The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051128	Bacillus megaterium strain S2 chromosome, complete genome	6468885	1091018	1099306	6468885		Prochlorococcus_phage(33.33%)	8	NA	NA
WP_168241642.1|1091018_1092317_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	24.7	5.9e-19
WP_098934681.1|1092420_1093134_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	45.4	2.4e-46
WP_168241643.1|1093126_1093381_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_168241644.1|1093377_1094061_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_168241645.1|1094044_1096270_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.9	1.3e-159
WP_168241646.1|1096245_1097658_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.4e-50
WP_098934677.1|1097672_1098707_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	47.7	6.5e-61
WP_168241647.1|1098703_1099306_+	phosphoribosylglycinamide formyltransferase	NA	R9S626	Prochlorococcus_phage	32.8	4.0e-18
>prophage 2
NZ_CP051128	Bacillus megaterium strain S2 chromosome, complete genome	6468885	2804069	2846320	6468885	terminase,transposase,integrase	Bacillus_phage(36.36%)	45	2841914:2841937	2854881:2854904
WP_168242912.1|2804069_2805053_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168242913.1|2805727_2806018_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168242914.1|2806048_2808577_+	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	33.7	2.3e-83
WP_168242915.1|2809176_2809467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168242916.1|2809616_2809796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168242917.1|2809782_2810325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168242918.1|2810433_2810784_+|terminase	P27 family phage terminase small subunit	terminase	A0A0S2SXN4	Bacillus_phage	34.2	1.6e-11
WP_168242919.1|2810987_2811077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168242920.1|2811166_2811553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168242921.1|2811558_2812143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168242922.1|2812281_2812620_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_168242923.1|2812782_2814003_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	28.7	5.0e-20
WP_168242924.1|2814009_2815059_+	5-methylcytosine-specific restriction endonuclease system specificity protein McrC	NA	NA	NA	NA	NA
WP_168242925.1|2815200_2815497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168242926.1|2815647_2816619_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_168242927.1|2816630_2816948_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_168242928.1|2817172_2817811_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_168242929.1|2818199_2819228_+	DNA (cytosine-5-)-methyltransferase	NA	A0A0K2FH18	Enterobacter_phage	31.8	1.5e-41
WP_168242930.1|2819216_2819957_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_168242931.1|2819980_2820322_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JPB6	Staphylococcus_phage	31.3	1.7e-05
WP_168242932.1|2820878_2822009_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	44.2	2.8e-81
WP_168242933.1|2822089_2823058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168242934.1|2823189_2823390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168242935.1|2823486_2823717_+	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	45.3	5.7e-10
WP_168242936.1|2823691_2824549_+	DNA primase	NA	A0A173H0P8	Pseudoalteromonas_phage	41.1	5.2e-40
WP_168242937.1|2824538_2826212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168242938.1|2826208_2826628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168242939.1|2826788_2827010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168242940.1|2827042_2827420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168242941.1|2828040_2828724_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168246033.1|2829027_2829603_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168242942.1|2829804_2829993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168242943.1|2830277_2831252_-	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_168242944.1|2831910_2832903_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168242945.1|2832923_2833166_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_168242946.1|2833162_2833642_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_168242947.1|2833757_2833988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168242948.1|2834530_2835619_-	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_168242949.1|2835615_2836707_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_168246034.1|2836699_2838199_-	spore germination protein	NA	NA	NA	NA	NA
WP_168242950.1|2839198_2839399_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	5.3e-20
WP_168242951.1|2839754_2840978_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	30.6	6.3e-47
WP_168242952.1|2841383_2841863_+	hypothetical protein	NA	NA	NA	NA	NA
2841914:2841937	attL	ACTTAAAGTAACGGGTGCGTTAGT	NA	NA	NA	NA
WP_168242953.1|2843998_2844877_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	29.9	2.7e-31
WP_168242954.1|2845045_2846320_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
2854881:2854904	attR	ACTTAAAGTAACGGGTGCGTTAGT	NA	NA	NA	NA
>prophage 3
NZ_CP051128	Bacillus megaterium strain S2 chromosome, complete genome	6468885	2851314	2920817	6468885	transposase,integrase	Paenibacillus_phage(25.0%)	60	2855645:2855661	2929295:2929311
WP_168242958.1|2851314_2852434_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	63.0	2.7e-97
WP_168242959.1|2853485_2854046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168242960.1|2854941_2855415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168242961.1|2855426_2856431_-	DUF3231 family protein	NA	NA	NA	NA	NA
2855645:2855661	attL	GTTTATCGGAAAAAGGG	NA	NA	NA	NA
WP_168242962.1|2856817_2858047_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	22.6	7.8e-05
WP_168242963.1|2858503_2858935_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	39.3	4.8e-10
