The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051637	Avibacterium paragallinarum strain ADL-AP16 chromosome, complete genome	2415855	257942	279150	2415855	integrase	Mannheimia_phage(44.44%)	33	255952:256003	282295:282346
255952:256003	attL	GACCAATCCCGACTTTCGTTTGAAAGTGGGTATATCCTAAATTAAAGGGCGG	NA	NA	NA	NA
WP_035689252.1|257942_258839_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	49.7	2.9e-73
WP_051128140.1|258898_259294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051128139.1|259290_259608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035689249.1|259694_260174_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	53.5	1.4e-39
WP_046097549.1|260161_260794_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	68.6	1.0e-77
WP_035689246.1|260790_261570_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	62.1	9.8e-86
WP_035689276.1|261580_262522_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	48.0	1.2e-45
WP_035689243.1|263400_263676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046097548.1|263697_264006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051128137.1|264099_264744_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	77.9	5.0e-19
WP_017806446.1|265416_265638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017807323.1|265652_265823_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_136711940.1|266141_266438_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	58.3	2.5e-26
WP_017807324.1|266438_266729_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	47.7	1.1e-13
WP_017807325.1|266875_267649_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_017807326.1|267650_268136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017807327.1|268135_268789_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	70.1	1.0e-67
WP_017807328.1|268926_269133_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168939907.1|269638_270046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046097539.1|270155_270926_+	phage antirepressor KilAC domain-containing protein	NA	D0UIL6	Aggregatibacter_phage	45.4	1.3e-45
WP_035689420.1|270922_271729_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	62.0	3.3e-28
WP_165381618.1|271752_272409_+	hypothetical protein	NA	A0A0M3LS65	Mannheimia_phage	42.2	4.4e-39
WP_052716788.1|272517_273153_+	DUF1367 family protein	NA	A0A2I7RNU5	Vibrio_phage	29.6	3.8e-19
WP_035689367.1|273153_273438_+	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	80.6	2.0e-36
WP_035689370.1|273763_274114_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	42.1	6.2e-16
WP_035689371.1|274113_274476_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_035689374.1|274720_275725_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	24.4	3.8e-05
WP_017807323.1|276022_276193_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_017806446.1|276207_276429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035660437.1|276685_277003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017807508.1|277006_277264_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	53.6	2.0e-11
WP_051128146.1|277244_277952_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_046097210.1|278184_279150_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	39.0	3.6e-61
282295:282346	attR	CCGCCCTTTAATTTAGGATATACCCACTTTCAAACGAAAGTCGGGATTGGTC	NA	NA	NA	NA
>prophage 2
NZ_CP051637	Avibacterium paragallinarum strain ADL-AP16 chromosome, complete genome	2415855	286019	292499	2415855	integrase	Mannheimia_phage(25.0%)	10	280988:281003	293496:293511
280988:281003	attL	GATCACATCAATAACA	NA	NA	NA	NA
WP_035688053.1|286019_286520_+	siphovirus Gp157 family protein	NA	A0A0E3U2R8	Fusobacterium_phage	35.5	3.8e-14
WP_035688055.1|286530_287418_+	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	55.9	1.3e-57
WP_035688057.1|287417_287897_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	52.8	2.1e-38
WP_035688059.1|287905_288154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035688062.1|288196_288511_+	hypothetical protein	NA	X2CY11	Brucella_phage	40.2	3.6e-07
WP_035688065.1|288533_288716_-	hypothetical protein	NA	Q19US2	Mannheimia_phage	52.6	4.0e-06
WP_035688068.1|289025_289235_-	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	58.1	6.1e-11
WP_035688071.1|289749_290412_+	KilA-N domain-containing protein	NA	D0UIM5	Aggregatibacter_phage	43.2	6.5e-14
WP_051128099.1|290655_291252_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_035688073.1|291479_292499_+|integrase	site-specific integrase	integrase	Q7Y5X7	Haemophilus_phage	88.2	2.3e-175
293496:293511	attR	TGTTATTGATGTGATC	NA	NA	NA	NA
>prophage 3
