The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051672	Parabacteroides distasonis strain CBBP chromosome, complete genome	5379509	363589	373485	5379509		Catovirus(25.0%)	10	NA	NA
WP_170104909.1|363589_364525_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	29.1	1.6e-29
WP_170104910.1|364521_365772_+	HAD-IIIA family hydrolase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	24.7	5.5e-06
WP_170104911.1|365786_366776_+	GHMP kinase	NA	A0A067XQL1	Caulobacter_phage	36.1	3.8e-42
WP_170104912.1|366777_367347_+	SIS domain-containing protein	NA	A0A067XQR2	Caulobacter_phage	35.9	2.4e-25
WP_170104913.1|367348_368161_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_170104914.1|368391_369597_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	A0A127AXI2	Bacillus_phage	26.5	6.1e-26
WP_170104915.1|369626_370787_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	28.5	3.6e-28
WP_170104916.1|370783_371974_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_005867972.1|372169_372631_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	42.7	2.2e-21
WP_005855789.1|372855_373485_-	master DNA invertase Mpi family serine-type recombinase	NA	H2A0H0	Bacteroides_phage	54.8	7.0e-50
>prophage 2
NZ_CP051672	Parabacteroides distasonis strain CBBP chromosome, complete genome	5379509	808775	861280	5379509	protease,integrase	BeAn_58058_virus(25.0%)	52	827802:827817	866863:866878
WP_005856073.1|808775_810005_-|integrase	phage integrase SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_024986818.1|811482_811818_-	DUF4133 domain-containing protein	NA	NA	NA	NA	NA
WP_024986817.1|811849_812149_-	DUF4134 domain-containing protein	NA	NA	NA	NA	NA
WP_036617877.1|812297_813020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024986816.1|813032_813395_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_024986815.1|813398_814157_-	ParA family protein	NA	NA	NA	NA	NA
WP_154398040.1|814239_814413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024986813.1|814920_815367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024986812.1|815341_816568_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_168166623.1|816614_818627_+	YWFCY domain-containing protein	NA	NA	NA	NA	NA
WP_036617874.1|818685_819300_-	tetracycline resistance element mobilization regulatory protein rteC	NA	NA	NA	NA	NA
WP_036651041.1|819406_820246_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036617890.1|820453_822769_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_024986810.1|822819_823938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036617869.1|823959_824478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024986808.1|824521_824980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024986807.1|825053_825251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024986806.1|825269_825644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024986804.1|826186_826582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036617867.1|826619_827357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036617859.1|827381_827828_-	hypothetical protein	NA	NA	NA	NA	NA
827802:827817	attL	GCTGCTCTTTTTTATA	NA	NA	NA	NA
WP_051635715.1|827923_828508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024986802.1|828583_829309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036617888.1|829345_829813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036617856.1|829842_830640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024986799.1|830708_831161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036653193.1|831233_831881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036617852.1|831913_832669_-	DUF1911 domain-containing protein	NA	NA	NA	NA	NA
WP_036617887.1|832983_833409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036617847.1|833475_834093_-	ankyrin repeat domain-containing protein	NA	A0A1L3IZC0	BeAn_58058_virus	39.5	1.2e-06
WP_051635714.1|834198_834786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036651038.1|834812_835853_-	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_036617843.1|835891_836866_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036617840.1|836873_838451_-	ankyrin repeat domain-containing protein	NA	A0A0M3ZJY4	Turkeypox_virus	28.6	7.7e-05
WP_051635713.1|838440_838926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036617838.1|838938_839628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051635712.1|839945_844076_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_036617836.1|844132_844555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036617834.1|844628_845060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024986787.1|845071_845698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036617881.1|845717_846080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051635711.1|846957_847350_-	DUF4377 domain-containing protein	NA	NA	NA	NA	NA
WP_024986783.1|847426_847729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036617879.1|847819_849166_-	BatD family protein	NA	NA	NA	NA	NA
