The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038498	Pectobacterium punjabense strain SS95 chromosome, complete genome	4793778	1596564	1605377	4793778		Escherichia_phage(28.57%)	9	NA	NA
WP_107169878.1|1596564_1597437_+	SDR family oxidoreductase	NA	A0A167RG57	Powai_lake_megavirus	34.9	4.4e-34
WP_107169879.1|1597433_1598564_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	51.1	5.5e-106
WP_107169880.1|1598563_1599763_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_107169881.1|1599764_1600178_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_107169882.1|1600347_1601196_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.1	5.3e-45
WP_107169883.1|1601192_1601729_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	59.8	1.1e-59
WP_107169884.1|1601730_1602600_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	68.1	8.3e-110
WP_107169885.1|1602843_1603740_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.6	3.2e-48
WP_107169886.1|1603970_1605377_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D7RI04	Synechococcus_phage	29.9	8.6e-32
>prophage 2
NZ_CP038498	Pectobacterium punjabense strain SS95 chromosome, complete genome	4793778	1870594	1932251	4793778	protease,transposase,integrase,plate,tail,tRNA	Burkholderia_phage(30.77%)	63	1862920:1862935	1937771:1937786
1862920:1862935	attL	CTAAATAATTCGAGTT	NA	NA	NA	NA
WP_107167930.1|1870594_1871527_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_107167931.1|1871669_1873082_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_107167932.1|1873074_1874010_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_107167933.1|1874026_1874575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107167934.1|1874948_1875491_+	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_107167935.1|1875551_1875908_+	FMN-binding protein	NA	NA	NA	NA	NA
WP_107167936.1|1875969_1876479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107167937.1|1876629_1877577_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_107167938.1|1877643_1878330_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_107167939.1|1878477_1879248_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_107167940.1|1879279_1880932_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_107167941.1|1880928_1881939_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	5.8e-30
WP_107167942.1|1882016_1883036_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_107167943.1|1883450_1884797_+	aspartate aminotransferase family protein	NA	M9MUV3	Rhodococcus_phage	30.9	8.9e-10
WP_107167944.1|1885159_1887466_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_107167945.1|1887587_1888127_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_107167946.1|1888409_1889057_-	LysE family transporter	NA	NA	NA	NA	NA
WP_107167947.1|1889109_1889943_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_107167948.1|1890124_1892224_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.4	6.2e-42
WP_107167949.1|1892852_1894283_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_107167950.1|1894388_1894700_+|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
WP_107167951.1|1894717_1896445_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	33.2	5.1e-26
WP_107167952.1|1896473_1897802_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_107167953.1|1897804_1899172_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_010281025.1|1899388_1899718_+	membrane protein	NA	A4JWP3	Burkholderia_virus	58.3	1.2e-24
WP_100017071.1|1899719_1900331_+	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	59.1	1.0e-58
WP_107167954.1|1900320_1900995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010281034.1|1900984_1901314_+	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	45.8	1.5e-19
WP_107167955.1|1901306_1901618_+	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	47.4	2.8e-20
WP_107167956.1|1901861_1902329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107167957.1|1902325_1902523_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	58.5	1.9e-09
WP_107167958.1|1902512_1903940_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	72.5	1.3e-200
WP_010281046.1|1903939_1904464_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	67.2	1.6e-68
WP_107167959.1|1904606_1904927_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_086002476.1|1904871_1905015_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_107167986.1|1905237_1907649_+|tail	phage tail tape measure protein	tail	A0A077K8S2	Ralstonia_phage	28.9	9.0e-21
WP_107167960.1|1907648_1908578_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	41.1	2.1e-42
WP_107167961.1|1908567_1908780_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	58.6	2.6e-17
WP_107167962.1|1908767_1909928_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	49.3	1.5e-85
WP_107167963.1|1909924_1910506_+|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	44.2	1.4e-23
WP_010286901.1|1910565_1910913_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	63.0	8.6e-34
WP_107167964.1|1910903_1912007_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	53.3	4.7e-102
WP_107167965.1|1911999_1912581_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	62.2	9.6e-62
WP_165800623.1|1914655_1914823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107167966.1|1914882_1915317_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	62.0	2.9e-31
WP_107167967.1|1915426_1916395_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_107167968.1|1916481_1918350_+	peptidase M3	NA	NA	NA	NA	NA
WP_107167969.1|1918389_1919112_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	3.0e-36
