The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051260	Proteus mirabilis strain STP3 chromosome, complete genome	4115975	860429	916203	4115975	protease,holin,transposase	Morganella_phage(28.57%)	46	NA	NA
WP_102140835.1|860429_861582_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	38.6	7.8e-47
WP_049199436.1|861827_863039_+	MFS transporter	NA	NA	NA	NA	NA
WP_049210456.1|863049_864183_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_110706741.1|864185_864632_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004244955.1|864968_866963_+	transketolase	NA	NA	NA	NA	NA
WP_004244954.1|867221_868241_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_004247314.1|868343_869507_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_004244952.1|869571_870651_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_004244951.1|870741_870954_-	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	62.2	1.0e-05
WP_110706740.1|871216_872695_-	dipeptide/tripeptide permease DtpB	NA	NA	NA	NA	NA
WP_004244949.1|873318_873837_-	4-hydroxyphenylacetate 3-monooxygenase, reductase component	NA	NA	NA	NA	NA
WP_004252455.1|873944_874136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244947.1|874412_874850_+	homoprotocatechuate degradation operon regulator HpaR	NA	NA	NA	NA	NA
WP_004247316.1|874920_876924_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.0	8.0e-23
WP_012367525.1|877292_877958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244944.1|878207_878882_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_110706739.1|878964_879882_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_004244940.1|881129_881657_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_110706738.1|881896_884524_+	outer membrane usher protein	NA	NA	NA	NA	NA
WP_004244938.1|884572_885331_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_004244937.1|885342_885897_+	fimbrial protein	NA	NA	NA	NA	NA
WP_004244936.1|885910_886429_+	fimbrial protein	NA	NA	NA	NA	NA
WP_004247321.1|886439_886976_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004247322.1|886994_887843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244929.1|887863_888184_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	41.8	1.1e-06
WP_004247323.1|888748_889315_-	phase variation DNA invertase MrpI	NA	A0A2L1IV36	Escherichia_phage	52.4	2.0e-51
WP_004247325.1|889993_890521_+	MR/P fimbria major subunit MrpA	NA	NA	NA	NA	NA
WP_023843516.1|890618_891167_+	MR/P fimbria assembly terminator MrpB	NA	NA	NA	NA	NA
WP_004247328.1|891189_893805_+	MR/P fimbria usher protein MrpC	NA	NA	NA	NA	NA
WP_110706737.1|893860_894619_+	MR/P fimbria assembly chaperone MrpD	NA	NA	NA	NA	NA
WP_004244923.1|894632_895178_+	fimbrial protein	NA	NA	NA	NA	NA
WP_004244922.1|895190_895676_+	fimbrial protein	NA	NA	NA	NA	NA
WP_004244920.1|895686_896235_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004244918.1|896256_897084_+	MR/P fimbria adhesin subunit MrpH	NA	NA	NA	NA	NA
WP_004244917.1|897105_897429_+	transcriptional regulator MrpJ	NA	A0A1W6JNW5	Morganella_phage	55.3	1.6e-05
WP_004244916.1|898052_899627_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_004244915.1|899666_900044_-	DUF1992 domain-containing protein	NA	NA	NA	NA	NA
WP_004244914.1|900175_900514_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004247331.1|900866_902513_+	lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase	NA	NA	NA	NA	NA
WP_110706736.1|903001_904354_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_004247333.1|904353_905679_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_110706735.1|905695_907435_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.0	1.4e-28
WP_004247335.1|907597_909073_-|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_107337183.1|909675_911739_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_168725578.1|911967_913932_-|protease	metalloprotease	protease	NA	NA	NA	NA
WP_107337182.1|914238_916203_-|protease	metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP051260	Proteus mirabilis strain STP3 chromosome, complete genome	4115975	1062045	1070579	4115975		Mycobacterium_phage(28.57%)	9	NA	NA
WP_004246075.1|1062045_1063245_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_004247427.1|1063853_1064822_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_004252248.1|1064847_1066974_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004246072.1|1067002_1067407_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|1067418_1067643_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|1067924_1068398_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|1068595_1068805_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246061.1|1069107_1069596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246058.1|1070204_1070579_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
>prophage 3
NZ_CP051260	Proteus mirabilis strain STP3 chromosome, complete genome	4115975	1110238	1156478	4115975	integrase,tail,capsid,lysis,terminase	Morganella_phage(52.5%)	64	1110152:1110170	1163390:1163408
1110152:1110170	attL	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
WP_159241546.1|1110238_1111240_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.0	7.4e-70
WP_004246013.1|1111196_1111442_-	excisionase	NA	NA	NA	NA	NA
WP_168725584.1|1112607_1113288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827452.1|1113359_1113869_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	57.3	4.9e-54
WP_017827451.1|1113868_1114480_-	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	69.2	1.1e-73
WP_017628824.1|1114481_1114802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628823.1|1114798_1114951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036919938.1|1114947_1115211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165439118.1|1115218_1115374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036919939.1|1115427_1115688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628819.1|1115887_1116385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245994.1|1116406_1116724_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	7.1e-19
WP_036908285.1|1117178_1117544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908283.1|1117540_1118320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908281.1|1118354_1118999_-	LexA family transcriptional regulator	NA	A0A077KGZ5	Edwardsiella_phage	65.0	1.9e-79
WP_004247477.1|1119104_1119314_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	83.3	1.2e-25
WP_049256531.1|1119459_1119807_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.9	1.1e-36
WP_004251793.1|1119902_1120076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036895070.1|1120072_1120840_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	51.9	1.5e-22
WP_017628813.1|1120839_1122225_+	AAA family ATPase	NA	Q716D2	Shigella_phage	47.7	1.4e-114
WP_063215454.1|1122252_1122582_+	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	39.0	1.1e-22
WP_036919942.1|1122649_1123099_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.9e-13
WP_004245984.1|1123177_1123468_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_004245983.1|1123464_1123821_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_004245982.1|1123820_1124453_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	3.3e-23
