The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041284	Escherichia coli strain 54 chromosome, complete genome	4659816	1055765	1068948	4659816		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1055765_1056527_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1056520_1057147_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1057286_1058426_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1058488_1059481_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1059574_1060939_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1061027_1061804_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1061808_1062447_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1062443_1063706_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1063702_1064611_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|1064806_1065574_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1065624_1066281_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_085438572.1|1066386_1068948_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	7.8e-31
>prophage 2
NZ_CP041284	Escherichia coli strain 54 chromosome, complete genome	4659816	1149989	1250453	4659816	terminase,transposase,head,integrase,portal,capsid,tRNA,tail,holin	Cronobacter_phage(44.68%)	103	1169589:1169605	1239301:1239317
WP_089566769.1|1149989_1151151_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000795662.1|1151518_1151725_+	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	6.5e-05
WP_000151178.1|1151745_1152045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572958.1|1152293_1152569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414984.1|1153110_1153674_-	hypothetical protein	NA	M1PL54	Cellulophaga_phage	44.9	1.8e-36
WP_000614786.1|1156417_1157314_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_151164936.1|1157310_1158207_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_021570914.1|1158196_1159753_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.3	1.1e-19
WP_088895425.1|1159845_1161073_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001384082.1|1161371_1162601_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.3	2.7e-207
WP_000162574.1|1163344_1163827_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600189.1|1163958_1164435_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1164424_1164715_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1164776_1165118_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|1165266_1166928_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1167013_1167892_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1168014_1168608_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|1168662_1169949_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
1169589:1169605	attL	GGTACAGCGCGGCAATG	NA	NA	NA	NA
WP_001338897.1|1169969_1170761_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1170927_1172289_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1172537_1172786_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1172804_1173353_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1173383_1174151_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1174192_1174540_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589847.1|1174615_1175098_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969032.1|1175113_1176340_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1176329_1176848_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|1176997_1177363_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168037.1|1177572_1178643_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225229.1|1178653_1179775_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200120.1|1179817_1180978_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010723158.1|1181076_1181124_-	phe operon leader peptide	NA	NA	NA	NA	NA
WP_077629794.1|1181287_1182307_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	57.2	5.9e-107
WP_000089404.1|1182346_1182646_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	54.2	5.9e-23
WP_000662537.1|1182754_1183036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000853270.1|1183062_1183398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681788.1|1183407_1183977_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	50.5	7.2e-46
WP_071988497.1|1183979_1184198_+	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	45.2	2.4e-05
WP_032292416.1|1184237_1186895_+	toprim domain protein	NA	A0A077K8T2	Ralstonia_phage	46.5	1.8e-240
WP_000909748.1|1186963_1187683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100224585.1|1187822_1188098_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	61.4	1.7e-24
WP_000746492.1|1188151_1189171_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	69.1	9.3e-137
WP_064670487.1|1189167_1190949_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	70.3	2.9e-250
WP_064670488.1|1191092_1191932_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	48.0	1.2e-44
WP_032295604.1|1191966_1192995_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.9	2.2e-133
WP_032292413.1|1193005_1193719_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	54.3	3.9e-65
WP_064670486.1|1193720_1193912_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	55.2	7.3e-11
WP_032292411.1|1193966_1194458_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	62.0	9.6e-47
WP_032292410.1|1194454_1194937_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	5.2e-37
WP_032292409.1|1194933_1195638_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	60.3	4.0e-70
WP_151140365.1|1195634_1196762_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.5	8.1e-174
WP_089587597.1|1196758_1197214_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.3e-58
WP_032292406.1|1197226_1197523_+|holin	holin	holin	C7BGD7	Burkholderia_phage	50.6	2.4e-16
WP_032292405.1|1197519_1197861_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	85.1	8.1e-45
