The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051641	Avibacterium paragallinarum strain ADL-AP02 chromosome, complete genome	2416187	257926	279134	2416187	integrase	Mannheimia_phage(44.44%)	33	255936:255987	282279:282330
255936:255987	attL	GACCAATCCCGACTTTCGTTTGAAAGTGGGTATATCCTAAATTAAAGGGCGG	NA	NA	NA	NA
WP_035689252.1|257926_258823_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	49.7	2.9e-73
WP_051128140.1|258882_259278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051128139.1|259274_259592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035689249.1|259678_260158_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	53.5	1.4e-39
WP_046097549.1|260145_260778_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	68.6	1.0e-77
WP_035689246.1|260774_261554_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	62.1	9.8e-86
WP_035689276.1|261564_262506_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	48.0	1.2e-45
WP_035689243.1|263384_263660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046097548.1|263681_263990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051128137.1|264083_264728_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	77.9	5.0e-19
WP_017806446.1|265400_265622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017807323.1|265636_265807_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_136711940.1|266125_266422_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	58.3	2.5e-26
WP_017807324.1|266422_266713_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	47.7	1.1e-13
WP_017807325.1|266859_267633_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_017807326.1|267634_268120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017807327.1|268119_268773_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	70.1	1.0e-67
WP_017807328.1|268910_269117_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168939907.1|269622_270030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046097539.1|270139_270910_+	phage antirepressor KilAC domain-containing protein	NA	D0UIL6	Aggregatibacter_phage	45.4	1.3e-45
WP_035689420.1|270906_271713_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	62.0	3.3e-28
WP_165381618.1|271736_272393_+	hypothetical protein	NA	A0A0M3LS65	Mannheimia_phage	42.2	4.4e-39
WP_052716788.1|272501_273137_+	DUF1367 family protein	NA	A0A2I7RNU5	Vibrio_phage	29.6	3.8e-19
WP_035689367.1|273137_273422_+	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	80.6	2.0e-36
WP_035689370.1|273747_274098_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	42.1	6.2e-16
WP_035689371.1|274097_274460_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_035689374.1|274704_275709_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	24.4	3.8e-05
WP_017807323.1|276006_276177_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_017806446.1|276191_276413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035660437.1|276669_276987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017807508.1|276990_277248_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	53.6	2.0e-11
WP_051128146.1|277228_277936_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_046097210.1|278168_279134_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	39.0	3.6e-61
282279:282330	attR	CCGCCCTTTAATTTAGGATATACCCACTTTCAAACGAAAGTCGGGATTGGTC	NA	NA	NA	NA
>prophage 2
NZ_CP051641	Avibacterium paragallinarum strain ADL-AP02 chromosome, complete genome	2416187	286003	292483	2416187	integrase	Mannheimia_phage(25.0%)	10	280972:280987	293480:293495
280972:280987	attL	GATCACATCAATAACA	NA	NA	NA	NA
WP_035688053.1|286003_286504_+	siphovirus Gp157 family protein	NA	A0A0E3U2R8	Fusobacterium_phage	35.5	3.8e-14
WP_035688055.1|286514_287402_+	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	55.9	1.3e-57
WP_035688057.1|287401_287881_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	52.8	2.1e-38
WP_035688059.1|287889_288138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035688062.1|288180_288495_+	hypothetical protein	NA	X2CY11	Brucella_phage	40.2	3.6e-07
WP_035688065.1|288517_288700_-	hypothetical protein	NA	Q19US2	Mannheimia_phage	52.6	4.0e-06
WP_035688068.1|289009_289219_-	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	58.1	6.1e-11
WP_035688071.1|289733_290396_+	KilA-N domain-containing protein	NA	D0UIM5	Aggregatibacter_phage	43.2	6.5e-14
WP_051128099.1|290639_291236_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_035688073.1|291463_292483_+|integrase	site-specific integrase	integrase	Q7Y5X7	Haemophilus_phage	88.2	2.3e-175
293480:293495	attR	TGTTATTGATGTGATC	NA	NA	NA	NA
>prophage 3