WP_004247148.1|1124764_1125286_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_060555895.1|1125444_1125867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247489.1|1125920_1126190_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	6.0e-19
WP_017628809.1|1126189_1126660_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
WP_012367623.1|1126641_1126800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367624.1|1126802_1127264_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	45.8	6.3e-24
WP_004247494.1|1127611_1128196_+	Bro-N domain-containing protein	NA	Q3LZN7	Bacteriophage	48.2	2.0e-22
WP_004245979.1|1128192_1128399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245978.1|1128395_1128554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367626.1|1128581_1129190_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	68.5	2.2e-64
WP_134940265.1|1129192_1130677_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	88.9	2.7e-270
WP_168725585.1|1130678_1132055_+	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	78.4	1.3e-210
WP_017628801.1|1132063_1133128_+|capsid	minor capsid protein	capsid	A0A1W6JNT7	Morganella_phage	51.4	9.2e-103
WP_017628800.1|1133202_1133889_+	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	81.1	3.4e-74
WP_017827430.1|1133894_1134845_+	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	87.1	1.3e-153
WP_017628798.1|1134887_1135265_+	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	71.2	5.8e-44
WP_017628797.1|1135266_1135608_+	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	79.6	1.2e-51
WP_017628796.1|1135610_1135979_+	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	83.6	3.3e-52
WP_017628795.1|1135975_1136347_+	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	70.7	1.5e-47
WP_026164642.1|1136411_1137167_+	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	77.3	9.1e-105
WP_017827425.1|1137216_1137909_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.1	7.6e-90
WP_017827424.1|1138069_1139059_+	hypothetical protein	NA	A9YX09	Burkholderia_phage	46.4	1.3e-71
WP_017827423.1|1139181_1139955_-	LexA family transcriptional regulator	NA	A2I308	Vibrio_virus	30.8	2.3e-10
WP_017827422.1|1140056_1140227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017827420.1|1140997_1141723_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	56.8	1.4e-65
WP_017827419.1|1141959_1143162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017827418.1|1143162_1144311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017827417.1|1144413_1144722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017827416.1|1144786_1148122_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	45.4	2.5e-207
WP_017827415.1|1148137_1148338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017827414.1|1148339_1148651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628783.1|1148794_1149124_+|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	71.6	9.6e-43
WP_017827413.1|1149120_1149819_+|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	82.8	2.6e-114
WP_017827412.1|1149822_1150542_+	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	74.5	1.4e-110
WP_017628780.1|1150478_1151045_+|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	76.7	3.1e-49
WP_168725586.1|1151044_1155190_+	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	75.5	0.0e+00
WP_004245936.1|1155183_1155552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247523.1|1155553_1156168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247524.1|1156217_1156478_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
1163390:1163408	attR	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
>prophage 4
NZ_CP051260	Proteus mirabilis strain STP3 chromosome, complete genome	4115975	1331153	1410106	4115975	plate,protease,tRNA	Bacillus_phage(23.53%)	58	NA	NA
WP_004244558.1|1331153_1331468_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|1331498_1333793_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|1333911_1334130_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004247616.1|1334449_1335142_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004244562.1|1335143_1336895_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.8	4.0e-18
WP_017628444.1|1336897_1338667_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004247618.1|1338805_1339765_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	1.2e-64
WP_004244566.1|1340307_1340802_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_168725592.1|1340929_1344733_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|1344845_1345451_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_110706932.1|1345461_1346811_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	4.0e-79
WP_004244571.1|1346944_1348234_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_004244572.1|1348413_1348746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247622.1|1349146_1350196_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_168725593.1|1350268_1351174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|1351531_1352272_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|1352379_1354662_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244577.1|1354716_1355571_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_036900836.1|1356241_1357999_-	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_004244579.1|1358226_1359264_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_108717050.1|1359338_1360592_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_104459796.1|1360728_1362159_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.8	1.5e-07
WP_004244582.1|1362295_1363384_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_004252010.1|1363580_1364867_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|1365155_1365833_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|1366014_1367688_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|1367752_1368040_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_143475375.1|1368464_1370834_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.3	3.6e-22
WP_004244589.1|1370870_1372616_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_004244590.1|1372612_1373614_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|1374109_1374325_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|1374739_1374919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|1374923_1375685_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004247632.1|1375807_1376638_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004247633.1|1377017_1377791_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|1377800_1379123_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247634.1|1379103_1379835_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_004247635.1|1379831_1384289_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004247636.1|1384570_1385224_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	80.4	8.2e-102
WP_004247637.1|1385630_1386344_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004247638.1|1386686_1388402_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_168725594.1|1388733_1389282_+	YcbK family protein	NA	NA	NA	NA	NA