WP_032292404.1|1197860_1198193_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	65.5	3.3e-35
WP_032292402.1|1198339_1198597_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	62.2	2.8e-21
WP_154205233.1|1198647_1198788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151140366.1|1198784_1200752_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.7	7.5e-268
WP_032292401.1|1200748_1201078_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	71.4	2.1e-37
WP_032292400.1|1201074_1202259_+	phage protein	NA	F1BUK6	Cronobacter_phage	78.9	3.3e-178
WP_032292399.1|1202251_1202839_+	protein phage	NA	F1BUK5	Cronobacter_phage	86.2	6.6e-95
WP_032292398.1|1202848_1204426_+|tail	tail protein	tail	F1BUK3	Cronobacter_phage	80.7	2.7e-135
WP_064670485.1|1204425_1205013_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	56.0	3.6e-56
WP_064670484.1|1205002_1205728_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	51.9	3.6e-58
WP_032292395.1|1205699_1206245_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	1.6e-63
WP_032292425.1|1206247_1207948_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	79.3	3.7e-223
WP_032187555.1|1208979_1210167_-	acyltransferase	NA	NA	NA	NA	NA
WP_000178456.1|1210310_1210652_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1210922_1211660_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079100.1|1211794_1212775_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040169.1|1212771_1213503_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_064670483.1|1213632_1216206_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.0e-127
WP_000841103.1|1222060_1223359_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|1223355_1223679_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1223724_1225080_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000083005.1|1225193_1227854_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001300438.1|1227885_1228584_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1228652_1229072_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1229278_1230316_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|1230363_1231053_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|1231357_1231741_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|1231796_1232384_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_053286107.1|1232486_1233368_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|1233576_1234911_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001295363.1|1235042_1235780_+|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
WP_001094491.1|1235764_1237387_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001303621.1|1237642_1237798_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001295364.1|1237794_1238370_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168459.1|1238402_1239053_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812053.1|1239052_1240009_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
1239301:1239317	attR	GGTACAGCGCGGCAATG	NA	NA	NA	NA
WP_000589068.1|1240005_1240485_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790168.1|1240682_1242482_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002541.1|1242497_1243472_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|1243743_1244424_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000020749.1|1244420_1245326_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399404.1|1245337_1246066_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_001297412.1|1246077_1246809_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986023.1|1246808_1247189_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000128776.1|1247609_1247690_+	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_001196283.1|1247883_1248144_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
WP_001013779.1|1248199_1249048_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190655.1|1249256_1249892_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001295367.1|1249916_1250453_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP041284	Escherichia coli strain 54 chromosome, complete genome	4659816	1463031	1475056	4659816	plate,integrase	Enterobacteria_phage(57.14%)	15	1459923:1459939	1477066:1477082
1459923:1459939	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_151140423.1|1463031_1463550_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	64.8	1.7e-54
WP_089519078.1|1463593_1464172_-	HNH endonuclease	NA	K7PHS8	Enterobacteria_phage	99.0	1.2e-109
WP_001614322.1|1464158_1464335_-	DUF2737 family protein	NA	K7PL43	Enterobacteria_phage	100.0	3.7e-25
WP_000753555.1|1464351_1464666_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_000041317.1|1464677_1465160_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.8	1.4e-79
WP_064670570.1|1465439_1466519_+	hypothetical protein	NA	Q8SBG7	Shigella_phage	99.2	2.9e-205
WP_086375688.1|1466518_1467067_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	5.6e-96
WP_000424744.1|1467066_1467492_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	3.9e-81
WP_064670569.1|1467478_1468537_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	99.7	3.0e-202
WP_064670568.1|1468527_1469112_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	1.2e-112
WP_001349560.1|1470130_1470547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062896641.1|1470801_1471929_-	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	31.1	3.8e-30
WP_064670333.1|1472258_1472648_+	hypothetical protein	NA	K7P6F7	Enterobacteria_phage	87.5	4.6e-60
WP_064670332.1|1472654_1473812_-|integrase	prophage integrase IntS	integrase	Q716F9	Shigella_phage	98.2	1.0e-219
WP_000368140.1|1474123_1475056_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
1477066:1477082	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP041284	Escherichia coli strain 54 chromosome, complete genome	4659816	1715019	1724460	4659816		Enterobacteria_phage(85.71%)	10	NA	NA