WP_024986781.1|849702_850314_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024986780.1|850532_851897_+	DUF3945 domain-containing protein	NA	NA	NA	NA	NA
WP_036651035.1|851927_854027_+	type IA DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	21.6	1.6e-13
WP_024986779.1|854061_854529_+	DUF1896 domain-containing protein	NA	NA	NA	NA	NA
WP_170106530.1|854848_858025_+	N-6 DNA methylase	NA	A0A248SL14	Klebsiella_phage	28.2	5.8e-60
WP_016278433.1|858082_859294_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_130054668.1|859290_860247_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_170105083.1|860230_861280_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
866863:866878	attR	GCTGCTCTTTTTTATA	NA	NA	NA	NA
>prophage 3
NZ_CP051672	Parabacteroides distasonis strain CBBP chromosome, complete genome	5379509	1325144	1375494	5379509	integrase	unidentified_phage(14.29%)	51	1360080:1360094	1379855:1379869
WP_065538044.1|1325144_1326380_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	30.4	1.1e-27
WP_024988123.1|1326391_1326763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071807633.1|1326851_1327148_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065540274.1|1327144_1327429_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100263463.1|1327642_1328002_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065538043.1|1328023_1328374_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_170105306.1|1328404_1329979_+	DUF4099 domain-containing protein	NA	NA	NA	NA	NA
WP_065538041.1|1330038_1332129_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	30.9	3.6e-42
WP_065538040.1|1332293_1332746_+	DUF1896 domain-containing protein	NA	NA	NA	NA	NA
WP_170105308.1|1332735_1336545_+	N-6 DNA methylase	NA	A0A240F4T3	Ochrobactrum_phage	34.4	4.1e-36
WP_170105083.1|1336602_1337652_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_130054668.1|1337635_1338592_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016278433.1|1338588_1339800_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_170105310.1|1341620_1343306_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	49.3	3.2e-134
WP_170106538.1|1343307_1344588_+	DNA methylase	NA	H2DE57	Erwinia_phage	26.5	3.2e-17
WP_065540271.1|1344731_1345343_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_170105312.1|1345468_1346575_+|integrase	site-specific integrase	integrase	S5W9T9	Leptospira_phage	33.6	3.1e-29
WP_121737179.1|1346650_1347397_+	BatD family protein	NA	NA	NA	NA	NA
WP_170105314.1|1347516_1348050_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_016274264.1|1348161_1348755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007654000.1|1348854_1349484_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_117912829.1|1349556_1349901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170106539.1|1350009_1350645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024986785.1|1350724_1351117_+	DUF4377 domain-containing protein	NA	NA	NA	NA	NA
WP_120466179.1|1351203_1351845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170105316.1|1351951_1352755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170105318.1|1352826_1353258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024986785.1|1353336_1353729_+	DUF4377 domain-containing protein	NA	NA	NA	NA	NA
WP_170105320.1|1353803_1354268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170105322.1|1354305_1355076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104369553.1|1355135_1355855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170105324.1|1355873_1356383_+	DUF4375 domain-containing protein	NA	NA	NA	NA	NA
WP_065538018.1|1356413_1356788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170105326.1|1356864_1357731_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_170105328.1|1357823_1360139_+	response regulator	NA	B5LWN0	Feldmannia_species_virus	25.7	3.0e-21
1360080:1360094	attL	AAGGGTTCGGAGATA	NA	NA	NA	NA
WP_170105330.1|1360131_1361454_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_065538014.1|1361735_1362149_+	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_065538013.1|1362359_1362977_+	RteC protein	NA	NA	NA	NA	NA
WP_065538012.1|1363108_1364557_+	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_065538011.1|1364559_1364949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538010.1|1365008_1367018_-	YWFCY domain-containing protein	NA	NA	NA	NA	NA
WP_065538009.1|1367048_1368299_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_121737100.1|1368277_1368706_-	MobA protein	NA	NA	NA	NA	NA
WP_170105332.1|1369092_1369260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538007.1|1369396_1370158_+	ParA family protein	NA	NA	NA	NA	NA
WP_170106540.1|1370244_1370583_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_157448008.1|1370729_1371188_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_065538006.1|1371184_1371916_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_008782546.1|1372120_1372432_+	DUF4134 domain-containing protein	NA	NA	NA	NA	NA
WP_170105333.1|1372442_1372775_+	DUF4133 domain-containing protein	NA	NA	NA	NA	NA