WP_004247640.1|1389331_1389982_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|1390074_1390548_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004247642.1|1390638_1392375_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_004244609.1|1392367_1393723_-	membrane protein	NA	NA	NA	NA	NA
WP_004244610.1|1393760_1397309_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_110706694.1|1397311_1398775_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244612.1|1398780_1399431_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|1399432_1400221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104459791.1|1400224_1402948_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	1.4e-83
WP_004244617.1|1402956_1403712_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_026164596.1|1403704_1405063_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|1405064_1405616_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247648.1|1405617_1406886_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004244621.1|1406890_1407928_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_046334530.1|1407891_1409667_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244624.1|1409674_1410106_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NZ_CP051260	Proteus mirabilis strain STP3 chromosome, complete genome	4115975	1489239	1539005	4115975	holin,integrase,protease,tail,lysis,terminase,portal	Enterobacteria_phage(25.53%)	62	1483220:1483236	1494758:1494774
1483220:1483236	attL	ATTTTAATGTCATGTTA	NA	NA	NA	NA
WP_046335327.1|1489239_1490415_-|integrase	site-specific integrase	integrase	A0A2H4J1K3	uncultured_Caudovirales_phage	29.4	2.7e-31
WP_046335326.1|1491052_1491361_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	67.7	7.1e-32
WP_046335325.1|1491973_1492921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335330.1|1493006_1493357_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_161779750.1|1493463_1493748_+	M15 family metallopeptidase	NA	A0A1P8DTE2	Proteus_phage	80.9	2.4e-42
WP_046335324.1|1493753_1494200_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	31.5	3.5e-11
WP_046335323.1|1494377_1494734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335322.1|1494832_1495843_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	37.0	6.4e-37
1494758:1494774	attR	ATTTTAATGTCATGTTA	NA	NA	NA	NA
WP_046335178.1|1496060_1496516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335342.1|1499361_1500432_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_049219126.1|1501209_1502391_-	recombinase	NA	A0A2D1GN00	Marinobacter_phage	30.0	2.0e-29
WP_049219192.1|1502392_1502599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168725601.1|1503196_1503976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168725602.1|1504047_1504581_-	hypothetical protein	NA	J9Q748	Salmonella_phage	46.6	6.1e-39
WP_168725603.1|1504583_1504853_-	hypothetical protein	NA	A0A248SL63	Klebsiella_phage	65.4	1.8e-18
WP_168725604.1|1504925_1505423_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	61.4	2.2e-46
WP_168725605.1|1505415_1505949_-	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	58.0	1.7e-52
WP_126656788.1|1506030_1506927_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	59.7	7.5e-98
WP_168725606.1|1507270_1507474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049211705.1|1507622_1508312_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	58.5	6.6e-70
WP_049210565.1|1508409_1508625_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	45.1	2.9e-08
WP_060961274.1|1508681_1509140_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	44.7	7.9e-27
WP_004251659.1|1509227_1509401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251656.1|1509397_1509577_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	1.8e-11
WP_036905234.1|1509589_1510651_+	replication protein	NA	H2DE83	Erwinia_phage	54.4	5.1e-29
WP_036901006.1|1510650_1511289_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	65.0	1.1e-82
WP_168725607.1|1511285_1511687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726600.1|1511749_1512133_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	53.7	1.7e-27
WP_087726599.1|1512151_1512955_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	63.1	2.0e-89
WP_168725608.1|1512951_1513977_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.1	1.1e-84
WP_049219102.1|1514005_1514404_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	57.5	7.1e-32
WP_036901019.1|1514580_1514775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168725609.1|1514847_1515870_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	69.8	6.9e-132
WP_168725610.1|1515983_1516205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070486607.1|1516179_1516416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168725611.1|1516555_1516825_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	4.3e-17
WP_064506373.1|1516824_1517295_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	57.5	2.2e-48
WP_168725612.1|1517276_1517435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168725613.1|1517437_1517899_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	34.2	4.2e-12
WP_168725614.1|1517898_1518126_+	hypothetical protein	NA	A0A2I7QSR3	Vibrio_phage	46.8	1.0e-06
WP_168725615.1|1518511_1518943_+	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	76.3	1.0e-47
WP_168725616.1|1518986_1519535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036970268.1|1519995_1520508_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	63.4	7.4e-58
WP_126656776.1|1520520_1521015_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	65.6	1.3e-48
WP_168725617.1|1521011_1523114_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	68.8	1.5e-293
WP_004247869.1|1523110_1523326_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	64.3	1.2e-17
WP_036970259.1|1523322_1524813_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	67.0	8.2e-190
WP_168725744.1|1524799_1526767_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	63.7	1.9e-247
WP_049209887.1|1526855_1527197_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	47.7	3.9e-15
WP_063073894.1|1527208_1527481_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	46.1	1.1e-15
WP_063073895.1|1527490_1528054_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	57.1	6.2e-50
WP_036973524.1|1528053_1528449_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	59.5	2.2e-41
WP_074153257.1|1528460_1528982_+|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	74.7	2.2e-65
WP_074561718.1|1528993_1529383_+|tail	phage minor tail protein G	tail	K7PJY4	Enterobacterial_phage	41.0	3.1e-16
WP_152964570.1|1529403_1529724_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	41.5	3.3e-16
WP_168725618.1|1529692_1532698_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	30.1	1.2e-99
WP_168725619.1|1532698_1533028_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	54.1	3.3e-27
WP_168725620.1|1533126_1533498_+	superinfection immunity protein	NA	A0A0S2SY85	Pseudomonas_phage	33.0	3.1e-13
WP_070486639.1|1533550_1534255_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	51.1	1.6e-66
WP_110229325.1|1534276_1535005_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	61.5	2.3e-89
