The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051862	Acinetobacter baumannii strain Ab-C102 chromosome, complete genome	3763047	630376	638577	3763047		uncultured_Caudovirales_phage(71.43%)	10	NA	NA
WP_000213576.1|630376_630811_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.8	1.8e-41
WP_000373080.1|630866_631190_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	61.0	1.2e-21
WP_002125971.1|631196_631670_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	50.6	6.2e-35
WP_000068659.1|631677_632718_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_001052988.1|632722_633427_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.5	1.3e-92
WP_002061937.1|633445_634399_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.8	1.6e-61
WP_002061939.1|634504_635572_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	59.5	9.3e-95
WP_032013557.1|635865_636657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770669.1|637091_637364_+	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_000394713.1|637353_638577_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A222YXG1	Escherichia_phage	47.1	5.4e-22
>prophage 2
NZ_CP051862	Acinetobacter baumannii strain Ab-C102 chromosome, complete genome	3763047	1199085	1211644	3763047	transposase	Acinetobacter_phage(54.55%)	12	NA	NA
WP_002122868.1|1199085_1200018_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	43.6	8.7e-65
WP_000152665.1|1200201_1200438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000195750.1|1201099_1201555_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	96.7	7.2e-81
WP_125565065.1|1201602_1202058_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	95.5	1.7e-69
WP_004841829.1|1202017_1202659_+	hypothetical protein	NA	A0A0P0I449	Acinetobacter_phage	85.9	3.6e-110
WP_140953704.1|1202716_1203193_+	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	53.6	4.5e-33
WP_169040947.1|1203911_1206974_+	CotH kinase family protein	NA	H7BUR7	unidentified_phage	33.8	4.7e-06
WP_125565046.1|1206970_1207624_+	metallophosphoesterase	NA	K7PJZ5	Enterobacterial_phage	43.4	2.3e-40
WP_002126537.1|1207678_1208113_+	C40 family peptidase	NA	A0A0B5A615	Paracoccus_phage	33.3	5.9e-08
WP_049590657.1|1208113_1210603_+	hypothetical protein	NA	A0A1I9L2F3	Xanthomonas_phage	23.1	1.5e-07
WP_114249554.1|1210666_1211056_+	hypothetical protein	NA	J7I481	Acinetobacter_phage	98.4	1.2e-65
WP_125564982.1|1211098_1211644_+	N-acetylmuramidase	NA	A0A0P0IW03	Acinetobacter_phage	95.0	4.3e-96
>prophage 3
NZ_CP051862	Acinetobacter baumannii strain Ab-C102 chromosome, complete genome	3763047	1281345	1327429	3763047	tRNA,transposase	Acinetobacter_phage(33.33%)	48	NA	NA
WP_000636785.1|1281345_1281579_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001185369.1|1281730_1282402_-	LexA family transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	56.6	1.1e-64
WP_000016216.1|1282614_1282812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427177.1|1282979_1283369_+	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	74.4	4.8e-49
WP_038343677.1|1283406_1283952_+	N-acetylmuramidase	NA	A0A0N7IRF5	Acinetobacter_phage	71.8	5.1e-73
WP_000015971.1|1284018_1284636_-	LysE family translocator	NA	NA	NA	NA	NA
WP_000072673.1|1285146_1285362_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	65.0	7.7e-17
WP_000350299.1|1285565_1285790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002123465.1|1286070_1286442_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025469473.1|1286471_1287404_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_100223092.1|1287415_1287934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001982898.1|1288090_1288210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001127325.1|1288694_1289153_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.8	3.5e-27
WP_049590653.1|1289731_1290664_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_000356133.1|1290817_1291198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002125242.1|1291585_1291939_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001182279.1|1292241_1293663_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.8	1.1e-55
WP_001133555.1|1293876_1294854_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	9.5e-38
WP_000179337.1|1294857_1295397_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_000381220.1|1295434_1295983_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000554244.1|1295966_1296515_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_001183458.1|1296514_1297261_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.1e-20
WP_168071625.1|1297787_1299011_+	TolC family protein	NA	NA	NA	NA	NA
WP_169040948.1|1299007_1301149_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.5	4.7e-29
WP_002125245.1|1301145_1302336_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002125235.1|1302427_1303027_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.6	3.8e-21
WP_000132356.1|1303019_1303631_+	chloramphenicol acetyltransferase CAT	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	55.6	1.6e-11
WP_001082436.1|1303786_1304629_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	2.6e-36
WP_001186837.1|1304745_1305414_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	43.3	3.3e-26
WP_000232556.1|1305553_1306225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000144889.1|1306405_1306729_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_086231346.1|1307073_1307604_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002125252.1|1307668_1310314_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.5	6.0e-34
WP_002125239.1|1311176_1312037_+	EamA family transporter	NA	NA	NA	NA	NA
WP_079269831.1|1312544_1313894_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_025467284.1|1315232_1315595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000157163.1|1315793_1316324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049590625.1|1316351_1317284_+|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
WP_000925271.1|1317437_1318466_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025466306.1|1318675_1319374_-	DUF1826 domain-containing protein	NA	NA	NA	NA	NA
WP_000398515.1|1319624_1320575_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_079265541.1|1320732_1320927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001127331.1|1321179_1321638_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.1	6.9e-31
WP_079265542.1|1322572_1323016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000631583.1|1323023_1324040_+	DUF1911 domain-containing protein	NA	NA	NA	NA	NA
WP_004739252.1|1324193_1325126_-|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