WP_005856073.1|1374264_1375494_+|integrase	phage integrase SAM-like domain-containing protein	integrase	NA	NA	NA	NA
1379855:1379869	attR	AAGGGTTCGGAGATA	NA	NA	NA	NA
>prophage 4
NZ_CP051672	Parabacteroides distasonis strain CBBP chromosome, complete genome	5379509	1571035	1580080	5379509		Synechococcus_phage(42.86%)	8	NA	NA
WP_121772608.1|1571035_1572187_-	GDP-mannose 4,6-dehydratase	NA	A0A0E3F1J3	Synechococcus_phage	62.0	9.6e-122
WP_121772607.1|1572212_1573289_-	GDP-L-fucose synthase	NA	M4R1H4	Synechococcus_phage	47.0	8.2e-83
WP_008772418.1|1573314_1574190_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.6	4.6e-108
WP_121772606.1|1574278_1574803_-	hypothetical protein	NA	K4JW05	Caulobacter_phage	37.6	2.9e-17
WP_057328371.1|1575052_1575754_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_057328372.1|1575758_1577225_-	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	41.4	2.0e-87
WP_057328373.1|1577229_1578690_-	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	27.2	3.7e-38
WP_121772605.1|1578700_1580080_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	45.8	2.6e-105
>prophage 5
NZ_CP051672	Parabacteroides distasonis strain CBBP chromosome, complete genome	5379509	2292395	2343502	5379509	integrase	Rhodobacter_phage(20.0%)	45	2320241:2320264	2348810:2348833
WP_005841877.1|2292395_2293421_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005924223.1|2293423_2294410_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005841879.1|2294393_2295650_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004304290.1|2296010_2296319_+	hypothetical protein	NA	A0A0K1LL53	Rhodobacter_phage	44.6	4.8e-12
WP_004291527.1|2296352_2296742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004291526.1|2296806_2297334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004291525.1|2297330_2297834_-	DUF3872 domain-containing protein	NA	NA	NA	NA	NA
WP_004291524.1|2297830_2298733_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_004291523.1|2298740_2299316_-	conjugal transfer protein TraO	NA	NA	NA	NA	NA
WP_004291522.1|2299318_2300305_-	conjugative transposon protein TraN	NA	NA	NA	NA	NA
WP_004291521.1|2300339_2301692_-	conjugative transposon protein TraM	NA	NA	NA	NA	NA
WP_004291518.1|2302642_2303647_-	conjugative transposon protein TraJ	NA	NA	NA	NA	NA
WP_004304283.1|2303650_2304280_-	DUF4141 domain-containing protein	NA	NA	NA	NA	NA
WP_004291516.1|2304303_2304684_-	DUF3876 domain-containing protein	NA	NA	NA	NA	NA
WP_008645841.1|2306383_2306965_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_004309979.1|2307120_2307531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008645844.1|2307813_2308011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117543722.1|2308324_2309044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170105688.1|2309048_2309969_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_004315361.1|2309934_2310318_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_007656447.1|2310463_2311429_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_007656440.1|2311591_2312665_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005856071.1|2312654_2313008_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_102408426.1|2313260_2313665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117678389.1|2313668_2314898_-|integrase	phage integrase SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_004291514.1|2316387_2316720_-	DUF4133 domain-containing protein	NA	NA	NA	NA	NA
WP_002560983.1|2316730_2317048_-	DUF4134 domain-containing protein	NA	NA	NA	NA	NA
WP_004304280.1|2317249_2317978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004291505.1|2317994_2318348_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_004291503.1|2318350_2318791_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_004291492.1|2318793_2319843_-	ParA family protein	NA	NA	NA	NA	NA
2320241:2320264	attL	TCAATCCGCTAAATCCAAAGTAAT	NA	NA	NA	NA
WP_004291488.1|2320264_2320693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004291483.1|2320671_2321919_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_004291482.1|2321949_2323968_+	YWFCY domain-containing protein	NA	NA	NA	NA	NA
WP_004291481.1|2324099_2327354_-	NTPase	NA	NA	NA	NA	NA
WP_004291480.1|2327370_2328501_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004304269.1|2328802_2329408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004291474.1|2329646_2330069_-	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_004291471.1|2330348_2331671_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004291467.1|2331663_2333982_-	response regulator	NA	B5LWN0	Feldmannia_species_virus	25.1	1.6e-19
WP_004291466.1|2333981_2335907_-	tetracycline resistance ribosomal protection protein Tet(Q)	NA	A0A1S5SF82	Streptococcus_phage	41.0	4.5e-140
WP_141806856.1|2336564_2337830_-	DNA methylase	NA	H2DE57	Erwinia_phage	25.7	2.7e-16
WP_170105310.1|2337831_2339517_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	49.3	3.2e-134