WP_168242964.1|2859501_2860599_-	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_168242965.1|2860627_2861818_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_168242966.1|2861834_2863319_-	spore germination protein	NA	NA	NA	NA	NA
WP_168242967.1|2863831_2864335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088087141.1|2864880_2865069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168242954.1|2865523_2866798_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168242968.1|2867127_2868248_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	63.0	1.2e-97
WP_168242969.1|2869809_2870892_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_168242970.1|2870987_2874629_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_168246035.1|2874817_2875171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168246036.1|2876136_2877087_+|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	33.2	4.2e-30
WP_168242971.1|2877188_2877362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168242972.1|2878342_2879596_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_168242973.1|2880085_2880730_-	YitT family protein	NA	NA	NA	NA	NA
WP_168242974.1|2880750_2881191_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088086607.1|2881319_2881772_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168242975.1|2881797_2882316_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_168242976.1|2883104_2883701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168242977.1|2884170_2884371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168242978.1|2884728_2885001_-	YqhV family protein	NA	NA	NA	NA	NA
WP_168246037.1|2885394_2885472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168242979.1|2885508_2886189_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_168242980.1|2886656_2887151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168242981.1|2887456_2887861_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_168242982.1|2887983_2888409_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168242983.1|2888466_2888865_+	DoxX family protein	NA	NA	NA	NA	NA
WP_168242984.1|2888955_2889894_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_168242985.1|2889917_2890526_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_168242986.1|2890563_2891508_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_168242987.1|2891507_2892119_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168242988.1|2892141_2892567_+	DoxX family protein	NA	NA	NA	NA	NA
WP_168242989.1|2892782_2893253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168242990.1|2893603_2894317_+	pirin family protein	NA	NA	NA	NA	NA
WP_168242991.1|2894316_2894592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098932266.1|2894680_2895334_+	alkylhydroperoxidase	NA	NA	NA	NA	NA
WP_168242992.1|2895470_2896388_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168242993.1|2896532_2898050_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.1	8.1e-44
WP_168242994.1|2898118_2899639_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_168242995.1|2899684_2900893_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_168242996.1|2901069_2902974_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	38.4	4.9e-131
WP_168242997.1|2903136_2904408_+	MFS transporter	NA	NA	NA	NA	NA
WP_168242998.1|2904508_2905150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168242999.1|2905168_2905723_+	polyhydroxyalkanoate biosynthesis repressor PhaR	NA	NA	NA	NA	NA
WP_168246038.1|2905743_2906823_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_168243000.1|2907162_2907939_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_168243001.1|2908088_2908208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168243002.1|2908314_2909535_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168243003.1|2909993_2914136_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	32.9	2.3e-24
WP_168243004.1|2914598_2915219_+	chromate transporter	NA	NA	NA	NA	NA
WP_168243005.1|2915236_2915779_+	chromate transporter	NA	NA	NA	NA	NA
WP_088086642.1|2916311_2917139_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_168243006.1|2917139_2918174_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_168243007.1|2918448_2919153_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_168243008.1|2919356_2920817_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
2929295:2929311	attR	GTTTATCGGAAAAAGGG	NA	NA	NA	NA
>prophage 4
NZ_CP051128	Bacillus megaterium strain S2 chromosome, complete genome	6468885	4914432	4972439	6468885	transposase,integrase	Bacillus_phage(28.57%)	56	4911204:4911219	4976525:4976540
4911204:4911219	attL	AGTCTTAGACTGCCGC	NA	NA	NA	NA
WP_168246199.1|4914432_4915350_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	5.3e-30
WP_168240866.1|4915343_4915520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168244575.1|4915456_4915777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168244576.1|4916005_4916476_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168244577.1|4916876_4917062_+	spore germination protein	NA	NA	NA	NA	NA
WP_168244578.1|4917160_4917628_-	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_168244579.1|4917649_4918195_-	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_168244580.1|4918501_4919221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168244581.1|4919694_4920873_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_168244582.1|4920959_4921874_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168244583.1|4922086_4922875_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_168246200.1|4922879_4923152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168244584.1|4923282_4923741_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_168244585.1|4923746_4924529_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168244586.1|4924984_4925701_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_168244587.1|4926178_4927027_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_168244588.1|4927312_4927513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168244589.1|4927675_4928224_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_168244590.1|4928227_4928863_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_168244591.1|4930205_4930697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168244592.1|4930710_4931334_-	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