NZ_CP051641	Avibacterium paragallinarum strain ADL-AP02 chromosome, complete genome	2416187	1465098	1488174	2416187		Mannheimia_phage(52.63%)	37	NA	NA
WP_081637566.1|1465098_1465998_-	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	72.1	5.5e-48
WP_035689183.1|1466342_1466561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081637567.1|1466553_1467780_-	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	49.3	5.0e-44
WP_046097530.1|1468002_1468281_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_026138622.1|1468290_1468584_+	HigA family addiction module antidote protein	NA	I6ZVM3	Aeromonas_phage	48.7	4.7e-09
WP_017807426.1|1468693_1469356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017807425.1|1469345_1469987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035689190.1|1470060_1470657_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	43.4	9.6e-33
WP_035689209.1|1470981_1471419_-	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	71.0	8.5e-55
WP_035689193.1|1471427_1472021_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	56.8	6.4e-53
WP_035689196.1|1472017_1472857_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	48.9	4.4e-68
WP_035689199.1|1472849_1473662_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	45.6	1.1e-15
WP_035689202.1|1473658_1474432_-	Rha family transcriptional regulator	NA	A0A2D0YGX8	Vibrio_phage	42.0	6.6e-42
WP_035689204.1|1474478_1474940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046097532.1|1474988_1475210_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	44.6	3.2e-10
WP_046097533.1|1475309_1475975_+	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	77.0	2.0e-71
WP_156127790.1|1476581_1476986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689467.1|1476988_1477429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017807323.1|1477788_1477959_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_017806446.1|1477973_1478195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051128137.1|1478867_1479512_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	77.9	5.0e-19
WP_046097548.1|1479605_1479914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689243.1|1479935_1480211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689276.1|1481089_1482031_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	48.0	1.2e-45
WP_035689246.1|1482041_1482821_+	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	62.1	9.8e-86
WP_046097549.1|1482817_1483450_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	68.6	1.0e-77
WP_035689249.1|1483437_1483917_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	53.5	1.4e-39
WP_051128139.1|1484003_1484321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051128140.1|1484317_1484713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689252.1|1484772_1485669_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	49.7	2.9e-73
WP_035689255.1|1485665_1485875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017807560.1|1485890_1486088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689257.1|1486090_1486420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051128141.1|1486535_1487039_+	hypothetical protein	NA	A0A0M3LNU4	Mannheimia_phage	32.5	1.6e-12
WP_035689260.1|1487031_1487265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689262.1|1487340_1487625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689265.1|1487691_1488174_+	methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	72.3	7.7e-65
>prophage 4
NZ_CP051641	Avibacterium paragallinarum strain ADL-AP02 chromosome, complete genome	2416187	1679061	1765889	2416187	capsid,holin,terminase,tRNA,plate,tail,transposase	Haemophilus_phage(23.94%)	105	NA	NA
WP_046097356.1|1679061_1679547_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_035687040.1|1679742_1680888_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_017807042.1|1680902_1681706_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_017807041.1|1681988_1682807_+	DNA ligase	NA	A0A1X9VNU1	Mimivirus	29.4	3.6e-30
WP_035687043.1|1683217_1684447_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_035687045.1|1684476_1686507_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_035695974.1|1686824_1688501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124994873.1|1688490_1690038_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	32.3	4.0e-22
WP_046097314.1|1690040_1690769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168939946.1|1691137_1692310_+	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	56.2	1.6e-116
WP_168939947.1|1692299_1693736_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.8	1.2e-17
