The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051487	Pseudomonas umsongensis strain CY-1 chromosome, complete genome	6690075	1367561	1377072	6690075		Pseudomonas_phage(50.0%)	9	NA	NA
WP_033040739.1|1367561_1368419_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	33.3	6.5e-06
WP_020795994.1|1368524_1369532_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	6.6e-34
WP_083348328.1|1370052_1370376_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_033045311.1|1370518_1373098_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.4	3.1e-27
WP_168759134.1|1373300_1374035_+	helix-turn-helix transcriptional regulator	NA	B5TK58	Pseudomonas_phage	91.4	1.8e-126
WP_020795998.1|1374245_1374593_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	78.1	8.3e-45
WP_020795999.1|1374772_1375339_+	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	73.8	3.9e-76
WP_020796000.1|1375429_1375930_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	85.5	1.4e-72
WP_008060630.1|1376013_1377072_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	58.9	2.7e-110
>prophage 2
NZ_CP051487	Pseudomonas umsongensis strain CY-1 chromosome, complete genome	6690075	2486844	2587244	6690075	plate,terminase,tRNA,integrase,transposase,holin,tail,portal,head	Pseudomonas_phage(32.5%)	133	2494254:2494303	2589507:2589556
WP_008066670.1|2486844_2488767_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	4.5e-124
WP_015095841.1|2488784_2489318_+	translation initiation factor IF-3	NA	NA	NA	NA	NA
WP_002553160.1|2489378_2489573_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_007905879.1|2489601_2489958_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_020799067.1|2490067_2491084_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	39.3	1.1e-28
WP_033042613.1|2491110_2493492_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002553164.1|2493495_2493798_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.8e-11
WP_003179985.1|2493778_2494135_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
2494254:2494303	attL	AGCATGGGGTGCTAGGGGTCGAGTGTTCGAATCACTCCGTCCCGACCATT	NA	NA	NA	NA
WP_168757685.1|2494354_2494921_+	hypothetical protein	NA	Q9ZXJ6	Pseudomonas_virus	32.1	1.3e-15
WP_168759156.1|2494921_2496037_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4JIT5	Pseudomonas_phage	32.3	1.4e-32
WP_104449552.1|2496036_2496249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757686.1|2496787_2497879_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_168757687.1|2498013_2498580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168757688.1|2498712_2499528_-	DUF2303 family protein	NA	I3PUY7	Vibrio_phage	38.4	6.9e-42
WP_168757689.1|2499554_2499902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757690.1|2499992_2500307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757691.1|2500303_2500585_-	hypothetical protein	NA	A0A2H4J404	uncultured_Caudovirales_phage	47.1	4.2e-07
WP_020799057.1|2500901_2501576_-	polysaccharide lyase family 7 protein	NA	NA	NA	NA	NA
WP_168757692.1|2501923_2502316_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JA92	uncultured_Caudovirales_phage	55.4	1.4e-19
WP_168757693.1|2502735_2503047_+	DUF1654 domain-containing protein	NA	A0A2D1GND3	Pseudomonas_phage	63.4	6.3e-28
WP_168757694.1|2503179_2503401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168757695.1|2503808_2503988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757696.1|2504287_2504521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757697.1|2504525_2505407_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH0	Pseudomonas_phage	62.4	2.6e-71
WP_168757698.1|2505512_2505707_+	Cro/Cl family transcriptional regulator	NA	A0A2H4J1L8	uncultured_Caudovirales_phage	53.1	7.0e-09
WP_020799051.1|2505740_2505944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168757699.1|2506193_2506475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168759157.1|2506461_2507130_+	DNA-binding protein	NA	A0A1B0YZY9	Pseudomonas_phage	60.9	4.8e-65
WP_168757700.1|2507129_2507882_+	hypothetical protein	NA	A0A2I2MUI8	uncultured_Caudovirales_phage	80.7	3.8e-111
WP_168759158.1|2507878_2508562_+	Replication protein P	NA	B5WZY0	Pseudomonas_phage	50.8	2.8e-44
WP_168757701.1|2508554_2508758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168757702.1|2508870_2509302_+	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	67.1	1.1e-46
