The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050804	Arcanobacterium sp. 2701 chromosome, complete genome	1941174	572696	598713	1941174	terminase,transposase,protease	Erysipelothrix_phage(42.86%)	24	NA	NA
WP_168917442.1|572696_573269_+|terminase	P27 family phage terminase small subunit	terminase	A0A2K5B277	Erysipelothrix_phage	49.7	1.2e-48
WP_168917443.1|574508_575756_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	59.2	6.7e-137
WP_168917444.1|575835_576852_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168916999.1|577299_577479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168917445.1|577478_577673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168917446.1|577782_579387_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	76.4	5.8e-242
WP_168917447.1|579454_580105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917448.1|581812_582358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917449.1|582948_583671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168917450.1|583700_583928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168917451.1|584573_585269_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_168917452.1|585265_586009_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_168917453.1|586135_586819_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	1.1e-21
WP_168917454.1|586815_588210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168917455.1|588215_588593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917456.1|588747_590607_+	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_168917457.1|590735_591572_+	YdcF family protein	NA	NA	NA	NA	NA
WP_168917458.1|591787_592021_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_168917459.1|592031_592199_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_168917460.1|592310_593195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917461.1|594118_595657_+	trigger factor	NA	NA	NA	NA	NA
WP_168917462.1|595944_596586_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	52.6	7.4e-47
WP_168918575.1|596636_597284_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.0	4.2e-34
WP_168917463.1|597429_598713_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.2	1.2e-125
>prophage 2
NZ_CP050804	Arcanobacterium sp. 2701 chromosome, complete genome	1941174	1132749	1188729	1941174	transposase	Klosneuvirus(22.22%)	50	NA	NA
WP_168917877.1|1132749_1133277_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	32.1	8.2e-12
WP_168917878.1|1133601_1133781_+	XamI family restriction endonuclease	NA	NA	NA	NA	NA
WP_168917879.1|1134050_1134245_+	XamI family restriction endonuclease	NA	NA	NA	NA	NA
WP_168917880.1|1134322_1134904_-	sulfopyruvate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_168917881.1|1134920_1135400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917882.1|1135405_1136635_-	MFS transporter	NA	NA	NA	NA	NA
WP_168917883.1|1136644_1137736_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168917884.1|1138448_1139486_-	YncE family protein	NA	NA	NA	NA	NA
WP_168917885.1|1140383_1141754_-	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	43.0	1.4e-90
WP_168917886.1|1142219_1142645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168917887.1|1143944_1144766_+	HNH endonuclease	NA	A0A1S6L216	Vibrio_phage	32.7	5.8e-12
WP_168917888.1|1145083_1145740_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_168917889.1|1145752_1146220_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_168917890.1|1146256_1147216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917891.1|1147208_1147946_-	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	28.6	5.5e-14
WP_168917892.1|1148128_1148494_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	34.3	2.5e-15
WP_168917893.1|1148570_1149518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917894.1|1149782_1151315_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_013170278.1|1151411_1151669_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_168917895.1|1151718_1152024_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_168918619.1|1152182_1154678_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_168917896.1|1155172_1156672_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_168917897.1|1156689_1157829_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_168917898.1|1157882_1158242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917899.1|1158572_1159439_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_168917900.1|1161796_1163458_+	thiol reductant ABC exporter subunit CydD	NA	NA	NA	NA	NA
WP_168917901.1|1163454_1165212_+	thiol reductant ABC exporter subunit CydC	NA	A0A1V0SJ29	Klosneuvirus	24.3	2.9e-13
WP_168917902.1|1165216_1166857_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_168918620.1|1166909_1167533_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_168917903.1|1168422_1169133_-	ribonuclease III	NA	A0A2K9L8W0	Tupanvirus	26.4	8.0e-18
WP_168917904.1|1169132_1169711_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_168917905.1|1169716_1170223_-	ATP synthase F0 subunit B	NA	NA	NA	NA	NA
WP_168917906.1|1170219_1170696_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	36.9	3.6e-22
WP_168917907.1|1170700_1171312_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_168917908.1|1171277_1173509_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_168917909.1|1173745_1173937_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_168917910.1|1174023_1175001_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_091280909.1|1175008_1176127_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_168917911.1|1176171_1176999_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_168917912.1|1177019_1178342_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_091280900.1|1178548_1179280_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168917913.1|1179289_1180423_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_168917914.1|1180489_1182508_+	M3 family metallopeptidase	NA	A0A1V0SID3	Klosneuvirus	22.4	1.4e-30
WP_168917915.1|1182567_1183491_-	phospholipase	NA	NA	NA	NA	NA
WP_168917916.1|1184006_1184714_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168917917.1|1184667_1184901_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_168917918.1|1185306_1185939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917917.1|1186368_1186602_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_168917916.1|1186555_1187263_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168917919.1|1187418_1188729_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP050804	Arcanobacterium sp. 2701 chromosome, complete genome	1941174	1196989	1239366	1941174	tail,terminase,portal,protease,integrase,holin	Propionibacterium_phage(31.58%)	58	1194684:1194708	1230910:1230934