WP_080973411.1|1534974_1535559_+|tail	tail assembly protein	tail	K7PH50	Enterobacteria_phage	48.0	3.1e-44
WP_168725621.1|1535573_1539005_+|tail	phage tail protein	tail	A0A0P0ZEQ8	Stx2-converting_phage	52.7	1.5e-279
>prophage 6
NZ_CP051260	Proteus mirabilis strain STP3 chromosome, complete genome	4115975	1620986	1689787	4115975	protease,integrase,capsid,tRNA,tail,lysis,head,transposase,terminase,portal	Morganella_phage(25.0%)	80	1618637:1618651	1637180:1637194
1618637:1618651	attL	TCTGCGATAAAGTGA	NA	NA	NA	NA
WP_168725627.1|1620986_1622090_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004247118.1|1622195_1622648_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004247841.1|1622640_1623270_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004251822.1|1623408_1624662_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
WP_060556847.1|1624771_1625905_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	72.8	1.0e-155
WP_017628380.1|1625879_1626131_-	excisionase	NA	NA	NA	NA	NA
WP_060556846.1|1626216_1626741_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	61.6	1.0e-54
WP_049217153.1|1627129_1627777_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	65.1	2.9e-75
WP_049217157.1|1627880_1628075_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	61.0	6.5e-15
WP_060556845.1|1628112_1628589_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	60.4	3.0e-45
WP_036976728.1|1628651_1628861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628377.1|1628850_1629030_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	3.4e-10
WP_060556894.1|1629587_1630103_+	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	3.5e-23
WP_060556844.1|1630124_1630931_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.5	1.8e-90
WP_060556843.1|1630927_1631953_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	46.5	9.2e-84
WP_049219743.1|1631980_1632379_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	54.3	1.6e-31
WP_004244726.1|1632719_1632932_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	81.4	3.1e-26
WP_060556842.1|1633263_1633722_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_060556841.1|1634215_1635031_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_060556840.1|1635020_1638128_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
1637180:1637194	attR	TCACTTTATCGCAGA	NA	NA	NA	NA
WP_060556839.1|1638558_1638981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020946092.1|1639046_1639316_+	phage protein	NA	A0A2H4FNF0	Salmonella_phage	53.3	1.6e-19
WP_168725628.1|1639315_1639786_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	63.4	4.7e-51
WP_168725629.1|1639767_1639926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168725630.1|1639928_1640390_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	34.7	1.1e-12
WP_168725631.1|1640386_1640755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168725632.1|1641448_1641799_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	92.9	4.6e-59
WP_168725633.1|1641795_1642197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168725634.1|1642387_1642882_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	75.6	4.5e-68
WP_168725635.1|1642878_1644609_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	82.3	4.1e-294
WP_049212495.1|1644618_1644798_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	54.7	1.7e-09
WP_168725636.1|1644797_1646027_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	72.2	7.2e-176
WP_168725637.1|1645998_1646649_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	79.1	1.3e-94
WP_168725638.1|1646662_1647871_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	69.1	1.1e-155
WP_063109140.1|1647952_1648261_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	40.2	4.8e-12
WP_168725639.1|1648257_1648587_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_168725640.1|1648576_1649050_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	30.2	1.6e-11
WP_109372567.1|1649055_1649397_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_109880550.1|1649406_1650072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088495854.1|1650136_1650553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168725745.1|1650549_1650828_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_168725641.1|1650869_1654148_+|tail	phage tail tape measure protein	tail	A0A2I2L6P9	Escherichia_phage	27.7	2.5e-42
WP_161739356.1|1654148_1654745_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	2.1e-51
WP_115370344.1|1654744_1655326_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	3.1e-52
WP_049219722.1|1655342_1655678_+	hypothetical protein	NA	Q775B6	Bordetella_phage	35.3	3.7e-10
WP_168725642.1|1655756_1656155_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	1.2e-31
WP_049219718.1|1660561_1660900_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_049219717.1|1661043_1661292_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081041966.1|1661345_1663655_-	hypothetical protein	NA	A0A2L1IV32	Escherichia_phage	60.3	2.2e-16
WP_168725643.1|1664216_1664417_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	9.6e-22
WP_110706661.1|1665060_1666266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110706660.1|1667549_1668674_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004247907.1|1669113_1669326_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	2.0e-25
WP_004242516.1|1669658_1670117_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_004247908.1|1670607_1671069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036920088.1|1671192_1671567_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012367816.1|1671656_1672505_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004242521.1|1672745_1672943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049203874.1|1672966_1673509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026090443.1|1674349_1674664_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012367820.1|1675037_1675298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247912.1|1675306_1675948_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	47.8	2.4e-50
WP_110706658.1|1675960_1677187_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	33.4	2.0e-61
WP_049208187.1|1677744_1678407_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012367822.1|1678969_1679326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004242531.1|1679528_1679699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908063.1|1679983_1680979_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_004247917.1|1681195_1681372_+	hypothetical protein	NA	A0A1W6JNZ9	Morganella_phage	60.0	9.1e-08
WP_004242534.1|1681864_1682086_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004242536.1|1682511_1682793_+	DUF5339 domain-containing protein	NA	NA	NA	NA	NA
WP_004242537.1|1683161_1683575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251481.1|1683602_1683845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004242541.1|1683907_1684468_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	50.6	1.9e-19
WP_004242542.1|1684843_1685041_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_110706657.1|1685058_1685835_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_004242548.1|1686069_1686453_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	47.8	2.3e-24