WP_064670440.1|1715019_1715946_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	31.1	2.2e-23
WP_000783120.1|1715950_1716682_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1716662_1716770_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1716829_1717561_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1717782_1719468_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1719464_1720184_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1720230_1720701_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1720740_1721202_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001402348.1|1721326_1723327_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_064670439.1|1723323_1724460_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	9.4e-162
>prophage 5
NZ_CP041284	Escherichia coli strain 54 chromosome, complete genome	4659816	1816691	1824658	4659816		Klebsiella_phage(16.67%)	8	NA	NA
WP_064670358.1|1816691_1818086_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
WP_000999466.1|1818243_1819239_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_000183034.1|1819481_1820375_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	2.3e-46
WP_000699411.1|1820746_1821832_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	8.8e-101
WP_000676086.1|1821831_1822695_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	68.1	2.0e-111
WP_001025599.1|1822698_1823094_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_000971201.1|1823090_1823558_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000564888.1|1823554_1824658_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.1	8.0e-41
>prophage 6
NZ_CP041284	Escherichia coli strain 54 chromosome, complete genome	4659816	1893712	1903633	4659816	transposase	Burkholderia_phage(33.33%)	10	NA	NA
WP_088895425.1|1893712_1894941_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_072134966.1|1895029_1895839_-	porin	NA	Q1MVN1	Enterobacteria_phage	50.3	8.1e-67
WP_001313057.1|1896404_1896770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365561.1|1896809_1897505_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001157230.1|1897571_1898990_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.7	3.0e-101
WP_000786004.1|1898970_1899441_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001507517.1|1899429_1900350_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|1900522_1901440_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009306.1|1901518_1901701_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001564714.1|1901938_1903633_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
>prophage 7
NZ_CP041284	Escherichia coli strain 54 chromosome, complete genome	4659816	2284003	2299808	4659816	lysis	Salmonella_phage(25.0%)	15	NA	NA
WP_000041681.1|2284003_2286430_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	4.5e-214
WP_001300836.1|2286628_2286934_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2287041_2287752_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2287754_2288315_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2288349_2288691_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2288825_2289152_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2289357_2290572_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|2290583_2291603_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|2291660_2291789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876986.1|2291790_2293071_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_000005552.1|2293105_2293357_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_021570798.1|2293429_2295901_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	4.2e-58
WP_001083297.1|2295993_2296185_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2296181_2296370_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000527809.1|2298347_2299808_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
>prophage 8
NZ_CP041284	Escherichia coli strain 54 chromosome, complete genome	4659816	3522128	3678169	4659816	terminase,transposase,protease,lysis,integrase,plate,head,capsid,portal,tail,holin	Shigella_phage(32.26%)	174	3550853:3550912	3663652:3664419
WP_088895425.1|3522128_3523357_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000983410.1|3523507_3524179_+	LysE family transporter	NA	NA	NA	NA	NA
WP_000290616.1|3524195_3524441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301260.1|3524853_3525669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000692754.1|3525911_3526961_-	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
WP_000665120.1|3527337_3528720_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_000661619.1|3528729_3529680_-	carbamate kinase family protein	NA	NA	NA	NA	NA
WP_001295687.1|3529755_3530052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000083429.1|3530101_3531520_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000111836.1|3531519_3533067_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_001310582.1|3533056_3533920_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_064670549.1|3533959_3534565_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001013892.1|3534822_3535320_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001084399.1|3535411_3536344_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301264.1|3536385_3537474_-	DNA-binding transcriptional activator/c-di-GMP phosphodiesterase PdeL	NA	NA	NA	NA	NA
WP_120795374.1|3538745_3538820_-	protein YahV	NA	NA	NA	NA	NA
WP_000131044.1|3539125_3541159_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3541287_3541875_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3541888_3543361_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3543374_3545045_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3545257_3545926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3546168_3546864_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_064670551.1|3546856_3548284_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3548294_3549014_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3549540_3550395_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