WP_168757703.1|2509298_2510579_+|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	55.1	2.1e-122
WP_168757704.1|2510581_2511094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168757705.1|2511093_2511414_+	hypothetical protein	NA	A0A2D1GNG3	Pseudomonas_phage	73.6	1.3e-39
WP_168757706.1|2511417_2511771_+	antitermination protein Q	NA	A0A2D1GNB4	Pseudomonas_phage	84.6	2.6e-54
WP_168757707.1|2511867_2512101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757708.1|2512305_2512635_+	MFS transporter	NA	A0A088FVG2	Escherichia_phage	44.9	1.9e-19
WP_168757709.1|2512631_2512976_+	hypothetical protein	NA	A0A193GYR7	Enterobacter_phage	41.0	3.6e-08
WP_168757710.1|2512984_2513725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168757711.1|2513851_2514397_+	DNA-packaging protein	NA	A0A1B0Z033	Pseudomonas_phage	70.4	1.3e-65
WP_168757712.1|2514368_2516306_+|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	73.9	3.3e-292
WP_168757713.1|2516314_2516524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168757714.1|2516520_2518041_+|portal	phage portal protein	portal	B7SYD6	Stenotrophomonas_phage	38.2	7.5e-74
WP_168757715.1|2518048_2520004_+	hypothetical protein	NA	A0A2I7S8L6	Vibrio_phage	32.3	1.7e-86
WP_168757716.1|2520083_2520434_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_042955929.1|2520788_2522057_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168757717.1|2522329_2522884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168757718.1|2522880_2523072_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	53.2	2.1e-05
WP_168757719.1|2523068_2524541_+|tail	phage tail protein	tail	A0A0C4UQS0	Shigella_phage	39.8	6.2e-81
WP_168757720.1|2524566_2524935_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_168757721.1|2524934_2525237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168757722.1|2525337_2527425_+	hypothetical protein	NA	A0A2I7QYY1	Vibrio_phage	26.3	9.8e-16
WP_168757723.1|2527437_2528766_+	hypothetical protein	NA	J7FAD8	Agrobacterium_phage	21.7	2.7e-11
WP_168757724.1|2528758_2529883_+	hypothetical protein	NA	M1PVV2	Vibrio_phage	36.7	2.9e-54
WP_168757725.1|2529879_2530395_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	34.7	6.6e-14
WP_168757726.1|2530394_2530862_+	hypothetical protein	NA	Q8W616	Enterobacteria_phage	36.9	3.9e-13
WP_168757727.1|2530861_2531920_+|plate	baseplate J/gp47 family protein	plate	A0A2P9JZK6	Alteromonadaceae_phage	40.4	1.9e-63
WP_168757728.1|2531928_2533737_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	49.5	1.0e-45
WP_168757729.1|2534387_2534612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168757730.1|2534631_2535033_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_168757731.1|2535075_2536128_-	acyltransferase	NA	NA	NA	NA	NA
WP_168757732.1|2536183_2536735_+	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	67.6	3.6e-66
WP_168757733.1|2536731_2537265_+	DUF2514 domain-containing protein	NA	A0A077KH21	Edwardsiella_phage	39.2	5.4e-11
WP_168757734.1|2537222_2537912_-	DUF159 family protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	80.0	5.0e-110
WP_168757735.1|2537914_2538235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757736.1|2538315_2538525_-	hypothetical protein	NA	A0A1B0VP78	Pseudomonas_phage	55.4	2.8e-11
WP_168757737.1|2538747_2539512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168756983.1|2539731_2539875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757738.1|2540347_2541544_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	69.8	3.3e-157
WP_168757739.1|2541943_2542357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168757740.1|2542454_2543048_-	morphogenetic protein	NA	H2BDG4	Pseudomonas_virus	49.3	1.1e-39
WP_168757741.1|2543044_2543359_-	hypothetical protein	NA	A0A059VA44	Pseudomonas_phage	72.1	4.9e-44
WP_168757742.1|2543558_2544170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757743.1|2544335_2546405_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	59.6	2.5e-229
WP_168757744.1|2546488_2546722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168757745.1|2546742_2546892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757746.1|2547028_2548036_-	nucleoid-associated protein YejK	NA	L7TI92	Pseudomonas_virus	66.3	3.6e-125
