The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051625	Pseudomonas sp. gcc21 chromosome, complete genome	3983233	866605	893494	3983233	terminase,integrase,portal,protease,lysis	Pseudomonas_phage(54.17%)	41	862632:862650	896117:896135
862632:862650	attL	TCCAGGCAATAAAAAACCC	NA	NA	NA	NA
WP_169406466.1|866605_867745_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J1K3	uncultured_Caudovirales_phage	64.7	1.6e-129
WP_169406467.1|867744_867978_-	hypothetical protein	NA	A0A2H4JA17	uncultured_Caudovirales_phage	79.2	4.3e-29
WP_169406468.1|867995_868250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169406469.1|868545_868875_-	restriction alleviation protein, Lar family	NA	B4UTV4	Rhizobium_phage	53.7	5.7e-11
WP_169406470.1|868871_869204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169406471.1|869230_869545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169406472.1|869519_870194_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_169406473.1|870202_871036_-	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	34.5	4.0e-29
WP_169406474.1|871056_871248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169406475.1|871280_871532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169406476.1|871528_872002_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_169406477.1|872018_872453_-	DUF4406 domain-containing protein	NA	S4TW22	Salmonella_phage	47.8	5.2e-20
WP_169406478.1|872431_872671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169406479.1|872654_872840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169406480.1|872876_873062_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	56.9	3.5e-10
WP_169406481.1|873072_873231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169406482.1|873382_873727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169406483.1|873910_874150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169406484.1|874236_874620_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JTA9	Pseudomonas_phage	41.1	1.1e-10
WP_169406485.1|875538_876651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169406486.1|876758_877865_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_169406487.1|877965_878739_-	S24 family peptidase	NA	A0A0S2SYF7	Pseudomonas_phage	38.9	2.1e-35
WP_169406488.1|878821_879052_+	hypothetical protein	NA	A0A1W6JTD1	Pseudomonas_phage	56.6	1.8e-16
WP_169406489.1|879264_879978_+	DNA-binding protein	NA	A0A0U4J8Z7	Pseudomonas_phage	48.4	5.0e-44
WP_169406490.1|879977_880727_+	hypothetical protein	NA	A0A2I7RQ47	Vibrio_phage	38.2	1.9e-14
WP_169406491.1|880729_881416_+	Replication protein P	NA	A0A2H4J1T4	uncultured_Caudovirales_phage	37.6	1.5e-21
WP_169406492.1|881537_882767_+|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	50.1	1.5e-109
WP_169406493.1|882828_883173_+	hypothetical protein	NA	A0A1X9SFK1	Acinetobacter_phage	59.7	9.5e-17
WP_169406494.1|883372_883729_+	endodeoxyribonuclease RusA	NA	A0A088F6Y8	Sulfitobacter_phage	43.9	8.6e-13
WP_169406495.1|883725_884025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169406496.1|884027_884387_+	antitermination protein Q	NA	B5WZY8	Pseudomonas_phage	60.4	3.4e-33
WP_169406497.1|884770_884977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169406498.1|884973_885510_+	lysozyme	NA	A0A0U4JP67	Pseudomonas_phage	59.9	1.3e-36
WP_169406499.1|885430_885892_+|lysis	lysis protein	lysis	I6WLR5	Burkholderia_virus	39.4	1.0e-13
WP_169406500.1|885888_886623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169406501.1|886755_887298_+	DNA-packaging protein	NA	A0A1B0Z033	Pseudomonas_phage	59.1	1.3e-49
WP_169406502.1|887269_889240_+|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	60.0	8.4e-243
WP_169406503.1|889230_889449_+	primosomal replication protein PriB/PriC domain protein	NA	A0A1B0YZU1	Pseudomonas_phage	62.0	6.2e-14
WP_169406504.1|889445_891074_+|portal	phage portal protein	portal	A0A1W6JTB6	Pseudomonas_phage	72.1	1.3e-228
WP_169409002.1|891090_893109_+|protease	Clp protease ClpP	protease	A0A1B0YZU0	Pseudomonas_phage	65.4	2.6e-223
WP_169406505.1|893179_893494_+	DUF2190 family protein	NA	A0A1W6JT93	Pseudomonas_phage	55.9	3.5e-18
896117:896135	attR	GGGTTTTTTATTGCCTGGA	NA	NA	NA	NA
>prophage 2
NZ_CP051625	Pseudomonas sp. gcc21 chromosome, complete genome	3983233	3032009	3098336	3983233	integrase,transposase	uncultured_Caudovirales_phage(25.0%)	46	3074630:3074645	3103265:3103280
WP_169408234.1|3032009_3033247_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	70.7	3.2e-107