WP_016278433.1|2341337_2342549_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_130054668.1|2342545_2343502_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2348810:2348833	attR	ATTACTTTGGATTTAGCGGATTGA	NA	NA	NA	NA
>prophage 6
NZ_CP051672	Parabacteroides distasonis strain CBBP chromosome, complete genome	5379509	2466288	2522188	5379509	tail,integrase,head	unidentified_phage(16.67%)	60	2491844:2491859	2525182:2525197
WP_170105734.1|2466288_2467524_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	38.0	2.4e-33
WP_135039418.1|2467526_2467901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162222466.1|2467929_2468175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024988615.1|2468231_2468537_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_121767487.1|2468589_2468862_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_170105736.1|2469362_2469872_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_170105738.1|2470152_2470575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170105739.1|2470827_2471649_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_170105740.1|2471729_2472350_+	chloramphenicol acetyltransferase	NA	NA	NA	NA	NA
WP_170105741.1|2472551_2473889_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_170105742.1|2473901_2474519_+	CatB-related O-acetyltransferase	NA	A0A1V0SJ47	Klosneuvirus	36.5	1.4e-23
WP_170105743.1|2474524_2476834_+	response regulator	NA	B5LWN0	Feldmannia_species_virus	24.2	1.2e-19
WP_170105744.1|2476826_2478149_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_170105745.1|2479896_2483334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158532980.1|2483330_2483783_+	response regulator	NA	NA	NA	NA	NA
WP_158532981.1|2483779_2485012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170105746.1|2485191_2486190_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.8	2.9e-66
WP_005858424.1|2487423_2487897_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_094582198.1|2487997_2488804_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005858428.1|2488902_2489265_+	VOC family protein	NA	NA	NA	NA	NA
WP_010801812.1|2490701_2490917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010801811.1|2490928_2491150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010801810.1|2491163_2491580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010801809.1|2491576_2492869_+	PcfJ family protein	NA	NA	NA	NA	NA
2491844:2491859	attL	ATGGAGTATTTCTCCA	NA	NA	NA	NA
WP_032934929.1|2492893_2493151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010801807.1|2493171_2493402_+	DUF3873 domain-containing protein	NA	NA	NA	NA	NA
WP_170104824.1|2493398_2493539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005841879.1|2493675_2494932_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005924223.1|2494915_2495902_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005841877.1|2495904_2496930_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_010801805.1|2497244_2497553_+	hypothetical protein	NA	S5M7P0	Sinorhizobium_phage	42.0	3.1e-11
WP_016274252.1|2497671_2497893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010801803.1|2497938_2498877_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_010801802.1|2498873_2499911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010801801.1|2499977_2500508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010801800.1|2500504_2501008_-	DUF3872 domain-containing protein	NA	NA	NA	NA	NA
WP_010801799.1|2501004_2501907_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_010801798.1|2501914_2502490_-	conjugal transfer protein TraO	NA	NA	NA	NA	NA
WP_010801797.1|2502492_2503479_-	conjugative transposon protein TraN	NA	NA	NA	NA	NA
WP_010801796.1|2503516_2504869_-	conjugative transposon protein TraM	NA	NA	NA	NA	NA
WP_010801795.1|2504849_2505137_-	DUF3989 domain-containing protein	NA	NA	NA	NA	NA
WP_004293887.1|2505176_2505800_-	conjugative transposon protein TraK	NA	NA	NA	NA	NA
WP_010801794.1|2505832_2506837_-	conjugative transposon protein TraJ	NA	NA	NA	NA	NA
WP_118468579.1|2506840_2507470_-	DUF4141 domain-containing protein	NA	NA	NA	NA	NA
WP_010801791.1|2507493_2507874_-	DUF3876 domain-containing protein	NA	NA	NA	NA	NA
WP_118468581.1|2507912_2510417_-	TraG family conjugative transposon ATPase	NA	NA	NA	NA	NA
WP_010801789.1|2510413_2510746_-	DUF4133 domain-containing protein	NA	NA	NA	NA	NA
WP_005796934.1|2510757_2511075_-	DUF4134 domain-containing protein	NA	NA	NA	NA	NA
WP_010801786.1|2511276_2512005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035457778.1|2512021_2512375_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_010801784.1|2512377_2512818_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_010801783.1|2512820_2513870_-	ParA family protein	NA	NA	NA	NA	NA
WP_010801782.1|2514291_2514720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010801781.1|2514698_2515946_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_010801780.1|2515976_2517986_+	YWFCY domain-containing protein	NA	NA	NA	NA	NA