WP_168757747.1|2548115_2548364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757748.1|2548513_2549254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168757749.1|2549250_2549448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757750.1|2549465_2549822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757751.1|2549823_2550297_-	single-stranded DNA-binding protein	NA	A0A088FAZ2	Sulfitobacter_phage	39.7	1.5e-09
WP_168757752.1|2550306_2550924_-	YqaJ viral recombinase family protein	NA	A0A1B0VMB3	Pseudomonas_phage	82.4	1.7e-96
WP_168757753.1|2550907_2551690_-	single-stranded DNA-binding protein	NA	A0A125RNR3	Pseudomonas_phage	47.5	2.6e-54
WP_168757754.1|2551697_2552852_-	hypothetical protein	NA	W6MYA7	Pseudomonas_phage	69.8	2.9e-41
WP_168757755.1|2553008_2553203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757756.1|2553199_2553400_-	hypothetical protein	NA	A0A1B0VMB8	Pseudomonas_phage	45.9	2.1e-08
WP_168757757.1|2553387_2553828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757758.1|2554197_2554656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757759.1|2555090_2555468_-	hypothetical protein	NA	A0A1V0E899	Vibrio_phage	38.0	1.7e-14
WP_168757760.1|2555652_2556174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757761.1|2556324_2557191_-	damage-inducible protein D	NA	F5A3D6	Riemerella_phage	43.6	1.2e-52
WP_168757762.1|2557340_2557529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757763.1|2557555_2558371_-	LexA family transcriptional regulator	NA	A0A2H4J6Q0	uncultured_Caudovirales_phage	57.6	5.1e-77
WP_168757764.1|2558479_2558674_+	hypothetical protein	NA	A0A2H4J1L8	uncultured_Caudovirales_phage	89.1	3.1e-25
WP_168757765.1|2558704_2558893_+	hypothetical protein	NA	B5WZX7	Pseudomonas_phage	62.9	9.1e-14
WP_168757766.1|2559162_2559369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168759159.1|2559724_2560483_+	phage antirepressor protein	NA	A0A059VF66	Pseudomonas_phage	58.1	6.8e-68
WP_168757767.1|2560479_2561268_+	DUF1376 domain-containing protein	NA	A0A059VF77	Pseudomonas_phage	66.3	1.8e-31
WP_168757768.1|2561267_2561927_+	Replication protein P	NA	W6MVG8	Pseudomonas_phage	55.9	2.1e-60
WP_168757769.1|2562023_2562494_+	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	64.7	5.4e-55
WP_168757770.1|2562490_2563081_+	recombination protein NinG	NA	A0A059VA66	Pseudomonas_phage	69.0	3.6e-72
WP_168757771.1|2563077_2563659_+	hypothetical protein	NA	A0A059VF83	Pseudomonas_phage	68.4	3.8e-74
WP_168759160.1|2563947_2564280_+|holin	phage holin, lambda family	holin	A0A2H4J1U5	uncultured_Caudovirales_phage	56.0	4.0e-28
WP_168757772.1|2564283_2564478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168757773.1|2564536_2565943_+	DUF1073 domain-containing protein	NA	H9C192	Pectobacterium_phage	44.8	4.0e-106
WP_168759161.1|2566010_2566805_+|head	phage head morphogenesis protein	head	A0A2I7QN95	Vibrio_phage	42.6	2.4e-55
WP_168757774.1|2566808_2567918_+	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	48.8	1.8e-53
WP_168757775.1|2567917_2568427_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_168757776.1|2568437_2569415_+	DUF2184 domain-containing protein	NA	A0A2I7QN78	Vibrio_phage	32.6	2.4e-33
WP_168757777.1|2569424_2569607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168757778.1|2569657_2570092_+	DUF4054 domain-containing protein	NA	B5AX60	Iodobacteriophage	39.0	3.4e-11
WP_168757779.1|2570088_2570586_+	hypothetical protein	NA	A0A2I7QQZ3	Vibrio_phage	47.8	3.8e-35
WP_168757780.1|2570585_2571005_+	hypothetical protein	NA	A0A1I9SEU3	Klebsiella_phage	35.4	4.2e-11
WP_168757781.1|2570997_2571555_+	hypothetical protein	NA	A0A2I7R3Y3	Vibrio_phage	28.1	6.7e-12
WP_168757782.1|2571538_2572669_+	DUF3383 domain-containing protein	NA	N0DP63	Edwardsiella_phage	42.7	2.3e-75
WP_168757783.1|2572682_2573087_+	hypothetical protein	NA	L0ASG3	Klebsiella_phage	40.6	1.3e-17
WP_168757784.1|2573083_2573530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168759162.1|2574586_2575615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168757785.1|2575611_2576232_+	hypothetical protein	NA	A0A1I9SEV5	Klebsiella_phage	34.6	1.0e-21
WP_168757786.1|2576228_2576531_+	hypothetical protein	NA	A0A2I7R3Z4	Vibrio_phage	38.8	5.0e-06