WP_107167970.1|1919108_1919768_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_107167971.1|1919794_1920541_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_107167972.1|1920938_1921442_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.9	1.8e-08
WP_107167973.1|1921754_1922306_+	AAA family ATPase	NA	A0A097BYE2	Leuconostoc_phage	27.3	6.8e-17
WP_107167974.1|1922302_1923184_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_107167975.1|1923561_1924077_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.0	7.0e-16
WP_107167976.1|1924342_1925512_+	MFS transporter	NA	NA	NA	NA	NA
WP_107167977.1|1925555_1926959_-	EmmdR/YeeO family multidrug/toxin efflux MATE transporter	NA	NA	NA	NA	NA
WP_107167978.1|1927333_1927870_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_107167979.1|1927928_1928258_+	DHCW motif cupin fold protein	NA	NA	NA	NA	NA
WP_107167980.1|1928498_1928981_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_107167981.1|1929275_1929815_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_107167982.1|1930064_1930310_-	YmjA family protein	NA	NA	NA	NA	NA
WP_107171070.1|1930566_1931731_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	86.2	4.8e-161
WP_107170054.1|1931735_1932251_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	41.4	3.3e-29
1937771:1937786	attR	AACTCGAATTATTTAG	NA	NA	NA	NA
>prophage 3
NZ_CP038498	Pectobacterium punjabense strain SS95 chromosome, complete genome	4793778	2228148	2238143	4793778	tRNA	Tupanvirus(33.33%)	11	NA	NA
WP_107170607.1|2228148_2230077_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	3.0e-128
WP_107170606.1|2230079_2230622_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.5	3.7e-15
WP_010275699.1|2230735_2230933_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005968887.1|2230976_2231333_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_133169876.1|2231398_2231497_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_039489639.1|2231660_2232644_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	39.3	4.5e-35
WP_107170605.1|2232658_2235046_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.9	7.8e-09
WP_005968881.1|2235050_2235347_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	5.5e-13
WP_165800674.1|2235414_2235855_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_107170603.1|2235908_2236286_-	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_107170602.1|2236424_2238143_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.4	2.9e-58
>prophage 4
NZ_CP038498	Pectobacterium punjabense strain SS95 chromosome, complete genome	4793778	2889958	2925359	4793778	protease,holin,transposase	uncultured_Caudovirales_phage(20.0%)	35	NA	NA
WP_107167731.1|2889958_2890618_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	48.4	3.9e-43
WP_107167732.1|2890772_2891102_+	sulfurtransferase TusE	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	50.0	2.5e-22
WP_107167733.1|2891112_2891391_-	acylphosphatase	NA	NA	NA	NA	NA
WP_107167734.1|2891621_2891930_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_107167735.1|2892010_2892424_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_014700457.1|2892619_2893144_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_107167736.1|2893281_2893740_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_107167737.1|2893818_2895876_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.4	3.3e-16
WP_107167738.1|2896062_2896509_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_107167739.1|2896529_2898665_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_107167740.1|2898681_2899302_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_107167741.1|2899523_2900030_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_107167742.1|2900392_2901478_+	porin OmpA	NA	NA	NA	NA	NA
WP_107167743.1|2901629_2902091_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_107167744.1|2902268_2904038_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_107167745.1|2904129_2904648_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_165800620.1|2904744_2905404_-	DUF533 domain-containing protein	NA	NA	NA	NA	NA
WP_107167747.1|2905544_2907224_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.7	2.2e-58
WP_107167748.1|2907243_2908716_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_107167749.1|2908783_2909371_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_107167750.1|2909722_2911756_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.2	4.4e-21
WP_010287191.1|2911973_2912612_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_107167751.1|2913290_2913602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107167752.1|2913802_2914024_+	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_107167753.1|2914430_2915219_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	74.4	1.2e-88
WP_107167754.1|2915750_2916266_-	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_014915881.1|2916469_2917192_-	RNA polymerase sigma factor FliA	NA	A0A2I5ARC7	Synechococcus_phage	32.2	1.2e-05
WP_107167811.1|2918579_2918690_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_107167755.1|2918912_2919719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107167756.1|2919785_2920559_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_107167812.1|2920549_2921623_+	CDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	27.2	3.0e-16
WP_107167757.1|2921637_2922168_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	40.1	5.9e-26
WP_107167813.1|2922200_2923025_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_107167814.1|2923109_2924114_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_107167758.1|2924250_2925359_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.6	3.8e-43
>prophage 5
NZ_CP038498	Pectobacterium punjabense strain SS95 chromosome, complete genome	4793778	2977658	3037702	4793778	integrase,tRNA,transposase	Leptospira_phage(22.22%)	57	3012244:3012267	3045377:3045400