3550853:3550912	attL	GGTAGTGACTCCAACTTACTGATAGTGTTTTATGTTCAGATAATGCCCGATGACCTTGTC	NA	NA	NA	NA
WP_000474084.1|3552830_3553067_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3553078_3553672_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|3554261_3555113_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000662258.1|3559239_3559341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3559704_3559968_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3559967_3560108_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3560142_3560370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3561193_3561736_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3561810_3562398_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3562455_3563124_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|3563149_3565675_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|3565664_3567308_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3567276_3567987_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3568299_3568629_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3568876_3569491_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|3569908_3570598_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3570594_3571551_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_053286015.1|3571547_3573746_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	26.1	1.9e-38
WP_000121359.1|3573755_3574712_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3574690_3575101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064670530.1|3575669_3576686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064670529.1|3577146_3578379_+	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	99.3	4.3e-237
WP_064670528.1|3578507_3579092_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	4.3e-102
WP_151140399.1|3579091_3582442_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000453558.1|3583014_3583560_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_000025003.1|3583897_3584218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085438473.1|3584598_3585042_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	82.8	7.3e-62
WP_000186784.1|3585562_3586243_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.7	2.3e-131
WP_072126246.1|3586239_3586422_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_000548531.1|3586394_3586586_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|3586596_3586878_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_085438467.1|3586976_3587195_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	97.2	1.4e-34
WP_000488407.1|3587242_3587521_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_053271768.1|3587719_3588883_+|integrase	site-specific integrase	integrase	S5FNS2	Shigella_phage	99.7	9.1e-229
WP_085438561.1|3589385_3589538_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	86.2	3.9e-07
WP_085438563.1|3590133_3591216_+	acyltransferase	NA	W6MVL2	Pseudomonas_phage	22.9	4.0e-05
WP_021548946.1|3591261_3591426_-	hypothetical protein	NA	A0A077KCA4	Edwardsiella_phage	64.5	2.1e-06
WP_136710480.1|3591436_3591853_-|tail	tail assembly chaperone	tail	A0A077KAY3	Edwardsiella_phage	55.3	4.5e-13
WP_064670553.1|3592855_3593194_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	93.4	3.6e-53
WP_000774473.1|3593190_3593481_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.1e-47
WP_000211034.1|3593473_3593644_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_064670554.1|3593643_3594099_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.8e-60
WP_072097297.1|3594095_3594197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074400827.1|3594291_3595074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064670555.1|3595248_3595572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709067.1|3595683_3597210_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	7.9e-31
WP_001301135.1|3597267_3597417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|3597465_3597798_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3597865_3598168_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788886.1|3598164_3598866_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	99.6	9.9e-130
WP_064670557.1|3598862_3599792_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	1.6e-111
WP_064670556.1|3599878_3600418_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	5.8e-61
WP_000184665.1|3600448_3600676_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001295669.1|3600786_3601479_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000380252.1|3601559_3602621_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|3602598_3602976_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000233576.1|3603451_3603658_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_033561765.1|3603733_3604030_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_074400828.1|3604035_3604863_+	phage recombination protein Bet	NA	A0A0P0ZDB4	Stx2-converting_phage	87.6	4.0e-114
WP_024220864.1|3605640_3606435_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000218773.1|3606516_3606870_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_029380176.1|3607153_3607435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071840188.1|3608385_3608643_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_000470135.1|3608697_3610443_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_000926290.1|3610411_3610660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082070.1|3610631_3611612_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_000784327.1|3612304_3613444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072161528.1|3613997_3615212_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_094304446.1|3615246_3616680_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	49.9	5.4e-106