WP_010801779.1|2518050_2518656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010801778.1|2518907_2519321_-	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_107031784.1|2519706_2520840_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	25.3	4.2e-05
WP_107031783.1|2521135_2521507_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_107031760.1|2521519_2522188_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
2525182:2525197	attR	ATGGAGTATTTCTCCA	NA	NA	NA	NA
>prophage 7
NZ_CP051672	Parabacteroides distasonis strain CBBP chromosome, complete genome	5379509	2637630	2661640	5379509	integrase	Agrobacterium_phage(50.0%)	20	2649848:2649861	2666388:2666401
WP_104368505.1|2637630_2638974_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_104368506.1|2638977_2640309_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_010801754.1|2640702_2640972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010801753.1|2640982_2641651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010801752.1|2641666_2642035_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_170106548.1|2642220_2643501_-	DNA methylase	NA	A0A223W0B5	Agrobacterium_phage	26.5	8.4e-18
WP_170105310.1|2643502_2645188_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	49.3	3.2e-134
WP_170105083.1|2647029_2648079_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_130054668.1|2648062_2649019_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016278433.1|2649015_2650227_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2649848:2649861	attL	TTCACATTTATTGA	NA	NA	NA	NA
WP_170105764.1|2650284_2654058_-	N-6 DNA methylase	NA	A0A223W0B5	Agrobacterium_phage	31.8	9.7e-38
WP_010801748.1|2654047_2654500_-	DUF1896 domain-containing protein	NA	NA	NA	NA	NA
WP_170105765.1|2654663_2656754_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	31.2	1.1e-43
WP_010801746.1|2656816_2658382_-	DUF3945 domain-containing protein	NA	NA	NA	NA	NA
WP_005802306.1|2658402_2658753_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010801744.1|2658756_2659113_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010801743.1|2659315_2659615_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004310576.1|2659646_2659952_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010801741.1|2660030_2660393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010801740.1|2660404_2661640_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2666388:2666401	attR	TCAATAAATGTGAA	NA	NA	NA	NA
>prophage 8
NZ_CP051672	Parabacteroides distasonis strain CBBP chromosome, complete genome	5379509	2708451	2764874	5379509	transposase,integrase	unidentified_phage(28.57%)	53	2707241:2707256	2752346:2752361
2707241:2707256	attL	ATGGAACTAATAAATA	NA	NA	NA	NA
WP_170105785.1|2708451_2709678_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	39.8	8.0e-34
WP_036616098.1|2710334_2711009_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_041525636.1|2711014_2711620_-	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_122246345.1|2712030_2713605_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	31.1	4.3e-24
WP_170105786.1|2713625_2715008_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_022193172.1|2715020_2715959_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_005858717.1|2715984_2716671_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012056204.1|2716680_2717262_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_170105787.1|2717368_2719693_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_170105788.1|2719840_2721040_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	24.8	2.1e-23
WP_034531524.1|2721092_2722298_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_005868583.1|2722297_2722897_-	sugar transferase	NA	NA	NA	NA	NA
WP_170106549.1|2722900_2724082_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_170105789.1|2724117_2725278_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_008772570.1|2725315_2726830_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_008772571.1|2726854_2728294_-	O-antigen polysaccharide polymerase Wzy family protein	NA	NA	NA	NA	NA
WP_005868573.1|2728347_2729325_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	31.9	9.3e-09
WP_170105790.1|2729596_2731168_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005868570.1|2731315_2731516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008772573.1|2731625_2732168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170105791.1|2732164_2733955_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_005868558.1|2734040_2734235_+	DUF4248 domain-containing protein	NA	NA	NA	NA	NA
WP_005868557.1|2734336_2734762_+	peptidase M15	NA	B5TR94	Bacteroides_phage	48.5	8.9e-33
WP_005858742.1|2734882_2735374_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_022193190.1|2735445_2735553_+	smalltalk protein	NA	NA	NA	NA	NA
WP_170105792.1|2735526_2737467_-	polysaccharide biosynthesis protein	NA	A0A2K9V8D7	Bandra_megavirus	28.4	6.3e-25
WP_008772577.1|2737483_2737864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005858746.1|2737875_2738940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008772578.1|2739445_2740378_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	27.9	2.9e-12