WP_168444505.1|2977658_2978806_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.0e-47
WP_107170987.1|2979029_2979248_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_107170986.1|2979464_2979821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107170984.1|2980328_2980757_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_107170983.1|2980756_2980987_-	antitoxin	NA	NA	NA	NA	NA
WP_107170988.1|2981080_2981914_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_107170982.1|2982031_2982352_-	toxin	NA	NA	NA	NA	NA
WP_129705773.1|2982420_2982756_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_107169985.1|2982795_2983269_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_107169984.1|2983391_2983742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107169983.1|2983799_2984633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165800660.1|2984779_2984938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107169982.1|2985121_2986009_-	GTP-binding protein HSR1	NA	NA	NA	NA	NA
WP_107169981.1|2986103_2987036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107169980.1|2987589_2988192_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_107169979.1|2988279_2988492_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	47.9	6.7e-05
WP_107169978.1|2988601_2989183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107169977.1|2989444_2990854_+	flagellin	NA	NA	NA	NA	NA
WP_107171160.1|2990866_2991975_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.6	3.1e-45
WP_107170909.1|2994037_2995024_+	DNA (cytosine-5-)-methyltransferase	NA	A7XXH6	Thermus_virus	41.3	3.6e-61
WP_107170905.1|2995020_2997384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107170906.1|2997376_2999068_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	31.0	1.3e-34
WP_107170907.1|2999064_2999643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107170908.1|2999645_3000104_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	48.8	5.8e-30
WP_107171160.1|3000366_3001474_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.6	3.1e-45
WP_107168534.1|3002207_3003464_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	2.4e-81
WP_107168533.1|3004102_3004651_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_107168532.1|3004709_3006542_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_010279369.1|3006534_3007191_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_107168531.1|3007828_3008053_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_107168530.1|3008147_3008435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107168529.1|3009299_3010712_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_168444506.1|3010881_3011148_-	anti-adapter protein IraP	NA	NA	NA	NA	NA
3012244:3012267	attL	GTTCGAGTCCAGTCAGAGGAGCCA	NA	NA	NA	NA
WP_107168526.1|3012446_3013724_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.5	3.2e-78
WP_107168525.1|3013833_3014583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100016978.1|3015063_3015243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107168524.1|3015392_3015602_-	DUF4926 domain-containing protein	NA	NA	NA	NA	NA
WP_107168523.1|3015601_3017380_-	S-type Pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_107168522.1|3017541_3019062_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_107168521.1|3019199_3019757_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_107168520.1|3019838_3020075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107168519.1|3020176_3020578_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_107168518.1|3020655_3021015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103182486.1|3021120_3021405_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_107168517.1|3021401_3021656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168444507.1|3022014_3022506_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_107168515.1|3023244_3024666_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_133169852.1|3025047_3026226_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_107168513.1|3028129_3029995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107168512.1|3030064_3030724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107168511.1|3030740_3031295_-	lipoprotein	NA	NA	NA	NA	NA
WP_107168510.1|3031932_3032310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133169851.1|3032404_3033343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107168508.1|3033498_3034185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107168507.1|3035275_3035929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107168506.1|3036868_3037255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165800632.1|3037366_3037702_-|transposase	transposase	transposase	NA	NA	NA	NA
3045377:3045400	attR	GTTCGAGTCCAGTCAGAGGAGCCA	NA	NA	NA	NA
>prophage 6
NZ_CP038498	Pectobacterium punjabense strain SS95 chromosome, complete genome	4793778	3524131	3531202	4793778	transposase	Mycobacterium_phage(28.57%)	7	NA	NA
WP_107168428.1|3524131_3525121_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.1	1.5e-22
WP_011094848.1|3525784_3526024_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	58.1	4.5e-18
WP_010280810.1|3526034_3526442_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A220BYR7	Staphylococcus_phage	26.5	1.1e-06
WP_107169952.1|3526438_3528586_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.1	1.3e-204
WP_107169953.1|3528610_3529573_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.8	6.1e-138
WP_107169954.1|3529944_3530682_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	37.6	3.6e-37
WP_165800658.1|3530635_3531202_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.0	6.9e-49