NZ_CP051637	Avibacterium paragallinarum strain ADL-AP16 chromosome, complete genome	2415855	1464648	1487724	2415855		Mannheimia_phage(52.63%)	37	NA	NA
WP_081637566.1|1464648_1465548_-	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	72.1	5.5e-48
WP_035689183.1|1465892_1466111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081637567.1|1466103_1467330_-	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	49.3	5.0e-44
WP_046097530.1|1467552_1467831_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_026138622.1|1467840_1468134_+	HigA family addiction module antidote protein	NA	I6ZVM3	Aeromonas_phage	48.7	4.7e-09
WP_017807426.1|1468243_1468906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017807425.1|1468895_1469537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035689190.1|1469610_1470207_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	43.4	9.6e-33
WP_035689209.1|1470531_1470969_-	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	71.0	8.5e-55
WP_035689193.1|1470977_1471571_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	56.8	6.4e-53
WP_035689196.1|1471567_1472407_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	48.9	4.4e-68
WP_035689199.1|1472399_1473212_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	45.6	1.1e-15
WP_035689202.1|1473208_1473982_-	Rha family transcriptional regulator	NA	A0A2D0YGX8	Vibrio_phage	42.0	6.6e-42
WP_035689204.1|1474028_1474490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046097532.1|1474538_1474760_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	44.6	3.2e-10
WP_046097533.1|1474859_1475525_+	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	77.0	2.0e-71
WP_152436202.1|1476014_1476536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689467.1|1476538_1476979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017807323.1|1477338_1477509_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_017806446.1|1477523_1477745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051128137.1|1478417_1479062_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	77.9	5.0e-19
WP_046097548.1|1479155_1479464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689243.1|1479485_1479761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689276.1|1480639_1481581_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	48.0	1.2e-45
WP_035689246.1|1481591_1482371_+	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	62.1	9.8e-86
WP_046097549.1|1482367_1483000_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	68.6	1.0e-77
WP_035689249.1|1482987_1483467_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	53.5	1.4e-39
WP_051128139.1|1483553_1483871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051128140.1|1483867_1484263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689252.1|1484322_1485219_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	49.7	2.9e-73
WP_035689255.1|1485215_1485425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017807560.1|1485440_1485638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689257.1|1485640_1485970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051128141.1|1486085_1486589_+	hypothetical protein	NA	A0A0M3LNU4	Mannheimia_phage	32.5	1.6e-12
WP_035689260.1|1486581_1486815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689262.1|1486890_1487175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689265.1|1487241_1487724_+	methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	72.3	7.7e-65
>prophage 4
NZ_CP051637	Avibacterium paragallinarum strain ADL-AP16 chromosome, complete genome	2415855	1678812	1765640	2415855	tRNA,terminase,tail,holin,plate,capsid,transposase	Haemophilus_phage(23.94%)	105	NA	NA
WP_046097356.1|1678812_1679298_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_035687040.1|1679493_1680639_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_017807042.1|1680653_1681457_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_017807041.1|1681739_1682558_+	DNA ligase	NA	A0A1X9VNU1	Mimivirus	29.4	3.6e-30
WP_035687043.1|1682968_1684198_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_035687045.1|1684227_1686258_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_035695974.1|1686575_1688252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124994873.1|1688241_1689789_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	32.3	4.0e-22
WP_046097314.1|1689791_1690520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168939946.1|1690888_1692061_+	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	56.2	1.6e-116
WP_168939947.1|1692050_1693487_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.8	1.2e-17