WP_004242549.1|1686595_1687459_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004247923.1|1687585_1688017_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	38.1	1.8e-20
WP_168725644.1|1688135_1688552_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	1.7e-44
WP_110706656.1|1688578_1689787_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	2.4e-187
>prophage 7
NZ_CP051260	Proteus mirabilis strain STP3 chromosome, complete genome	4115975	1924662	1934654	4115975		Escherichia_phage(66.67%)	8	NA	NA
WP_049210313.1|1924662_1926720_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	4.8e-31
WP_004248043.1|1926731_1928432_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_036918303.1|1928767_1929454_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242888.1|1929453_1929915_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242890.1|1929967_1930579_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
WP_004242891.1|1930718_1931579_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.5	3.7e-25
WP_004242892.1|1931580_1932198_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_110706632.1|1932209_1934654_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.2	1.2e-219
>prophage 8
NZ_CP051260	Proteus mirabilis strain STP3 chromosome, complete genome	4115975	2458382	2477251	4115975	lysis,holin	Burkholderia_phage(26.67%)	22	NA	NA
WP_012368081.1|2458382_2460821_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
WP_049213336.1|2460832_2461450_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	4.4e-89
WP_004243611.1|2461453_2462230_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243612.1|2462345_2462888_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_017628013.1|2463456_2463636_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_108716900.1|2463775_2465011_-	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	34.1	2.4e-14
WP_004243615.1|2465016_2465673_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
WP_017628010.1|2465669_2466857_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_004243617.1|2466849_2467194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243621.1|2467190_2467883_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243622.1|2467885_2468698_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|2468666_2468987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036971128.1|2468992_2469487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107337176.1|2469489_2471793_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.1	2.0e-14
WP_004243627.1|2471875_2472334_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_004243628.1|2472393_2472846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168725666.1|2472856_2474344_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.5	5.4e-77
WP_110706591.1|2474352_2474865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036918597.1|2474901_2475351_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_110706590.1|2475347_2475752_-	structural protein	NA	A0A0E3JJ20	Enterobacteria_phage	45.8	1.1e-24
WP_168725667.1|2475754_2476003_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	53.8	8.9e-17
WP_036918599.1|2476435_2477251_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.3	2.1e-54
>prophage 9
NZ_CP051260	Proteus mirabilis strain STP3 chromosome, complete genome	4115975	2975502	3023809	4115975	holin,integrase,tail,capsid,terminase	Proteus_phage(25.0%)	76	2975273:2975328	3022659:3022714
2975273:2975328	attL	TTGATTTTAAATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_168725688.1|2975502_2975733_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	94.7	4.1e-32
WP_168725689.1|2975737_2977153_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	53.4	3.1e-114
WP_168725690.1|2977168_2980792_-	host specificity protein J	NA	A0A1W6JNW2	Morganella_phage	65.7	0.0e+00
WP_049199070.1|2980791_2981358_-|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	77.4	1.4e-49
WP_164527438.1|2981294_2982014_-|tail	phage tail protein	tail	A0A1W6JNU8	Morganella_phage	74.5	2.8e-111
WP_036971552.1|2982017_2982716_-|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	84.1	4.8e-116
WP_036971549.1|2982712_2983042_-|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	69.7	6.2e-42
WP_168725691.1|2983186_2983498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168725561.1|2983499_2983700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168725692.1|2983715_2987072_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	44.8	2.0e-204
WP_168725693.1|2987140_2987686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168725694.1|2987712_2988123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113977037.1|2988272_2988650_-	DUF2335 domain-containing protein	NA	A0A0D4DCC1	Staphylococcus_phage	35.4	1.4e-05
WP_113977029.1|2988803_2988998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168725695.1|2989389_2989572_+	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	74.6	3.7e-20
WP_004247509.1|2989585_2989957_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	65.7	4.4e-36
WP_168725696.1|2989999_2990692_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	72.4	4.0e-91
WP_168725697.1|2990741_2991497_-	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	78.5	2.2e-106
WP_036905489.1|2991561_2991930_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	28.7	2.0e-09
WP_168725698.1|2991926_2992298_-	HK97 gp10 family phage protein	NA	G0ZNE3	Cronobacter_phage	65.0	1.9e-39
WP_004247766.1|2992299_2992641_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	52.4	9.4e-25
WP_094960238.1|2992640_2993039_-	hypothetical protein	NA	I6S619	Salmonella_phage	78.8	2.7e-55
WP_094960239.1|2993095_2993269_-	glycoprotein	NA	I6R9A3	Salmonella_phage	50.0	1.2e-07
WP_004247762.1|2993278_2994373_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	68.9	2.0e-145
WP_149127653.1|2994389_2994827_-	hypothetical protein	NA	I6S1Q2	Salmonella_phage	68.5	1.5e-46
WP_168725699.1|2994826_2996101_-	hypothetical protein	NA	G0ZND7	Cronobacter_phage	64.2	4.0e-153
WP_149127655.1|2996104_2997034_-|capsid	minor capsid protein	capsid	A0A1V0E5Q2	Salmonella_phage	55.7	2.7e-90
WP_149127656.1|2996984_2998340_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	63.8	1.1e-161
WP_149127657.1|2998339_2999584_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1V0E5Q3	Salmonella_phage	73.8	1.2e-186
WP_149127658.1|2999564_2999987_-	hypothetical protein	NA	A0A068CGC1	Acinetobacter_phage	61.7	2.6e-32
WP_168725562.1|2999970_3000186_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	72.9	4.4e-20
WP_161747469.1|3000366_3000600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168725750.1|3000610_3001297_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	77.2	4.4e-98
WP_168725700.1|3001725_3001917_-	hypothetical protein	NA	A0A0U4ISD3	Pseudomonas_phage	52.5	8.1e-10
WP_049257604.1|3002315_3002693_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	30.8	1.4e-05
WP_099660112.1|3002694_3003027_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	70.3	7.4e-35
WP_164526264.1|3003023_3003359_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	31.5	8.1e-05