WP_005858748.1|2740464_2740854_+	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
WP_170105793.1|2740867_2741050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022193193.1|2741215_2742550_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_170105794.1|2742738_2744169_+	phosphotransferase	NA	NA	NA	NA	NA
WP_005858756.1|2744165_2744903_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_170105795.1|2744918_2745950_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_022193195.1|2746030_2748985_-	response regulator	NA	NA	NA	NA	NA
WP_009017035.1|2749180_2750515_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_005858764.1|2750613_2751171_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_170106550.1|2751167_2751482_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_140394005.1|2751791_2753459_-	hypothetical protein	NA	NA	NA	NA	NA
2752346:2752361	attR	TATTTATTAGTTCCAT	NA	NA	NA	NA
WP_087346041.1|2753483_2753684_-	DUF2589 domain-containing protein	NA	NA	NA	NA	NA
WP_087346038.1|2754022_2754493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122143977.1|2754582_2754924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087346035.1|2754916_2755900_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_087346030.1|2756217_2756400_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_087880463.1|2756494_2756890_+	pilus assembly protein HicB	NA	NA	NA	NA	NA
WP_087346025.1|2757074_2757296_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005868529.1|2757581_2758319_-	acyltransferase	NA	NA	NA	NA	NA
WP_004356044.1|2759586_2759808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007135033.1|2760000_2760120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005642186.1|2760483_2761929_-|transposase	IS4-like element ISBf8 family transposase	transposase	NA	NA	NA	NA
WP_005642186.1|2762199_2763645_-|transposase	IS4-like element ISBf8 family transposase	transposase	NA	NA	NA	NA
WP_170105796.1|2763767_2764874_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP051672	Parabacteroides distasonis strain CBBP chromosome, complete genome	5379509	2874539	2944524	5379509	protease,tRNA,tail,transposase	Bacillus_virus(18.18%)	57	NA	NA
WP_005867105.1|2874539_2875772_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	52.7	2.4e-115
WP_005853931.1|2875793_2876456_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	46.7	4.8e-41
WP_005853929.1|2876645_2877998_-	trigger factor	NA	NA	NA	NA	NA
WP_036618446.1|2878141_2879029_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005853924.1|2879023_2879776_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	1.1e-22
WP_036618449.1|2879860_2880976_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_008773770.1|2881151_2881898_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005853918.1|2881900_2882671_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	35.4	1.7e-29
WP_005867099.1|2882785_2884072_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	49.0	2.2e-106
WP_008778718.1|2884321_2884516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005867096.1|2884546_2885005_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_005853911.1|2885015_2886065_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_005867095.1|2886077_2886785_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_005867094.1|2886788_2887589_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_005853907.1|2887585_2887825_-	DUF3098 domain-containing protein	NA	NA	NA	NA	NA
WP_170105810.1|2887852_2888731_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_008773777.1|2889202_2889355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170105811.1|2889532_2894878_-	Ig domain-containing protein	NA	B8QTT6	Erwinia_phage	54.1	5.8e-12
WP_170106553.1|2894898_2898450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005862367.1|2899222_2899600_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_095231420.1|2899608_2900589_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	28.2	7.6e-19
WP_009017957.1|2901144_2901783_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_009017956.1|2901779_2902112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170105812.1|2902259_2903633_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_009017954.1|2903893_2904352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005867081.1|2904453_2905950_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_009017953.1|2906129_2907317_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_009017952.1|2907325_2908213_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005867076.1|2908228_2908981_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.2	4.0e-20
WP_170105813.1|2909005_2909680_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_170105814.1|2909720_2910935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170105815.1|2910995_2913434_-	glycoside hydrolase family 95 protein	NA	NA	NA	NA	NA