1194684:1194708	attL	GTGCGCGAGGAGGGACTTGAACCCT	NA	NA	NA	NA
WP_168917931.1|1196989_1197238_-|holin	holin	holin	A0A1W6JRG0	Corynebacterium_phage	54.3	6.4e-07
WP_168917932.1|1197248_1198112_-	CHAP domain-containing protein	NA	A0A2P1CIB7	Actinomyces_phage	47.0	9.3e-53
WP_168917933.1|1198322_1198640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168918621.1|1198644_1199406_-	collagen-like protein	NA	NA	NA	NA	NA
WP_168917934.1|1199915_1200458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917935.1|1200503_1200665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917936.1|1200664_1203490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917937.1|1203477_1204260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917938.1|1204273_1206460_-	tape measure protein	NA	A0A0U3TMF4	Arthrobacter_phage	48.1	1.0e-63
WP_168917939.1|1206477_1206780_-	DUF5361 domain-containing protein	NA	NA	NA	NA	NA
WP_168917940.1|1206863_1207160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917941.1|1207320_1207881_-|tail	phage tail protein	tail	A0A141E164	Streptococcus_phage	47.0	2.2e-39
WP_168917942.1|1207873_1208254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917943.1|1208250_1208490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917944.1|1208492_1208828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917945.1|1208824_1209202_-	hypothetical protein	NA	A0A1D8ETI1	Propionibacterium_phage	51.3	3.7e-22
WP_168917946.1|1209208_1209448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917947.1|1209523_1210495_-	DUF5309 domain-containing protein	NA	A0A1D8ETI7	Propionibacterium_phage	56.9	1.1e-99
WP_168917948.1|1210509_1211058_-	hypothetical protein	NA	A0A1D8EU51	Propionibacterium_phage	43.3	9.1e-22
WP_168917949.1|1211919_1213311_-|portal	phage portal protein	portal	A0A1D8ETN4	Propionibacterium_phage	58.0	1.7e-144
WP_168917950.1|1213314_1214787_-|terminase	terminase	terminase	A0A1D8EU11	Propionibacterium_phage	46.0	1.4e-109
WP_168917951.1|1214758_1215070_-	hypothetical protein	NA	A0A222ZR10	Mycobacterium_phage	44.7	2.6e-05
WP_168918622.1|1215256_1215562_-	HNH endonuclease	NA	A0A2K9VIL1	Propionibacterium_phage	55.3	1.3e-22
WP_168917952.1|1215726_1216332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917953.1|1216425_1216875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917954.1|1217149_1218526_-	DEAD/DEAH box helicase	NA	A0A1L6BZE2	Pasteurella_phage	55.3	2.4e-143
WP_168917955.1|1218506_1218788_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	47.8	7.0e-18
WP_168917956.1|1219261_1221730_-	DNA primase	NA	A0A0A7RWN8	Mycobacterium_phage	40.8	5.0e-83
WP_168917957.1|1221839_1222517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917958.1|1222546_1223314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917959.1|1223310_1223619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917960.1|1223615_1223810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917961.1|1223806_1224154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917962.1|1224153_1224351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917963.1|1224480_1224639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917964.1|1224631_1225291_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_168917965.1|1225290_1225476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917966.1|1225478_1225727_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168917967.1|1225815_1226595_-	phage antirepressor Ant	NA	A0A0C5AEJ9	Bacteriophage	56.5	1.4e-76
WP_168917968.1|1226857_1227376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917969.1|1227605_1227842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917970.1|1227960_1228344_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168917971.1|1228357_1228735_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_168917972.1|1228780_1229215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168917973.1|1229340_1229556_+	transcriptional regulator	NA	A0A2K9VEW2	Mycobacterium_phage	47.4	1.3e-11
WP_168917974.1|1229602_1230823_-|integrase	site-specific integrase	integrase	A0A2P1JR65	Mycobacterium_phage	31.0	2.6e-40
WP_168917975.1|1231095_1231575_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
1230910:1230934	attR	GTGCGCGAGGAGGGACTTGAACCCT	NA	NA	NA	NA
WP_168917976.1|1231611_1231926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168917977.1|1232057_1232588_+	DUF4916 domain-containing protein	NA	NA	NA	NA	NA
WP_168917978.1|1232590_1233220_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	28.9	6.0e-09
WP_168917979.1|1233219_1233963_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_168917980.1|1234089_1234506_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_168917981.1|1234638_1234971_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168917982.1|1235484_1236681_-	Fic family protein	NA	Q9AZ49	Lactococcus_phage	31.2	9.9e-45
WP_168917983.1|1236825_1237626_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_168917984.1|1237638_1238487_-	glutamate racemase	NA	NA	NA	NA	NA
WP_168917985.1|1238497_1239178_-	DUF2017 family protein	NA	NA	NA	NA	NA
WP_168918623.1|1239177_1239366_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
>prophage 4
NZ_CP050804	Arcanobacterium sp. 2701 chromosome, complete genome	1941174	1490807	1498447	1941174	tRNA	Streptomyces_phage(16.67%)	8	NA	NA
WP_168918183.1|1490807_1491494_+	DNA polymerase III subunit epsilon	NA	Q1WDI5	Streptomyces_phage	43.0	1.1e-45
WP_168918184.1|1491557_1493102_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	29.1	1.4e-35
WP_168918185.1|1493105_1493669_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_168918186.1|1493857_1495024_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	34.8	1.3e-62
WP_168918637.1|1495261_1495546_+	WhiB family transcriptional regulator	NA	A0A097EYN9	Mycobacterium_phage	36.1	2.1e-09
WP_168918187.1|1495632_1495929_-	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	49.5	7.4e-18
WP_168918188.1|1496124_1497330_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_168918189.1|1497403_1498447_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	39.2	9.5e-60