WP_000355484.1|3617083_3617857_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_151140400.1|3617917_3618472_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.7	5.3e-86
WP_001008234.1|3618931_3619375_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_151140401.1|3619346_3619949_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	92.5	1.7e-101
WP_151140402.1|3619948_3620671_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	93.5	1.6e-50
WP_063073499.1|3620674_3621259_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	2.0e-112
WP_028125900.1|3621249_3622308_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.9	1.2e-200
WP_000424744.1|3622294_3622720_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	3.9e-81
WP_052921837.1|3622719_3623268_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	2.5e-96
WP_063073500.1|3623267_3624347_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.2	3.4e-206
WP_063073501.1|3624343_3625672_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_040072272.1|3625725_3626403_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	45.6	6.6e-46
WP_063073503.1|3626484_3628266_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	91.8	9.8e-275
WP_001314907.1|3628258_3628441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661054.1|3628407_3628677_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090998.1|3628676_3629033_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_151140403.1|3629032_3630529_-|tail	phage tail protein	tail	U5P0H3	Shigella_phage	98.4	1.4e-274
WP_063073505.1|3630512_3630683_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	7.9e-25
WP_000779292.1|3630691_3631252_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000224836.1|3631248_3631755_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702401.1|3631729_3632140_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.9	8.0e-71
WP_000927711.1|3632136_3632460_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|3632462_3632663_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_063073507.1|3632712_3633918_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	1.3e-222
WP_001193640.1|3633932_3634583_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	5.6e-119
WP_000466255.1|3634560_3635802_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605605.1|3635801_3635984_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
WP_072011717.1|3635995_3637492_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_063073508.1|3637730_3638216_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	98.8	1.4e-85
WP_001135220.1|3638341_3638692_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	95.7	1.2e-62
WP_000738423.1|3639216_3639510_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_123010240.1|3639600_3639783_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	95.0	2.1e-15
WP_001197766.1|3639999_3640476_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120496.1|3640479_3640806_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_001532221.1|3641124_3642222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021552536.1|3642232_3642655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073510.1|3642647_3643283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021552535.1|3643258_3643645_-	hypothetical protein	NA	A5LH77	Enterobacteria_phage	90.0	6.8e-56
WP_021552534.1|3643663_3644653_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	6.2e-194
WP_001061445.1|3644660_3645470_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	4.0e-151
WP_000767103.1|3645489_3645879_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_061356387.1|3645875_3646202_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	2.9e-52
WP_074149693.1|3646201_3646696_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	8.1e-86
WP_061356389.1|3646692_3647634_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.4	5.0e-153
WP_001250269.1|3647623_3647803_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_063073513.1|3647978_3648536_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	2.6e-96
WP_000649477.1|3648579_3648780_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|3648870_3649545_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000549626.1|3649779_3649986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|3649957_3650392_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000008236.1|3650936_3651473_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242749.1|3651463_3651826_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|3651825_3652131_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|3652357_3653521_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893278.1|3653725_3654979_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|3654990_3656094_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3656381_3657437_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_000174677.1|3657475_3657877_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|3657934_3659179_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3659270_3659729_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293003.1|3659989_3661447_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001353768.1|3661503_3662061_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001321003.1|3661972_3662239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059847.1|3662472_3662925_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263493.1|3663711_3664110_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|3664112_3664406_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|3664457_3665513_-	DNA polymerase IV	NA	NA	NA	NA	NA