WP_087346971.1|2913587_2914397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087346974.1|2914417_2916115_-	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_057328127.1|2916395_2918243_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.4	4.6e-57
WP_170105816.1|2918372_2919215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022192254.1|2919218_2919689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022192255.1|2919692_2920769_+	radical SAM protein	NA	NA	NA	NA	NA
WP_011966845.1|2920826_2922602_+	DUF4091 domain-containing protein	NA	NA	NA	NA	NA
WP_170105817.1|2922787_2925139_+	beta-glucosidase	NA	NA	NA	NA	NA
WP_121735780.1|2925199_2925793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008773795.1|2925977_2926229_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_008773796.1|2926255_2926555_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_170105818.1|2926547_2926889_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_008773798.1|2926972_2927671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170105819.1|2928296_2929148_+	hemagglutinin	NA	NA	NA	NA	NA
WP_008773800.1|2929263_2929473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087346995.1|2929654_2930968_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_008773803.1|2930992_2931883_-	GTPase Era	NA	NA	NA	NA	NA
WP_008779906.1|2931866_2932871_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_005634607.1|2932974_2933160_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_005867041.1|2933172_2933763_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_057328117.1|2933851_2935009_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005867039.1|2941124_2941661_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_170106554.1|2941751_2942507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170105820.1|2942526_2944035_+|tail	phage tail sheath family protein	tail	A0A142EZL9	Stenotrophomonas_phage	31.1	1.5e-10
WP_005861441.1|2944071_2944524_+|tail	phage tail protein	tail	A0A059XEM3	uncultured_phage	45.1	1.8e-23
>prophage 10
NZ_CP051672	Parabacteroides distasonis strain CBBP chromosome, complete genome	5379509	4431250	4516084	5379509	transposase,tRNA,integrase	Bacillus_phage(20.0%)	58	4423441:4423456	4522535:4522550
4423441:4423456	attL	TGGCAAGAAAAAAGAA	NA	NA	NA	NA
WP_005867488.1|4431250_4432303_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005859552.1|4432452_4432965_+	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_170106229.1|4433053_4433863_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_170106230.1|4434013_4434856_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_170106231.1|4434870_4437519_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_009275358.1|4437522_4438560_+	DUF4249 domain-containing protein	NA	NA	NA	NA	NA
WP_011967328.1|4441395_4442511_+	DUF4249 domain-containing protein	NA	NA	NA	NA	NA
WP_036610131.1|4442463_4443282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008772825.1|4443383_4443935_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_170106583.1|4443921_4445295_+	PorT family protein	NA	NA	NA	NA	NA
WP_036650615.1|4445315_4446578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170106584.1|4449118_4449694_+	response regulator	NA	NA	NA	NA	NA
WP_170106232.1|4449712_4450690_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_008772819.1|4450686_4451019_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_170106233.1|4451334_4454034_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_170106234.1|4454854_4457809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170106235.1|4458953_4459727_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_008779191.1|4459745_4460315_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	28.6	3.5e-08
WP_170106236.1|4460746_4463143_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_170106237.1|4463305_4467415_+	response regulator	NA	W8CYF6	Bacillus_phage	37.1	7.6e-28
WP_170106238.1|4467353_4469741_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_008772813.1|4469954_4470728_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_008772812.1|4470698_4471304_-	DUF4858 domain-containing protein	NA	NA	NA	NA	NA
WP_170106239.1|4471520_4472885_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_128577343.1|4472881_4473889_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	31.5	1.1e-07
WP_170106240.1|4473883_4476532_-	response regulator	NA	A0A1V0SGX0	Hokovirus	29.4	1.4e-35
WP_057319049.1|4476664_4479058_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_087879907.1|4479128_4479791_+|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005867529.1|4479851_4480169_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	38.9	6.2e-15
WP_008772806.1|4480256_4484060_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	33.4	4.7e-181
WP_170106241.1|4484866_4488058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008777864.1|4488541_4489174_+	PorT family protein	NA	NA	NA	NA	NA