WP_168725701.1|3004059_3004563_-	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	85.6	5.3e-77
WP_168725702.1|3004740_3005334_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	94.4	4.6e-96
WP_168725703.1|3005305_3005449_-	hypothetical protein	NA	A0A1P8DTE6	Proteus_phage	93.6	3.2e-19
WP_168725704.1|3005426_3005867_-	hypothetical protein	NA	A0A1P8DTF9	Proteus_phage	51.0	8.6e-31
WP_168725705.1|3005988_3006213_-	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	75.4	6.1e-25
WP_168725706.1|3006209_3006653_-	hypothetical protein	NA	A0A1P8DTD8	Proteus_phage	90.5	2.7e-32
WP_168725751.1|3006654_3006969_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	48.5	6.0e-18
WP_168725707.1|3007016_3007244_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_168725708.1|3007240_3007444_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_168725709.1|3007430_3007652_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168725710.1|3007671_3009048_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	58.6	2.9e-157
WP_159262679.1|3009047_3010133_-	DNA replication protein	NA	E5AGE9	Erwinia_phage	50.7	1.4e-82
WP_168725563.1|3010125_3010350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168725711.1|3010398_3010734_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	96.3	2.0e-51
WP_036895075.1|3010869_3011055_-	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	58.3	2.3e-09
WP_168725712.1|3011150_3011861_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	62.1	3.3e-80
WP_168725713.1|3011896_3013012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072502853.1|3013014_3013323_+	STAS-like domain-containing protein	NA	A0A2H4J4X6	uncultured_Caudovirales_phage	48.4	2.3e-14
WP_109395527.1|3013333_3013795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036970054.1|3014174_3014444_+	hypothetical protein	NA	A0A1P8DTK1	Proteus_phage	72.5	6.2e-24
WP_168725714.1|3014457_3014943_+	hypothetical protein	NA	A0A2I7S3K3	Vibrio_phage	46.8	7.8e-33
WP_168725715.1|3015041_3015191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162557014.1|3015236_3015401_+	hypothetical protein	NA	A0A1W6JP47	Morganella_phage	59.3	6.1e-14
WP_168725716.1|3015454_3015610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060961233.1|3015617_3015872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094960320.1|3015868_3016123_+	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	95.2	2.5e-38
WP_036908293.1|3016119_3016938_+	exodeoxyribonuclease VIII	NA	A0A1P8DTH1	Proteus_phage	97.8	1.8e-159
WP_036908295.1|3016930_3017737_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	98.9	1.9e-145
WP_168725717.1|3017726_3018236_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	79.2	5.5e-53
WP_109910842.1|3018319_3018589_+	hypothetical protein	NA	A0A248SL63	Klebsiella_phage	66.7	3.5e-19
WP_168725718.1|3018591_3018912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168725719.1|3019105_3019456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049211072.1|3019465_3019711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060558087.1|3019869_3020235_+	DUF2528 family protein	NA	NA	NA	NA	NA
WP_060558086.1|3020238_3020466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168725720.1|3020452_3021055_+	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	52.0	2.0e-54
WP_004247695.1|3021062_3021257_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	90.6	3.5e-29
WP_070487132.1|3021490_3022648_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	74.9	8.9e-176
WP_004244243.1|3022936_3023809_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	5.7e-34
3022659:3022714	attR	TTGATTTTAAATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 10
NZ_CP051260	Proteus mirabilis strain STP3 chromosome, complete genome	4115975	3282581	3291461	4115975		Caulobacter_phage(50.0%)	9	NA	NA
WP_004245601.1|3282581_3284150_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_012368337.1|3284550_3285231_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|3285327_3285903_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|3285979_3286558_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245605.1|3286625_3287651_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|3287685_3288141_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_143475448.1|3288165_3289338_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_004245609.1|3289338_3289923_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017827550.1|3290315_3291461_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.2e-31
>prophage 11
NZ_CP051260	Proteus mirabilis strain STP3 chromosome, complete genome	4115975	3353620	3368076	4115975	integrase,transposase	Escherichia_phage(50.0%)	18	3354969:3355028	3369463:3369533
WP_004574636.1|3353620_3354910_+|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
3354969:3355028	attL	AAAATAATAAAAGCAGACTTGACCTGATAGTTTGGCTGTGAGCAATTATGTGCTTAGTGC	NA	NA	NA	NA
WP_001261740.1|3355089_3355881_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_032084014.1|3355965_3357186_-	EreA family erythromycin esterase	NA	NA	NA	NA	NA
WP_032084013.1|3357378_3357852_-	trimethoprim-resistant dihydrofolate reductase DfrA32	NA	A0A1B2IBQ4	Erwinia_phage	33.1	6.5e-16
WP_015057121.1|3358009_3358969_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|3358859_3359564_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000184001.1|3359717_3360923_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|3361078_3361282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|3361369_3362074_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_063102497.1|3362267_3362654_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_000084745.1|3362973_3363366_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_001067858.1|3363561_3364266_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_168725730.1|3364305_3364395_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_124724886.1|3364483_3364753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015639707.1|3364686_3364986_+	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_156734542.1|3365017_3366067_+	Cfr family 23S rRNA (adenine(2503)-C(8))-methyltransferase	NA	NA	NA	NA	NA
WP_164526969.1|3366791_3367325_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	34.4	4.0e-14
WP_001067858.1|3367371_3368076_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
3369463:3369533	attR	AAAATAATAAAAGCAGACTTGACCTGATAGTTTGGCTGTGAGCAATTATGTGCTTAGTGCATCTAACGCCG	NA	NA	NA	NA
>prophage 12
NZ_CP051260	Proteus mirabilis strain STP3 chromosome, complete genome	4115975	3372608	3438457	4115975	integrase,transposase	Escherichia_phage(20.0%)	54	3372557:3372616	3378961:3379022
3372557:3372616	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|3372608_3373313_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|3373442_3374258_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|3374447_3375152_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001038045.1|3375984_3376644_-	tetracycline resistance transcriptional repressor TetR(C)	NA	NA	NA	NA	NA
WP_053409934.1|3376736_3377927_+	tetracycline efflux MFS transporter Tet(C)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.0	8.1e-07