WP_035688629.1|1693842_1695009_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_046097312.1|1695018_1696161_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_035688630.1|1696160_1696958_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_035688632.1|1696954_1697602_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	1.9e-10
WP_124994912.1|1698274_1698526_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_035688634.1|1699022_1699649_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A218M2Y8	Acidovorax_phage	34.4	5.7e-12
WP_035688639.1|1699648_1700074_-	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	41.3	3.3e-19
WP_017807028.1|1700066_1700750_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	48.9	1.1e-53
WP_017807029.1|1700924_1701248_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_035685198.1|1702887_1704567_-|tail	tail fiber protein	tail	Q7Y5S2	Haemophilus_phage	36.3	1.5e-11
WP_017805938.1|1704576_1705191_-	DUF2612 domain-containing protein	NA	A0A0N9SSD8	Pseudomonas_phage	35.8	9.0e-18
WP_035685201.1|1705199_1706636_-|plate	baseplate J/gp47 family protein	plate	E5AGC3	Erwinia_phage	29.8	1.7e-43
WP_017805941.1|1706628_1706994_-	hypothetical protein	NA	D4N458	Pseudomonas_phage	36.9	1.1e-10
WP_017805942.1|1706990_1707662_-|plate	phage baseplate protein	plate	A0A0M5M1K7	Salmonella_phage	33.8	5.6e-21
WP_035685202.1|1707654_1708620_-	hypothetical protein	NA	M4SNA5	Psychrobacter_phage	30.9	3.5e-24
WP_017805944.1|1708597_1708930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168939948.1|1709037_1709880_-	phage antirepressor N-terminal domain-containing protein	NA	A0A0M3LR56	Mannheimia_phage	71.8	2.3e-48
WP_168939949.1|1710205_1711357_-	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	30.3	6.2e-36
WP_035685204.1|1711488_1712082_-	hypothetical protein	NA	I3PGV3	Xanthomonas_phage	26.5	1.3e-08
WP_017805948.1|1712171_1712354_+	type II toxin-antitoxin system HicA family toxin	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	47.5	1.4e-06
WP_017805949.1|1712397_1712817_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A2H4JFV9	uncultured_Caudovirales_phage	46.4	9.4e-27
WP_017805950.1|1712854_1715113_-	tape measure protein	NA	K7RVL7	Vibrio_phage	29.4	1.5e-33
WP_017805951.1|1715109_1715262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017805952.1|1715297_1715783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017805953.1|1715782_1716211_-	DUF3277 family protein	NA	A0A2H4P8K8	Pseudomonas_phage	38.3	4.6e-21
WP_017805954.1|1716262_1717336_-	DUF3383 family protein	NA	A0A0N9SJA3	Pseudomonas_phage	35.5	5.3e-66
WP_017805955.1|1717322_1717832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017805956.1|1717833_1718193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035685207.1|1718192_1718651_-	hypothetical protein	NA	D0UII8	Aggregatibacter_phage	29.0	2.2e-08
WP_017805958.1|1718634_1718988_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_017805960.1|1719218_1720172_-	DUF2184 domain-containing protein	NA	A0A0N9SG07	Pseudomonas_phage	37.6	3.6e-50
WP_017805961.1|1720245_1720662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035685209.1|1720673_1721729_-	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	40.5	3.9e-53
WP_017805963.1|1721816_1722251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035685212.1|1723373_1724681_-	DUF1073 domain-containing protein	NA	A0A2K9V3H1	Faecalibacterium_phage	31.4	3.3e-46
WP_046097305.1|1724683_1726033_-|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	59.0	5.4e-148
WP_017806476.1|1726013_1726541_-|terminase	terminase small subunit	terminase	E5AGA2	Erwinia_phage	43.2	2.4e-19
WP_168939950.1|1726551_1726806_-	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	56.8	2.3e-20
WP_168939980.1|1726789_1727002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168939979.1|1726970_1727333_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_168939951.1|1727292_1727700_-	M15 family metallopeptidase	NA	W0LI70	Edwardsiella_phage	64.4	1.5e-45
WP_017807585.1|1727692_1728025_-|holin	phage holin, lambda family	holin	A0A2D1GNJ3	Pseudomonas_phage	36.8	4.1e-09
WP_130239081.1|1728179_1728497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017807600.1|1728584_1729097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035689440.1|1729280_1729685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035689442.1|1729675_1730281_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	44.9	2.3e-34
WP_035689454.1|1730589_1731243_+	hypothetical protein	NA	D0UIM5	Aggregatibacter_phage	37.6	1.2e-31