WP_035688629.1|1693593_1694760_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_046097312.1|1694769_1695912_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_035688630.1|1695911_1696709_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_035688632.1|1696705_1697353_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	1.9e-10
WP_124994912.1|1698025_1698277_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_035688634.1|1698773_1699400_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A218M2Y8	Acidovorax_phage	34.4	5.7e-12
WP_035688639.1|1699399_1699825_-	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	41.3	3.3e-19
WP_017807028.1|1699817_1700501_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	48.9	1.1e-53
WP_017807029.1|1700675_1700999_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_035685198.1|1702638_1704318_-|tail	tail fiber protein	tail	Q7Y5S2	Haemophilus_phage	36.3	1.5e-11
WP_017805938.1|1704327_1704942_-	DUF2612 domain-containing protein	NA	A0A0N9SSD8	Pseudomonas_phage	35.8	9.0e-18
WP_035685201.1|1704950_1706387_-|plate	baseplate J/gp47 family protein	plate	E5AGC3	Erwinia_phage	29.8	1.7e-43
WP_017805941.1|1706379_1706745_-	hypothetical protein	NA	D4N458	Pseudomonas_phage	36.9	1.1e-10
WP_017805942.1|1706741_1707413_-|plate	phage baseplate protein	plate	A0A0M5M1K7	Salmonella_phage	33.8	5.6e-21
WP_035685202.1|1707405_1708371_-	hypothetical protein	NA	M4SNA5	Psychrobacter_phage	30.9	3.5e-24
WP_017805944.1|1708348_1708681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168939948.1|1708788_1709631_-	phage antirepressor N-terminal domain-containing protein	NA	A0A0M3LR56	Mannheimia_phage	71.8	2.3e-48
WP_168939949.1|1709956_1711108_-	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	30.3	6.2e-36
WP_035685204.1|1711239_1711833_-	hypothetical protein	NA	I3PGV3	Xanthomonas_phage	26.5	1.3e-08
WP_017805948.1|1711922_1712105_+	type II toxin-antitoxin system HicA family toxin	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	47.5	1.4e-06
WP_017805949.1|1712148_1712568_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A2H4JFV9	uncultured_Caudovirales_phage	46.4	9.4e-27
WP_017805950.1|1712605_1714864_-	tape measure protein	NA	K7RVL7	Vibrio_phage	29.4	1.5e-33
WP_017805951.1|1714860_1715013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017805952.1|1715048_1715534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017805953.1|1715533_1715962_-	DUF3277 family protein	NA	A0A2H4P8K8	Pseudomonas_phage	38.3	4.6e-21
WP_017805954.1|1716013_1717087_-	DUF3383 family protein	NA	A0A0N9SJA3	Pseudomonas_phage	35.5	5.3e-66
WP_017805955.1|1717073_1717583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017805956.1|1717584_1717944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035685207.1|1717943_1718402_-	hypothetical protein	NA	D0UII8	Aggregatibacter_phage	29.0	2.2e-08
WP_017805958.1|1718385_1718739_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_017805960.1|1718969_1719923_-	DUF2184 domain-containing protein	NA	A0A0N9SG07	Pseudomonas_phage	37.6	3.6e-50
WP_017805961.1|1719996_1720413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035685209.1|1720424_1721480_-	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	40.5	3.9e-53
WP_017805963.1|1721567_1722002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035685212.1|1723124_1724432_-	DUF1073 domain-containing protein	NA	A0A2K9V3H1	Faecalibacterium_phage	31.4	3.3e-46
WP_046097305.1|1724434_1725784_-|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	59.0	5.4e-148
WP_017806476.1|1725764_1726292_-|terminase	terminase small subunit	terminase	E5AGA2	Erwinia_phage	43.2	2.4e-19
WP_168939950.1|1726302_1726557_-	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	56.8	2.3e-20
WP_168939980.1|1726540_1726753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168939979.1|1726721_1727084_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_168939951.1|1727043_1727451_-	M15 family metallopeptidase	NA	W0LI70	Edwardsiella_phage	64.4	1.5e-45
WP_017807585.1|1727443_1727776_-|holin	phage holin, lambda family	holin	A0A2D1GNJ3	Pseudomonas_phage	36.8	4.1e-09
WP_130239081.1|1727930_1728248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017807600.1|1728335_1728848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035689440.1|1729031_1729436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035689442.1|1729426_1730032_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	44.9	2.3e-34
WP_035689454.1|1730340_1730994_+	hypothetical protein	NA	D0UIM5	Aggregatibacter_phage	37.6	1.2e-31