WP_169408235.1|3033258_3033699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169408236.1|3033780_3034644_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_169408237.1|3034844_3035438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169408238.1|3035577_3036384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169408239.1|3039788_3045836_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_169408240.1|3046335_3046932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169408241.1|3047367_3049317_+	NTPase KAP	NA	NA	NA	NA	NA
WP_169408242.1|3049748_3050168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169408243.1|3050164_3051541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169408244.1|3051537_3052305_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_169408245.1|3052574_3052886_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_169408246.1|3052996_3053464_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_169409148.1|3053463_3053895_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_169408247.1|3054403_3054739_+|transposase	transposase	transposase	U5P429	Shigella_phage	49.5	4.3e-22
WP_008958322.1|3055078_3056380_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	39.4	1.4e-84
WP_169408248.1|3056681_3057950_+	ferredoxin reductase family protein	NA	NA	NA	NA	NA
WP_008958323.1|3058056_3059292_-	organoarsenical effux MFS transporter ArsJ	NA	NA	NA	NA	NA
WP_169408249.1|3060361_3060787_-	arsenate reductase ArsC	NA	A0A2H4J437	uncultured_Caudovirales_phage	43.9	4.6e-21
WP_169408250.1|3060918_3061269_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_092850563.1|3061275_3061689_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	67.7	5.1e-41
WP_092850574.1|3061700_3062414_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	66.7	6.9e-86
WP_169408251.1|3062427_3063495_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_169408252.1|3064034_3065570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169408253.1|3065611_3069346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169408254.1|3069417_3070233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169408255.1|3071146_3071545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169408256.1|3071731_3072511_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_169408257.1|3072657_3072906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169409149.1|3072898_3074101_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	31.6	1.5e-40
WP_169408258.1|3074093_3074330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169408259.1|3074464_3074713_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
3074630:3074645	attL	CTGTGTCGATACTTCG	NA	NA	NA	NA
WP_169408260.1|3074840_3076334_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	55.9	8.6e-147
WP_169408261.1|3076330_3077857_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	57.2	9.1e-136
WP_169408262.1|3077849_3079748_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_169408263.1|3080854_3083845_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	40.1	1.0e-199
WP_169408264.1|3083857_3086080_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	31.6	4.5e-27
WP_169408265.1|3086079_3087219_+	5-methylcytosine-specific restriction endonuclease system specificity protein McrC	NA	NA	NA	NA	NA
WP_169408266.1|3087237_3087540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169409150.1|3087960_3088356_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_169408267.1|3088417_3090424_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.3	5.4e-112
WP_169408268.1|3090602_3092285_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
WP_169409151.1|3092293_3092860_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_169408269.1|3093039_3094146_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_169408270.1|3094149_3096360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169408271.1|3096356_3098336_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3103265:3103280	attR	CGAAGTATCGACACAG	NA	NA	NA	NA
>prophage 3
NZ_CP051625	Pseudomonas sp. gcc21 chromosome, complete genome	3983233	3106797	3156182	3983233	integrase,transposase	Salmonella_phage(13.33%)	41	3136881:3136906	3156299:3156324
WP_169409154.1|3106797_3106983_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_136869546.1|3107079_3108317_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	74.4	2.1e-114
WP_169408279.1|3108320_3108725_-	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	49.2	7.7e-26
WP_169408280.1|3108811_3109249_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1B1ITQ0	uncultured_Mediterranean_phage	34.0	6.0e-08