WP_168939952.1|1731280_1731706_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	62.1	3.5e-45
WP_103853787.1|1731695_1731923_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	42.6	1.5e-07
WP_168939953.1|1731922_1732600_-	hypothetical protein	NA	A0A1P8DTF3	Proteus_phage	35.7	1.1e-27
WP_168939954.1|1732599_1733337_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	45.1	5.0e-47
WP_046097539.1|1733333_1734104_-	phage antirepressor KilAC domain-containing protein	NA	D0UIL6	Aggregatibacter_phage	45.4	1.3e-45
WP_082082238.1|1734213_1734621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689502.1|1734668_1734962_-	hypothetical protein	NA	Q7Y5W3	Haemophilus_phage	79.2	1.6e-36
WP_035689499.1|1734984_1735185_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	44.6	1.0e-07
WP_035689497.1|1735304_1736063_+	helix-turn-helix domain-containing protein	NA	Q76H56	Enterobacteria_phage	26.1	6.5e-18
WP_017807600.1|1736239_1736752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046097541.1|1737017_1737560_-	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	34.9	2.5e-19
WP_017807585.1|1737663_1737996_+|holin	phage holin, lambda family	holin	A0A2D1GNJ3	Pseudomonas_phage	36.8	4.1e-09
WP_168939951.1|1737988_1738396_+	M15 family metallopeptidase	NA	W0LI70	Edwardsiella_phage	64.4	1.5e-45
WP_168939979.1|1738355_1738718_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_168939980.1|1738686_1738899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168939950.1|1738882_1739137_+	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	56.8	2.3e-20
WP_115615517.1|1739147_1739660_+|terminase	terminase small subunit	terminase	A0A0M3LSU1	Mannheimia_phage	59.8	1.2e-44
WP_046097804.1|1739640_1740990_+|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	58.3	3.0e-143
WP_046097263.1|1740986_1742303_+	DUF1073 domain-containing protein	NA	D0UIJ6	Aggregatibacter_phage	52.8	5.1e-119
WP_168939955.1|1742223_1743621_+|capsid	minor capsid protein	capsid	Q7Y5U5	Haemophilus_phage	45.1	6.5e-56
WP_168939956.1|1743623_1743905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168939957.1|1743972_1745094_+	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	60.2	7.0e-85
WP_017807108.1|1745093_1745546_+	hypothetical protein	NA	D0UIJ1	Aggregatibacter_phage	52.7	3.6e-32
WP_035688838.1|1745558_1746461_+	DUF2184 domain-containing protein	NA	Q7Y5U0	Haemophilus_phage	62.8	3.0e-102
WP_017807106.1|1746469_1746820_+	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	51.7	2.4e-23
WP_035688835.1|1746816_1747260_+	hypothetical protein	NA	Q7Y5T8	Haemophilus_phage	49.6	3.3e-30
WP_017807104.1|1747256_1747604_+	hypothetical protein	NA	Q776V7	Haemophilus_phage	47.9	4.0e-23
WP_051052690.1|1747527_1748040_+	hypothetical protein	NA	Q7Y5T6	Haemophilus_phage	50.6	1.0e-35
WP_168939958.1|1748043_1749546_+	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	74.9	3.9e-216
WP_017807101.1|1749555_1749984_+	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	78.2	7.3e-59
WP_017807100.1|1749986_1750412_+	hypothetical protein	NA	Q776V6	Haemophilus_phage	56.2	3.6e-34
WP_051128129.1|1750541_1752476_+|tail	phage tail tape measure protein	tail	D0UII2	Aggregatibacter_phage	48.2	4.7e-04
WP_035688832.1|1752478_1752826_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	55.3	8.1e-24
WP_081637560.1|1752809_1753064_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	55.8	1.4e-17
WP_035688830.1|1753131_1753893_+	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	53.5	3.0e-63
WP_035688827.1|1753896_1754199_+	hypothetical protein	NA	Q7Y5S9	Haemophilus_phage	56.8	6.1e-28
WP_082082221.1|1754174_1755014_+	replication initiation protein	NA	A0A1V0E006	Clostridioides_phage	35.7	2.2e-14
WP_103846642.1|1756198_1757047_+	hemin receptor	NA	NA	NA	NA	NA
WP_017806206.1|1757009_1757606_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_017806205.1|1757608_1758316_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_035688856.1|1758662_1758989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130231609.1|1760159_1760996_+	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	71.5	3.7e-115
WP_081637559.1|1760992_1761640_+|plate	baseplate protein	plate	D0UIH7	Aggregatibacter_phage	60.8	7.6e-68
WP_081637558.1|1761636_1761987_+	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	66.7	8.6e-42
WP_035688818.1|1762037_1763168_+|plate	baseplate J/gp47 family protein	plate	Q7Y5S4	Haemophilus_phage	66.6	7.7e-140
WP_046097796.1|1763167_1763746_+	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	67.9	1.2e-72
WP_046097262.1|1763750_1765889_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	37.1	7.6e-64