WP_168757787.1|2576523_2577477_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	26.2	4.1e-17
WP_168757788.1|2577473_2578148_+	hypothetical protein	NA	N0DPE2	Edwardsiella_phage	38.6	1.2e-26
WP_168757789.1|2578144_2578510_+	hypothetical protein	NA	H9C1B2	Pectobacterium_phage	39.8	1.4e-13
WP_168757790.1|2578509_2579769_+|plate	phage baseplate protein	plate	A0A2I7QR17	Vibrio_phage	39.1	2.1e-66
WP_168757791.1|2579765_2580425_+	DUF2612 domain-containing protein	NA	B5AX81	Iodobacteriophage	35.6	2.6e-23
WP_168757792.1|2580424_2581450_+|tail	tail fiber protein	tail	A0A1L7DQA4	Ralstonia_phage	46.9	6.5e-13
WP_168757793.1|2581446_2581638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168757794.1|2581646_2582096_+|terminase	terminase small subunit	terminase	E5AGA2	Erwinia_phage	53.6	8.8e-31
WP_168757795.1|2582092_2583703_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	47.4	2.2e-148
WP_168757796.1|2583770_2586458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168759163.1|2586596_2587244_+	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	62.7	1.9e-66
2589507:2589556	attR	AGCATGGGGTGCTAGGGGTCGAGTGTTCGAATCACTCCGTCCCGACCATT	NA	NA	NA	NA
>prophage 3
NZ_CP051487	Pseudomonas umsongensis strain CY-1 chromosome, complete genome	6690075	2991139	3032300	6690075	holin,coat	Bacillus_phage(50.0%)	37	NA	NA
WP_050511669.1|2991139_2991898_+|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_168757940.1|2991930_2992749_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_033045682.1|2992878_2993841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757941.1|2993833_2995018_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_168757942.1|2995097_2996180_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_168759169.1|2996176_2997250_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_033045678.1|2997322_2998153_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_020801069.1|2998136_2999279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757943.1|3001759_3003490_+	fatty acyl-AMP ligase	NA	NA	NA	NA	NA
WP_168757944.1|3003486_3004404_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168757945.1|3004439_3004700_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_083348912.1|3004686_3005889_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	32.8	1.3e-41
WP_168757946.1|3005947_3007675_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.8	1.7e-29
WP_033043596.1|3007850_3008627_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_168757947.1|3008680_3010792_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_168757948.1|3010967_3012770_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_168757949.1|3013033_3013879_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_168757950.1|3013939_3014431_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_168757951.1|3014550_3015807_-	MFS transporter	NA	NA	NA	NA	NA
WP_168757952.1|3015905_3016364_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033043439.1|3016412_3016808_-	GFA family protein	NA	NA	NA	NA	NA
WP_020797743.1|3016839_3017235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020797744.1|3017287_3017893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757953.1|3017933_3019268_-	OprD family porin	NA	NA	NA	NA	NA
WP_168757954.1|3019289_3020081_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.3	2.1e-11
WP_020797747.1|3020077_3021094_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	20.9	8.2e-08
WP_168757955.1|3021090_3022104_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168757956.1|3022478_3023645_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_168757957.1|3023836_3024205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168757958.1|3024697_3025630_-	transporter	NA	NA	NA	NA	NA
WP_168757959.1|3025846_3026809_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_168757960.1|3026805_3029163_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_168757961.1|3029239_3030028_-	molecular chaperone	NA	NA	NA	NA	NA
WP_168757962.1|3030072_3030573_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_168757963.1|3030577_3031114_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_168757964.1|3031134_3031665_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_168757965.1|3031772_3032300_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 4