WP_000667189.1|1325629_1325908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049590623.1|1326496_1327429_+|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP051862	Acinetobacter baumannii strain Ab-C102 chromosome, complete genome	3763047	1817746	1879014	3763047	transposase	Planktothrix_phage(20.0%)	53	NA	NA
WP_169040973.1|1817746_1818679_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_086231623.1|1819097_1820132_-	anthranilate 1,2-dioxygenase electron transfer component AntC	NA	NA	NA	NA	NA
WP_000076814.1|1820137_1820629_-	anthranilate 1,2-dioxygenase small subunit	NA	NA	NA	NA	NA
WP_002122423.1|1820631_1822047_-	anthranilate 1,2-dioxygenase large subunit	NA	NA	NA	NA	NA
WP_000664115.1|1822269_1822620_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038342286.1|1822808_1823588_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005135276.1|1823584_1824277_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_038342287.1|1824281_1824902_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.4	2.9e-16
WP_001257949.1|1825261_1826032_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005069253.1|1826099_1826762_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_001040033.1|1827235_1828168_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.6	1.7e-60
WP_000207886.1|1828315_1828717_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_038343862.1|1828784_1830575_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000202702.1|1830881_1832957_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_001982218.1|1833180_1833255_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_038343859.1|1833330_1834242_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_000195110.1|1834250_1835009_+	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_001031362.1|1835005_1835290_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_000134716.1|1835286_1836441_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_031987674.1|1836457_1837510_+	dipeptidase	NA	NA	NA	NA	NA
WP_002122418.1|1838092_1838266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000044010.1|1838519_1838756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000582742.1|1838923_1839511_+	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_002122425.1|1839519_1840410_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_025469515.1|1840449_1841382_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002122847.1|1841807_1842275_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	52.4	8.6e-37
WP_004739252.1|1843005_1843938_+|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
WP_000060708.1|1845045_1846104_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000209267.1|1846117_1846828_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_000279315.1|1846860_1848054_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002122576.1|1848064_1849639_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000155281.1|1849644_1850796_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000096369.1|1850792_1851641_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000024066.1|1851643_1853461_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	4.2e-23
WP_000997920.1|1853487_1854753_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000209742.1|1855077_1856130_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_169040974.1|1856413_1858225_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	26.6	1.2e-38
WP_169040975.1|1858221_1860054_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.5	2.3e-48
WP_002126609.1|1860130_1860253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557769.1|1860220_1862713_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	36.5	4.9e-14
WP_086231556.1|1862801_1864013_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002056344.1|1865433_1866366_-|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
WP_000985610.1|1866593_1866875_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.3	5.7e-12
WP_079283165.1|1866875_1867073_-	addiction module killer protein	NA	A0A141GEX6	Brucella_phage	53.1	5.4e-09
WP_001133624.1|1869079_1869355_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_038343718.1|1869376_1870489_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	30.1	5.6e-34
WP_004740248.1|1870719_1871550_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_004740247.1|1871790_1872093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004740246.1|1872695_1873853_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000697980.1|1873938_1874616_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000655282.1|1874814_1875942_+	alkene reductase	NA	NA	NA	NA	NA
WP_000804055.1|1876369_1876978_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004739641.1|1878081_1879014_-|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP051862	Acinetobacter baumannii strain Ab-C102 chromosome, complete genome	3763047	2220309	2283943	3763047	tRNA,transposase	uncultured_virus(25.0%)	60	NA	NA
WP_004739252.1|2220309_2221242_-|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
WP_000774578.1|2221496_2221724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109442.1|2222012_2222456_+	universal stress protein	NA	NA	NA	NA	NA
WP_038343916.1|2222715_2224299_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.6	2.8e-31
WP_038343919.1|2224372_2224798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049590948.1|2225083_2226016_+|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
WP_002124446.1|2226267_2226399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031949896.1|2226578_2227691_-	OmpW family protein	NA	NA	NA	NA	NA
WP_002124441.1|2227996_2230153_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_001019951.1|2230345_2230852_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_169041037.1|2230884_2231256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004738162.1|2231294_2232518_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.3	3.2e-43
WP_000650375.1|2232783_2233065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001123845.1|2233253_2233724_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.4	4.9e-32
WP_000179474.1|2234136_2234388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005138671.1|2234686_2235922_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_005138665.1|2238706_2239261_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001055585.1|2239528_2239912_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000618092.1|2239908_2240244_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001094410.1|2240318_2241902_+|transposase	IS66-like element ISAba25 family transposase	transposase	A0A218MNE7	uncultured_virus	53.8	2.1e-143