3663652:3664419	attR	GACAAGGTCATCGGGCATTATCTGAACATAAAACACTATCAGTAAGTTGGAGTCACTACCTCAAAAACGCATGCGAAACGCTTCTGCCATTTTCCCAATTTTATGCATTTGGTTGTTATCTCGAGCCTGTTTATGAGGTTCAGGTTTCAGAATGGCAATGAGCAACCATGCTTGCTCATCAAACGCACCCTGACAATATACCAAATGCGCTTCGTCATTCGTTCTGCTGAATTGGCGCAACTGTGGCGGAAATGGATTATTCACATTTGCCAGATGAATATGAGCAACTCGCTCAAATTTGATTAATGGCCAGGTAAACGAGTCGTCGTAGAGTGCATCGCGACCAAATATATCTGGCAAAACACCGTCACGCTTATAGGAAATAAAATCCGCCGTTAACGCATCAAGTTCCTCTGCTGTAAGTTGCAGGCGAATAAGTTTTGTTTTGAATACCCGCATCCTTATTCCTTAAAGTCATTGAAATCATCATCCGTCATATCATTAAGATATTTTTCAGCTCGGCGTGTAATTTCCTCTAATCTTGCAGCACTTGGACGGAAGCGCGCCTTTATGGGCTTTTTCTCCTCTTGTTCAGCAAGCATGTCCATTAACGCTTCGAATGCGCTGGCACTTAAGAGATATCCTGCGGGGCGATTATTAGAAAGAACCGCAACCGGTTGATCAATAAAGTATTTAGCTGGGTTTTTACGTAACTCAGTAATATTGACCGATTTTTCAGCGAGAATTCGATGCATGCAGTGATCCCCT	NA	NA	NA	NA
WP_000207587.1|3665583_3666369_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|3666313_3668053_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|3668276_3668774_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_024192679.1|3668949_3669699_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000729703.1|3669908_3670169_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615983.1|3670171_3670450_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3670605_3671346_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|3671316_3672084_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3672289_3672868_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|3673107_3675552_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|3675594_3676068_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118036.1|3676221_3676992_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_032227780.1|3677032_3678169_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP041286	Escherichia coli strain 54 plasmid p54-tetX, complete sequence	102347	1204	57245	102347	transposase,integrase	Escherichia_phage(32.0%)	55	NA	NA
WP_077816224.1|1204_2173_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	5.7e-184
WP_033548869.1|2339_2756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039462.1|3340_3676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515192.1|3684_3876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|5003_5759_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_161955224.1|6427_6562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160784086.1|6883_7024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|7118_7823_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000105383.1|7908_9345_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001067858.1|9611_10316_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001516695.1|11017_11674_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001067845.1|11834_12539_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_001814923.1|13891_14008_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_025989258.1|14023_15943_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A2K5B2A5	Erysipelothrix_phage	96.4	0.0e+00
WP_000336323.1|16061_16229_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_136655701.1|16236_16467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077141251.1|17524_18019_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000027057.1|18129_18990_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|19172_19730_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001531602.1|19893_22899_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.9	0.0e+00
WP_001351729.1|23699_24092_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|24229_25114_+	EamA family transporter	NA	NA	NA	NA	NA
WP_001493765.1|25145_26345_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001493764.1|26450_27101_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|27132_27375_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_166498031.1|27432_28008_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	2.8e-90
WP_001067858.1|27998_28703_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001255015.1|29521_29827_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034167813.1|29854_31069_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.6	1.5e-19
WP_001447541.1|31285_32170_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_072051933.1|32200_33547_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_136655511.1|33578_34034_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_136655510.1|34256_34886_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	37.1	8.3e-19
WP_136655509.1|34933_36547_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	30.9	1.1e-30
WP_001120888.1|36908_38402_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_164538593.1|38740_39877_-	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_151140429.1|39887_40784_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_164538590.1|41149_41287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077250842.1|41514_42345_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067858.1|42424_43129_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001317507.1|43457_43931_-	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
WP_000845048.1|44086_45100_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067858.1|45245_45950_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_109023896.1|47029_47305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|47307_48099_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|48567_48813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054377175.1|48850_49714_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_032492336.1|49859_51089_-	macrolide efflux MFS transporter Mef(B)	NA	A0A1B0RXG2	Streptococcus_phage	39.0	2.1e-74
WP_001067855.1|51216_51921_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000105636.1|52193_53888_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|53939_54362_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|54397_54673_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|54686_55037_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|55108_55543_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|56540_57245_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