NZ_CP051487	Pseudomonas umsongensis strain CY-1 chromosome, complete genome	6690075	4462729	4469005	6690075	tRNA	uncultured_Caudovirales_phage(83.33%)	8	NA	NA
WP_168759202.1|4462729_4463122_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	80.6	3.8e-54
WP_168758532.1|4463123_4463486_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	67.5	9.9e-41
WP_020799593.1|4463485_4463779_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	67.7	2.8e-30
WP_008062047.1|4463775_4464111_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	80.2	2.7e-45
WP_168758533.1|4464107_4465109_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	86.0	2.5e-166
WP_168758534.1|4465199_4466198_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_168758535.1|4466329_4467724_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_083349381.1|4467724_4469005_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.2	1.6e-96
>prophage 5
NZ_CP051487	Pseudomonas umsongensis strain CY-1 chromosome, complete genome	6690075	6348138	6390952	6690075	transposase,holin,protease	Tupanvirus(33.33%)	39	NA	NA
WP_020796053.1|6348138_6348645_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_020796054.1|6348919_6349807_+	acyltransferase	NA	NA	NA	NA	NA
WP_168759053.1|6349808_6350390_-	DUF2780 domain-containing protein	NA	NA	NA	NA	NA
WP_020796056.1|6350652_6351852_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	26.6	2.3e-09
WP_020796057.1|6352053_6352911_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_020796058.1|6352907_6353069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020796059.1|6353081_6353714_-	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
WP_168759054.1|6353862_6356880_-	sarcosine oxidase subunit alpha	NA	NA	NA	NA	NA
WP_008057118.1|6356876_6357206_-	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_007980419.1|6357220_6358471_-	sarcosine oxidase subunit beta	NA	NA	NA	NA	NA
WP_020796061.1|6358494_6359748_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.2	1.0e-100
WP_168759237.1|6360041_6360770_-	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_168759055.1|6360901_6361942_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_168759056.1|6362179_6362362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020796065.1|6362442_6363543_-	glycine-betaine demethylase subunit GbcB	NA	NA	NA	NA	NA
WP_020796067.1|6363837_6365133_+	glycine-betaine demethylase subunit GbcA	NA	NA	NA	NA	NA
WP_020796068.1|6365984_6366551_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020796069.1|6366573_6367344_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_168759057.1|6367359_6368580_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_168759058.1|6368579_6370526_-	dimethylglycine demethylation protein DgcB	NA	NA	NA	NA	NA
WP_033044081.1|6370660_6372721_-	dimethylglycine demethylation protein DgcA	NA	NA	NA	NA	NA
WP_020796073.1|6372736_6373267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008019494.1|6373345_6374323_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_033044083.1|6374558_6374960_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_020796076.1|6375019_6375436_+	DUF3010 family protein	NA	NA	NA	NA	NA
WP_020796077.1|6375487_6376432_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_020796078.1|6376626_6377571_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_020796079.1|6377645_6378533_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_020796081.1|6378624_6379590_+	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_168759059.1|6379727_6380204_+	thioesterase	NA	NA	NA	NA	NA
WP_168759060.1|6380216_6381380_+	gamma-butyrobetaine dioxygenase	NA	NA	NA	NA	NA
WP_168757207.1|6381476_6382424_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_020796085.1|6382928_6383195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007975492.1|6383297_6384401_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_168759061.1|6384889_6385996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151143613.1|6386091_6387468_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_020796088.1|6387906_6388854_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_020796089.1|6388931_6389777_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_020796090.1|6389773_6390952_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	37.6	7.7e-26