WP_168244593.1|4932115_4932388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168244594.1|4932433_4932625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168244595.1|4932681_4933134_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_168244596.1|4933893_4934277_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_088090879.1|4935099_4935327_-	DUF2187 family protein	NA	NA	NA	NA	NA
WP_168244597.1|4935374_4935596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168244598.1|4935949_4936453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168244599.1|4936987_4937167_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_168244600.1|4937272_4937503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168244601.1|4938147_4938363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088090819.1|4939074_4939203_-	YhfH family protein	NA	NA	NA	NA	NA
WP_168244602.1|4940828_4941350_-	hypothetical protein	NA	A0A0A0RMX2	Bacillus_phage	40.4	1.5e-21
WP_168244603.1|4942036_4942771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168244604.1|4942889_4943063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168244605.1|4943606_4943759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168244606.1|4943816_4944011_+	RNA polymerase	NA	A0A2I7S8R6	Vibrio_phage	54.0	1.1e-06
WP_168244607.1|4944500_4944899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168246201.1|4945277_4946255_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168246202.1|4953224_4953758_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	30.5	5.1e-09
WP_168244608.1|4953750_4954224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168240867.1|4954660_4954822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168244609.1|4954931_4955843_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168243563.1|4956341_4957565_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	30.0	1.3e-47
WP_168244610.1|4958562_4958919_-	DUF2019 domain-containing protein	NA	NA	NA	NA	NA
WP_168244611.1|4959140_4961048_-	S8/S53 family peptidase	NA	NA	NA	NA	NA
WP_168244612.1|4961555_4962779_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168244613.1|4962929_4963400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168244614.1|4963660_4964575_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	36.8	2.6e-05
WP_168244615.1|4964720_4966016_+	MFS transporter	NA	NA	NA	NA	NA
WP_168244616.1|4966323_4967259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168244617.1|4967483_4967801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168244618.1|4967972_4968392_-	DUF4279 domain-containing protein	NA	NA	NA	NA	NA
WP_168244619.1|4968786_4970010_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	30.0	2.8e-47
WP_168246203.1|4970143_4970368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168241956.1|4971164_4972439_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
4976525:4976540	attR	AGTCTTAGACTGCCGC	NA	NA	NA	NA
>prophage 5
NZ_CP051128	Bacillus megaterium strain S2 chromosome, complete genome	6468885	5364513	5379796	6468885	coat,protease,transposase	Acanthamoeba_polyphaga_lentillevirus(50.0%)	18	NA	NA
WP_098931580.1|5364513_5365203_-|protease	intramembrane metalloprotease PrsW	protease	NA	NA	NA	NA
WP_168246236.1|5365317_5366274_-	asparaginase	NA	NA	NA	NA	NA
WP_168244934.1|5366273_5367254_-	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_168244935.1|5367349_5368627_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_168244936.1|5368870_5369452_-	genetic competence negative regulator	NA	NA	NA	NA	NA
WP_168244937.1|5369527_5370310_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_168244938.1|5370334_5370703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168244939.1|5370899_5371130_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_168244940.1|5371126_5371387_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_168244941.1|5371408_5371978_+|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
WP_168244942.1|5372008_5372464_-	YpbF family protein	NA	NA	NA	NA	NA
WP_168246237.1|5372555_5373080_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_168244943.1|5373265_5373871_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_168244944.1|5373867_5375382_-	ATP-dependent DNA helicase RecQ	NA	J2YAJ8	Acanthamoeba_polyphaga_lentillevirus	31.9	1.1e-56
WP_168244945.1|5375381_5376419_-	RQC domain-containing protein	NA	NA	NA	NA	NA
WP_024030326.1|5376680_5376929_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	49.3	1.2e-16
WP_168244946.1|5377221_5377806_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_168244947.1|5378335_5379796_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP051128	Bacillus megaterium strain S2 chromosome, complete genome	6468885	6200812	6210188	6468885	transposase	Bacillus_phage(57.14%)	8	NA	NA
WP_168245624.1|6200812_6201556_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	7.0e-17
WP_168245625.1|6201665_6202999_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.9	1.1e-28
WP_168245626.1|6203146_6204520_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.4	6.0e-30
WP_168245627.1|6204497_6205208_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.8	2.9e-36
WP_168245628.1|6205553_6206918_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	36.9	2.4e-39
WP_168245629.1|6206953_6208471_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	29.0	2.9e-09
WP_168245630.1|6208485_6209028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088089532.1|6209453_6210188_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.0	7.9e-37