WP_005859486.1|4489369_4489825_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_005859484.1|4489830_4490217_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_005859482.1|4490356_4491193_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_005867537.1|4491337_4492327_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_005859478.1|4492482_4493676_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_005859476.1|4493757_4494975_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	45.2	3.0e-97
WP_009275387.1|4494999_4496925_-	YjgP/YjgQ family permease	NA	NA	NA	NA	NA
WP_005859472.1|4497027_4497411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005859470.1|4498402_4499335_-	FimB/Mfa2 family fimbrial subunit	NA	NA	NA	NA	NA
WP_087342336.1|4499899_4501801_+	response regulator	NA	NA	NA	NA	NA
WP_087342094.1|4502256_4503591_+	fimbrial protein	NA	NA	NA	NA	NA
WP_005862367.1|4504012_4504390_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_170106534.1|4504398_4505379_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	28.2	9.9e-19
WP_087342339.1|4505993_4507361_-	fimbrial protein	NA	NA	NA	NA	NA
WP_170106585.1|4507836_4508196_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_170106242.1|4508298_4509528_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	29.7	2.1e-21
WP_170106243.1|4509541_4510762_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	26.5	2.7e-13
WP_170106244.1|4510783_4511158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170106245.1|4511169_4511352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008761211.1|4511485_4512328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170106246.1|4512329_4512473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148356471.1|4512620_4512926_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_170106247.1|4512979_4513291_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_170106248.1|4513700_4514168_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_170106249.1|4514448_4514874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170106250.1|4514875_4516084_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4522535:4522550	attR	TTCTTTTTTCTTGCCA	NA	NA	NA	NA
>prophage 11
NZ_CP051672	Parabacteroides distasonis strain CBBP chromosome, complete genome	5379509	5051911	5061309	5379509	integrase	Organic_Lake_phycodnavirus(33.33%)	7	5057398:5057436	5061223:5061261
WP_087375728.1|5051911_5054617_+	DEAD/DEAH box helicase family protein	NA	A0A2I7SC38	Paenibacillus_phage	23.8	1.6e-13
WP_087375727.1|5054621_5056040_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	27.0	4.5e-28
WP_087375726.1|5056043_5057174_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	27.6	1.7e-25
WP_122132814.1|5057220_5058627_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	25.1	1.7e-08
5057398:5057436	attL	GATACGCCCCATTATGAGAACGTGCCGTTTGAAGTGCCG	NA	NA	NA	NA
WP_087375798.1|5058657_5059461_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0H4TI16	Erysipelothrix_phage	23.8	6.9e-10
WP_087375797.1|5059551_5059995_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_170106392.1|5059989_5061309_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	41.6	4.0e-15
5061223:5061261	attR	CGGCACTTCAAACGGCACGTTCTCATAATGGGGCGTATC	NA	NA	NA	NA
>prophage 12
NZ_CP051672	Parabacteroides distasonis strain CBBP chromosome, complete genome	5379509	5103438	5116338	5379509		Croceibacter_phage(22.22%)	19	NA	NA
WP_170106595.1|5103438_5104977_-	hypothetical protein	NA	Q6J7X1	Actinoplanes_phage	26.4	9.4e-32
WP_170106432.1|5105130_5105709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170106433.1|5105705_5105984_-	spermidine synthase	NA	I6S756	Croceibacter_phage	57.1	1.4e-23
WP_170106434.1|5105986_5107540_-	site-specific DNA-methyltransferase	NA	I6R9Y1	Croceibacter_phage	40.1	1.0e-86
WP_170106435.1|5107643_5108009_-	hypothetical protein	NA	A0A0P0IKL1	Acinetobacter_phage	42.1	3.3e-20
WP_170106436.1|5108109_5108484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170106437.1|5108559_5108934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170106438.1|5109087_5109375_-	DUF4884 domain-containing protein	NA	Q333I1	Escherichia_virus	42.0	1.6e-06
WP_170106439.1|5109371_5109527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170106440.1|5109539_5109854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170106441.1|5109861_5110116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170106442.1|5110112_5110346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120177924.1|5110333_5110519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170106443.1|5110523_5110808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170106444.1|5110827_5112648_-	toprim domain-containing protein	NA	A0A218ML96	uncultured_virus	40.4	3.9e-109
WP_170106445.1|5112644_5113616_-	DUF4373 domain-containing protein	NA	H7BVC7	unidentified_phage	55.6	4.0e-36
WP_170106446.1|5113628_5115005_-	DEAD/DEAH box helicase family protein	NA	A0A0S2MWK8	Cellulophaga_phage	34.2	9.3e-55
WP_170106447.1|5115167_5115341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170106448.1|5115396_5116338_-	endonuclease	NA	A0A222ZFK1	Arthrobacter_phage	28.6	1.9e-22