WP_168939952.1|1731031_1731457_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	62.1	3.5e-45
WP_103853787.1|1731446_1731674_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	42.6	1.5e-07
WP_168939953.1|1731673_1732351_-	hypothetical protein	NA	A0A1P8DTF3	Proteus_phage	35.7	1.1e-27
WP_168939954.1|1732350_1733088_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	45.1	5.0e-47
WP_046097539.1|1733084_1733855_-	phage antirepressor KilAC domain-containing protein	NA	D0UIL6	Aggregatibacter_phage	45.4	1.3e-45
WP_082082238.1|1733964_1734372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689502.1|1734419_1734713_-	hypothetical protein	NA	Q7Y5W3	Haemophilus_phage	79.2	1.6e-36
WP_035689499.1|1734735_1734936_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	44.6	1.0e-07
WP_035689497.1|1735055_1735814_+	helix-turn-helix domain-containing protein	NA	Q76H56	Enterobacteria_phage	26.1	6.5e-18
WP_017807600.1|1735990_1736503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046097541.1|1736768_1737311_-	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	34.9	2.5e-19
WP_017807585.1|1737414_1737747_+|holin	phage holin, lambda family	holin	A0A2D1GNJ3	Pseudomonas_phage	36.8	4.1e-09
WP_168939951.1|1737739_1738147_+	M15 family metallopeptidase	NA	W0LI70	Edwardsiella_phage	64.4	1.5e-45
WP_168939979.1|1738106_1738469_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_168939980.1|1738437_1738650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168939950.1|1738633_1738888_+	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	56.8	2.3e-20
WP_115615517.1|1738898_1739411_+|terminase	terminase small subunit	terminase	A0A0M3LSU1	Mannheimia_phage	59.8	1.2e-44
WP_046097804.1|1739391_1740741_+|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	58.3	3.0e-143
WP_046097263.1|1740737_1742054_+	DUF1073 domain-containing protein	NA	D0UIJ6	Aggregatibacter_phage	52.8	5.1e-119
WP_168939955.1|1741974_1743372_+|capsid	minor capsid protein	capsid	Q7Y5U5	Haemophilus_phage	45.1	6.5e-56
WP_168939956.1|1743374_1743656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168939957.1|1743723_1744845_+	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	60.2	7.0e-85
WP_017807108.1|1744844_1745297_+	hypothetical protein	NA	D0UIJ1	Aggregatibacter_phage	52.7	3.6e-32
WP_035688838.1|1745309_1746212_+	DUF2184 domain-containing protein	NA	Q7Y5U0	Haemophilus_phage	62.8	3.0e-102
WP_017807106.1|1746220_1746571_+	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	51.7	2.4e-23
WP_035688835.1|1746567_1747011_+	hypothetical protein	NA	Q7Y5T8	Haemophilus_phage	49.6	3.3e-30
WP_017807104.1|1747007_1747355_+	hypothetical protein	NA	Q776V7	Haemophilus_phage	47.9	4.0e-23
WP_051052690.1|1747278_1747791_+	hypothetical protein	NA	Q7Y5T6	Haemophilus_phage	50.6	1.0e-35
WP_168939958.1|1747794_1749297_+	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	74.9	3.9e-216
WP_017807101.1|1749306_1749735_+	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	78.2	7.3e-59
WP_017807100.1|1749737_1750163_+	hypothetical protein	NA	Q776V6	Haemophilus_phage	56.2	3.6e-34
WP_051128129.1|1750292_1752227_+|tail	phage tail tape measure protein	tail	D0UII2	Aggregatibacter_phage	48.2	4.7e-04
WP_035688832.1|1752229_1752577_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	55.3	8.1e-24
WP_081637560.1|1752560_1752815_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	55.8	1.4e-17
WP_035688830.1|1752882_1753644_+	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	53.5	3.0e-63
WP_035688827.1|1753647_1753950_+	hypothetical protein	NA	Q7Y5S9	Haemophilus_phage	56.8	6.1e-28
WP_082082221.1|1753925_1754765_+	replication initiation protein	NA	A0A1V0E006	Clostridioides_phage	35.7	2.2e-14
WP_103846642.1|1755949_1756798_+	hemin receptor	NA	NA	NA	NA	NA
WP_017806206.1|1756760_1757357_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_017806205.1|1757359_1758067_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_035688856.1|1758413_1758740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130231609.1|1759910_1760747_+	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	71.5	3.7e-115
WP_081637559.1|1760743_1761391_+|plate	baseplate protein	plate	D0UIH7	Aggregatibacter_phage	60.8	7.6e-68
WP_081637558.1|1761387_1761738_+	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	66.7	8.6e-42
WP_035688818.1|1761788_1762919_+|plate	baseplate J/gp47 family protein	plate	Q7Y5S4	Haemophilus_phage	66.6	7.7e-140
WP_046097796.1|1762918_1763497_+	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	67.9	1.2e-72
WP_046097262.1|1763501_1765640_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	37.1	7.6e-64