WP_002310911.1|3377830_3378169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071533317.1|3378165_3378351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015696.1|3378376_3378655_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_053409935.1|3379109_3379517_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
3378961:3379022	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCA	NA	NA	NA	NA
WP_053409936.1|3379612_3380509_+	cation transporter	NA	NA	NA	NA	NA
WP_003821921.1|3380512_3381025_+	signal peptidase II	NA	NA	NA	NA	NA
WP_048608563.1|3382375_3383050_+	DNA-specific endonuclease I	NA	NA	NA	NA	NA
WP_004249372.1|3383458_3385498_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004249371.1|3385494_3386913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064497036.1|3387371_3391064_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_000735887.1|3391066_3392095_-	TraU family protein	NA	NA	NA	NA	NA
WP_064497037.1|3392078_3393203_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_064497054.1|3393213_3393633_-	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_064497038.1|3393709_3394057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064497039.1|3394049_3396449_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_001228924.1|3396448_3397141_-	DsbC family protein	NA	NA	NA	NA	NA
WP_064497040.1|3397272_3398211_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_000095577.1|3398203_3398995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032469918.1|3399215_3399602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024008834.1|3399598_3400171_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_064497041.1|3400245_3401535_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_064497055.1|3401537_3402434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064497042.1|3402417_3403044_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_000433891.1|3403040_3403322_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_031500457.1|3403458_3404565_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	29.0	1.3e-35
WP_124724881.1|3404557_3405229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064497043.1|3405267_3405903_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_064497044.1|3405889_3406450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064497045.1|3406459_3408280_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_064497046.1|3408328_3410479_-	phosphohydrolase	NA	NA	NA	NA	NA
WP_047109294.1|3410635_3411817_-	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_064497047.1|3411888_3414315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064497048.1|3414314_3418196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064497049.1|3418292_3420944_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_064497050.1|3420945_3422781_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	31.4	8.6e-40
WP_064497051.1|3422861_3423815_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_064497052.1|3424132_3424432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064497053.1|3424519_3425425_-	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
WP_168725731.1|3426066_3426468_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	60.2	1.1e-29
WP_102140835.1|3426464_3427618_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	38.6	7.8e-47
WP_001043260.1|3427744_3428560_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|3428620_3429424_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|3429423_3430260_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001120891.1|3430231_3430771_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|3430882_3431188_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|3431215_3432430_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|3432652_3433537_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|3433567_3435061_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000985631.1|3435478_3438457_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP051260	Proteus mirabilis strain STP3 chromosome, complete genome	4115975	3913485	3932997	4115975	transposase	Escherichia_phage(57.14%)	21	NA	NA
WP_001067858.1|3913485_3914190_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_011091028.1|3914625_3915501_+	class A extended-spectrum beta-lactamase CTX-M-3	NA	A0A1B0VBP7	Salmonella_phage	82.1	5.4e-125
WP_013023839.1|3915547_3916024_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_001067855.1|3916801_3917506_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|3917623_3917827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124743826.1|3917954_3918794_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3918787_3919135_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|3919357_3919810_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000186237.1|3919894_3920527_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001334766.1|3920664_3921495_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|3921625_3922180_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|3922323_3923028_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|3923141_3923918_+	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_000742814.1|3924146_3925172_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|3925593_3926346_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	38.7	2.4e-33
WP_166635460.1|3928270_3928642_+	phenol hydroxylase	NA	NA	NA	NA	NA
WP_085940648.1|3928838_3929929_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|3930018_3930834_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|3930920_3931223_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|3931116_3931368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|3932292_3932997_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
>prophage 14
NZ_CP051260	Proteus mirabilis strain STP3 chromosome, complete genome	4115975	3936197	3991789	4115975	integrase,transposase,tRNA	Escherichia_phage(25.0%)	52	3940150:3940163	3970855:3970868
WP_001067855.1|3936197_3936902_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|3936948_3937350_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|3937499_3938360_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001403349.1|3938542_3938968_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.7e-53
WP_001067855.1|3938944_3939649_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|3939838_3940654_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
3940150:3940163	attL	CGTCATCAAAATCA	NA	NA	NA	NA
WP_001067855.1|3940804_3941509_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_168725740.1|3942264_3943116_+	replication protein C	NA	NA	NA	NA	NA
WP_001043265.1|3943423_3944239_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|3944299_3945103_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|3945102_3945939_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|3945999_3946704_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001300294.1|3948093_3948762_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|3948797_3949034_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|3949030_3949393_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|3949410_3951105_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|3951156_3951579_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|3951614_3951890_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|3951903_3952254_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|3952325_3952760_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_086937185.1|3954728_3955532_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	38.4	1.9e-31
