168500541.1|11898428_11899376_-	NAD-binding protein	NA	NA	NA	NA	NA
WP_168500542.1|11900237_11900822_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_143605000.1|11901286_11901964_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_143605001.1|11901950_11902502_-	VOC family protein	NA	NA	NA	NA	NA
WP_168500543.1|11902665_11904852_+	MFS transporter	NA	NA	NA	NA	NA
WP_168500544.1|11904894_11906253_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_168500545.1|11906462_11907683_+|transposase	transposase	transposase	A0A1D8ETH9	Propionibacterium_phage	47.8	2.8e-87
WP_143605004.1|11907772_11908825_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_168500546.1|11909483_11910719_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168500547.1|11910727_11911606_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_168500548.1|11911602_11912640_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_143605008.1|11912636_11913368_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.8	5.7e-11
WP_143605009.1|11913370_11914093_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.7	1.6e-10
WP_168500549.1|11914735_11915833_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168500550.1|11915839_11916727_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_143614938.1|11916723_11917764_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_168501671.1|11920142_11920922_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_168501672.1|11920949_11921246_+	DUF1275 family protein	NA	NA	NA	NA	NA
WP_168500551.1|11921259_11922450_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0R8V9X2	Thermobifida_phage	73.0	3.1e-147
WP_168500552.1|11922604_11922853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143615169.1|11922978_11923425_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168500553.1|11924011_11925304_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_143605016.1|11925494_11926172_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_143605017.1|11926450_11926996_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_168500554.1|11927573_11928563_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168500555.1|11928570_11929467_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_168500556.1|11929463_11930324_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_168501673.1|11930350_11931175_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.6	8.0e-30
WP_143605021.1|11931181_11932279_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_143614945.1|11932327_11932894_+	YceI family protein	NA	NA	NA	NA	NA
WP_143614946.1|11932914_11933721_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_143605024.1|11933738_11934059_+	Dabb family protein	NA	NA	NA	NA	NA
WP_143605025.1|11934055_11934562_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_168500557.1|11934706_11935273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500558.1|11935821_11936547_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	30.2	1.6e-26
WP_168500559.1|11936751_11936904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500560.1|11937077_11937467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500561.1|11937748_11938171_+	SsgA family sporulation/cell division regulator	NA	NA	NA	NA	NA
WP_168500562.1|11938290_11938995_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168500831.1|11939092_11940799_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_168486672.1|11940975_11941176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500558.1|11941552_11942278_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	30.2	1.6e-26
WP_168500563.1|11942345_11942708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168501674.1|11943029_11943572_-	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_168500564.1|11943598_11944105_-	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_168500565.1|11944740_11945778_-	hypothetical protein	NA	A0A141HSE6	Bacillus_phage	30.7	5.6e-12
WP_168500566.1|11946134_11949917_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168500567.1|11950014_11950446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500568.1|11951193_11951646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500569.1|11951700_11952381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500570.1|11952589_11952964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500571.1|11952994_11953540_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_168500572.1|11953923_11954751_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_168500573.1|11954934_11955552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500574.1|11955852_11956707_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
>prophage 21
NZ_CP050974	Streptomyces sp. RLB1-33 chromosome, complete genome	12127650	11971539	12040992	12127650	tRNA,transposase,integrase	Salmonella_phage(12.5%)	49	12002083:12002100	12045773:12045790
WP_168500581.1|11971539_11971917_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168500582.1|11971930_11972524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500583.1|11972531_11974247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168497974.1|11974859_11976500_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_168500584.1|11978599_11979796_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168500585.1|11980380_11981259_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_168500586.1|11981265_11982804_-	amino acid permease	NA	NA	NA	NA	NA
WP_168500587.1|11982938_11983571_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168500588.1|11985280_11985592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500589.1|11985642_11986869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500590.1|11988257_11988446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097282962.1|11988551_11988947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500591.1|11989355_11990141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168501677.1|11991326_11993258_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_168500592.1|11994360_11994756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500593.1|11995899_11996673_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_168500594.1|11996676_11997033_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_168500595.1|11997032_11997668_-	7-carboxy-7-deazaguanine synthase	NA	A0A1W6JS84	Salmonella_phage	32.3	3.5e-17
WP_168500596.1|11997670_11998366_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A126HGA1	Vibrio_phage	36.6	1.6e-31
WP_168500597.1|11998490_11999384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500598.1|11999383_12000517_+	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_168500599.1|12000513_12001734_+|tRNA	queuine/other tRNA-ribosyltransferase	tRNA	NA	NA	NA	NA
WP_168500600.1|12001775_12002879_+	DGQHR domain-containing protein	NA	NA	NA	NA	NA
12002083:12002100	attL	CCGGCGAACTCGTCATCC	NA	NA	NA	NA
WP_168500601.1|12002963_12003215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500602.1|12004841_12006860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500603.1|12006849_12007374_-	phosphatidylserine/phosphatidylglycerophosphate/ cardiolipin synthase family protein	NA	NA	NA	NA	NA
WP_168501678.1|12007370_12011837_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_168500604.1|12011858_12012542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500605.1|12012538_12015595_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_168500606.1|12015587_12016454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500607.1|12016453_12019048_-	DEAD/DEAH box helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	26.5	1.3e-17
WP_168500608.1|12019047_12022089_-	restriction endonuclease subunit R	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	22.2	5.6e-12
WP_168500609.1|12022135_12022273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500610.1|12022784_12023882_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168500611.1|12024553_12024946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500612.1|12026312_12027404_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168500613.1|12027696_12028011_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	8.1e-15
WP_168500614.1|12028051_12029401_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	8.0e-35
WP_168500615.1|12029393_12030011_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	30.1	2.7e-14
WP_168500616.1|12030037_12030328_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168500617.1|12032939_12033170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168500618.1|12033262_12033433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168501679.1|12033846_12034923_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1J0MC50	Streptomyces_phage	36.3	1.2e-46
WP_168500619.1|12034961_12035909_-	ATP-grasp ribosomal peptide maturase	NA	NA	NA	NA	NA
WP_168500620.1|12035905_12036199_-	putative ATP-grasp-modified RiPP	NA	NA	NA	NA	NA
WP_168500621.1|12036547_12036688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168500622.1|12036776_12037160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143653886.1|12037198_12038392_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_143656914.1|12039828_12040992_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
12045773:12045790	attR	GGATGACGAGTTCGCCGG	NA	NA	NA	NA