WP_169408281.1|3109241_3109583_+	RulB protein	NA	A0A218MNF2	uncultured_virus	66.3	1.9e-33
WP_034039555.1|3109632_3110922_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_034039553.1|3110914_3112645_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_049306259.1|3113460_3114681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023443007.1|3114661_3115126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058131653.1|3115193_3117884_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_065285146.1|3118433_3119804_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_088813950.1|3119930_3120488_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065285147.1|3120667_3121831_+	MexC family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_034065037.1|3121846_3124981_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.3	3.8e-56
WP_003152694.1|3124985_3126419_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_169409155.1|3126869_3127814_+	DUF4113 domain-containing protein	NA	I6RSM4	Salmonella_phage	44.6	2.2e-68
WP_169408282.1|3128257_3129355_+	DUF262 domain-containing protein	NA	A0A0R6PJX3	Moraxella_phage	34.8	4.5e-44
WP_169408283.1|3129354_3130065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169408284.1|3130064_3131144_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	51.3	4.5e-89
WP_169408285.1|3131409_3132414_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_169408286.1|3132572_3133193_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F2H8	Mycobacterium_phage	31.1	9.4e-07
WP_169408287.1|3133316_3134306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169408288.1|3134314_3135469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169408289.1|3135927_3136476_-	hypothetical protein	NA	NA	NA	NA	NA
3136881:3136906	attL	TTTGGACGGAAAATCCCTAGAACCCC	NA	NA	NA	NA
WP_106761484.1|3138329_3139271_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_169408290.1|3139299_3140514_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.8	4.5e-21
WP_099593669.1|3141641_3142256_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	49.2	3.5e-38
WP_025464697.1|3142321_3143125_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.6	2.2e-24
WP_000480959.1|3143124_3143961_+	APH(6)-I family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
WP_002075255.1|3144221_3145235_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_032495607.1|3145606_3146263_+	quinolone resistance pentapeptide repeat protein QnrVC6	NA	NA	NA	NA	NA
WP_052484405.1|3146510_3146843_+	quaternary ammonium compound efflux SMR transporter QacK	NA	NA	NA	NA	NA
WP_000777555.1|3146985_3147459_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	33.8	3.7e-19
WP_169408291.1|3147567_3148122_+	AacA4 family aminoglycoside N(6')-acetyltransferase	NA	NA	NA	NA	NA
WP_063857839.1|3148679_3149546_+	PSE family carbenicillin-hydrolyzing class A beta-lactamase CARB-12	NA	A0A077SL40	Escherichia_phage	44.5	1.2e-55
WP_001206316.1|3149663_3150455_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|3150618_3150966_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|3150959_3151799_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|3151926_3152427_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012414174.1|3152723_3153011_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_021740570.1|3153164_3156182_-|transposase	Tn3-like element IS3000 family transposase	transposase	NA	NA	NA	NA
3156299:3156324	attR	TTTGGACGGAAAATCCCTAGAACCCC	NA	NA	NA	NA
>prophage 4
NZ_CP051625	Pseudomonas sp. gcc21 chromosome, complete genome	3983233	3661220	3668933	3983233		Thermobifida_phage(16.67%)	10	NA	NA
WP_169408714.1|3661220_3662075_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.3	5.8e-07
WP_169408715.1|3662081_3662540_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_150302816.1|3662561_3662870_-	ribosome-associated translation inhibitor RaiA	NA	A0A0M7QCF2	Escherichia_phage	36.4	4.2e-08
WP_169408716.1|3662946_3664449_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_169408717.1|3664539_3665265_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	1.7e-23
WP_169408718.1|3665257_3665797_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_169408719.1|3665783_3666365_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_169409189.1|3666361_3666880_-	HAD family hydrolase	NA	A0A140XBD6	Dickeya_phage	49.6	1.1e-27
WP_169408720.1|3666894_3667866_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.1	3.6e-37
WP_169408721.1|3668117_3668933_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.2	4.0e-21