WP_119563495.1|3955761_3956715_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001218908.1|3957559_3958744_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
WP_036970530.1|3959377_3961420_+	oligopeptidase A	NA	NA	NA	NA	NA
WP_012368588.1|3961423_3962170_+	16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ	NA	NA	NA	NA	NA
WP_004246663.1|3962240_3962990_-	D-threitol dehydrogenase	NA	NA	NA	NA	NA
WP_017628608.1|3963118_3964459_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_004246661.1|3964712_3965147_-	universal stress protein UspA	NA	NA	NA	NA	NA
WP_004246660.1|3965560_3965893_+	universal stress protein UspB	NA	NA	NA	NA	NA
WP_004246659.1|3965964_3967464_-	inorganic phosphate transporter PitA	NA	NA	NA	NA	NA
WP_004246658.1|3967772_3968978_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_110706861.1|3969390_3970092_+	pirin family protein	NA	NA	NA	NA	NA
WP_168725741.1|3970207_3971827_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.6	2.2e-140
3970855:3970868	attR	CGTCATCAAAATCA	NA	NA	NA	NA
WP_004246652.1|3972031_3972916_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_004246651.1|3972943_3973357_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_017827151.1|3973430_3975539_-	intracellular growth attenuator family protein	NA	NA	NA	NA	NA
WP_036919365.1|3975894_3976452_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_004249852.1|3976541_3977345_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012368592.1|3977678_3980213_-	peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA	NA	NA	NA	NA	NA
WP_036919369.1|3980329_3981154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246641.1|3981141_3981741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110706860.1|3981724_3982258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110706859.1|3982264_3983380_+	type IV pilus secretin PilQ	NA	D0U174	Enterobacteria_phage	24.9	1.0e-11
WP_012368596.1|3983960_3984482_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_004249857.1|3984534_3985629_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_004246636.1|3985783_3986728_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_004249858.1|3986809_3987625_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	47.1	1.2e-65
WP_004246629.1|3987669_3988344_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_110706858.1|3988340_3989051_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_004246627.1|3989052_3990081_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_110706857.1|3990141_3991350_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.0	9.5e-189
WP_110706856.1|3991372_3991789_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	7.6e-45
>prophage 15
NZ_CP051260	Proteus mirabilis strain STP3 chromosome, complete genome	4115975	4017387	4068093	4115975	integrase,protease,transposase,tRNA	Virus_Rctr41k(25.0%)	48	4004284:4004300	4055494:4055510
4004284:4004300	attL	ACTTTACCTACCGCCAG	NA	NA	NA	NA
WP_004246600.1|4017387_4019286_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_168725742.1|4019282_4019909_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004246598.1|4020523_4020901_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_004246597.1|4020932_4021757_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004246596.1|4021802_4022042_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_004246595.1|4022103_4022574_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004246594.1|4022586_4023120_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_004246592.1|4023134_4024676_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004246591.1|4024733_4025597_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_004246589.1|4025631_4027014_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_004246588.1|4027035_4027452_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_004246587.1|4027602_4028976_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	32.3	9.6e-28
WP_004246586.1|4029133_4030960_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	44.6	1.2e-131
WP_001029679.1|4031119_4031941_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_000267723.1|4031927_4034036_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|4034032_4035700_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001243518.1|4035702_4037229_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000251879.1|4037229_4038846_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001271300.1|4039076_4039454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|4039863_4040235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444089.1|4040295_4040793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206315.1|4040868_4041657_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000704156.1|4041714_4042239_-	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_000777554.1|4042333_4042807_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000071896.1|4043138_4043675_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000497519.1|4043789_4044116_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
WP_001353740.1|4044303_4044543_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_004249814.1|4045471_4046548_+	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	1.1e-26
WP_017628744.1|4046560_4048252_+	putative 2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023843642.1|4048300_4049308_+	putative 2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017628743.1|4049372_4050500_+	TIGR03364 family FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004249808.1|4050574_4050979_-	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_017628742.1|4051006_4051294_-	YjeO family protein	NA	NA	NA	NA	NA
WP_012368613.1|4051382_4052195_-	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_004246571.1|4053069_4054203_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_004246570.1|4054212_4055619_+	YfcC family protein	NA	NA	NA	NA	NA
4055494:4055510	attR	CTGGCGGTAGGTAAAGT	NA	NA	NA	NA
WP_012368614.1|4055711_4056350_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017628741.1|4056471_4057575_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004249975.1|4059184_4059634_-	metal-binding protein	NA	NA	NA	NA	NA
WP_004246565.1|4059818_4060493_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_004249799.1|4060514_4062428_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004246563.1|4062601_4062916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246562.1|4062940_4063579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246561.1|4063863_4064526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246560.1|4064939_4065596_-	fimbrial protein	NA	NA	NA	NA	NA
WP_012368617.1|4065992_4066658_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_004249797.1|4066955_4067360_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	43.3	1.4e-22
WP_017628739.1|4067508_4068093_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