WP_001122273.1|2242204_2242714_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001043692.1|2244140_2245073_+|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
WP_024438812.1|2245213_2245552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000262548.1|2246149_2246647_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005110386.1|2246675_2247233_-	chorismate mutase	NA	NA	NA	NA	NA
WP_005138662.1|2247310_2247994_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000135427.1|2248003_2248765_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005138661.1|2248772_2249459_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_005138659.1|2249648_2252255_-	aminopeptidase N	NA	NA	NA	NA	NA
WP_000420541.1|2252573_2252831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162622129.1|2253048_2254140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169040985.1|2254173_2255001_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000312221.1|2255029_2255881_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_086231500.1|2255962_2256328_-	5-carboxymethyl-2-hydroxymuconate Delta-isomerase	NA	NA	NA	NA	NA
WP_002124462.1|2256365_2258078_-	AAA family ATPase	NA	A0A172Q090	Acinetobacter_phage	40.0	1.3e-77
WP_002124459.1|2258308_2259481_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_049590947.1|2259676_2260645_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000494374.1|2260641_2261832_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002124458.1|2261975_2263487_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001075435.1|2263708_2265145_+	ethanolamine permease	NA	NA	NA	NA	NA
WP_046127667.1|2265161_2266547_+	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_169040986.1|2266557_2267373_+	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_046127668.1|2267537_2268260_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_046127669.1|2268744_2270472_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.2	1.2e-187
WP_000009660.1|2270640_2271150_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	34.0	9.4e-13
WP_049590946.1|2271165_2271885_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000462398.1|2271892_2272123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049590945.1|2273314_2273968_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_049590944.1|2274006_2274864_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001983665.1|2274995_2275514_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000070779.1|2275596_2276541_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_000129005.1|2276547_2278500_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	33.1	3.5e-84
WP_031944287.1|2278492_2278966_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_087450874.1|2279115_2279994_+	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_001232531.1|2280105_2280414_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_000637089.1|2280510_2280954_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049590942.1|2280946_2281651_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000351255.1|2281751_2281970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880863.1|2282223_2282676_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004738527.1|2282788_2283943_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP051862	Acinetobacter baumannii strain Ab-C102 chromosome, complete genome	3763047	2547110	2561909	3763047		Acinetobacter_phage(100.0%)	10	NA	NA
WP_002126589.1|2547110_2547686_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	99.5	4.6e-109
WP_169040997.1|2547782_2550554_-	ERAP1-like C-terminal domain-containing protein	NA	A0A0P0IY26	Acinetobacter_phage	98.3	0.0e+00
WP_038343171.1|2550561_2553294_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	97.8	0.0e+00
WP_001982145.1|2553650_2554700_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000608303.1|2554709_2555516_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	99.3	1.1e-145
WP_000066123.1|2555525_2556221_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	99.6	2.2e-121
WP_001164233.1|2556231_2557215_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	96.0	2.9e-183
WP_038343173.1|2557221_2559597_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	98.0	0.0e+00
WP_049590920.1|2559598_2561098_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	98.2	4.1e-282
WP_001187844.1|2561360_2561909_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
>prophage 7
NZ_CP051862	Acinetobacter baumannii strain Ab-C102 chromosome, complete genome	3763047	2943378	3002010	3763047	tRNA,transposase	uncultured_virus(30.0%)	52	NA	NA
WP_000582207.1|2943378_2943852_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_000350917.1|2943928_2945302_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_032069041.1|2945369_2946641_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.2	5.3e-97
WP_001177773.1|2946759_2947548_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_042893601.1|2947616_2948321_-|transposase	IS6-like element IS1008 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	3.9e-118
WP_088766618.1|2948503_2949151_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000201632.1|2949439_2949697_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_000271409.1|2949715_2950027_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_000667115.1|2950123_2950423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169041006.1|2950470_2951448_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_000547886.1|2951462_2953523_+	site-specific recombinase	NA	NA	NA	NA	NA
WP_169041007.1|2953707_2954334_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000986589.1|2954358_2955609_+	multidrug efflux RND transporter periplasmic adaptor subunit AdeI	NA	NA	NA	NA	NA
WP_114237844.1|2955621_2958798_+	multidrug efflux RND transporter permease subunit AdeJ	NA	NA	NA	NA	NA
WP_001174793.1|2958797_2960252_+	multidrug efflux RND transporter outer membrane channel subunit AdeK	NA	NA	NA	NA	NA
WP_000927238.1|2960361_2960712_+	YbjQ family protein	NA	NA	NA	NA	NA
WP_000369287.1|2960719_2961154_+	YbjQ family protein	NA	NA	NA	NA	NA
WP_000371762.1|2961150_2961585_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_005134847.1|2961639_2962446_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005134846.1|2962471_2963149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169041008.1|2963345_2966225_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.5	3.7e-146
WP_038343040.1|2966312_2966657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038343038.1|2967048_2968050_+	5'-nucleotidase	NA	NA	NA	NA	NA
WP_162541885.1|2968089_2969088_-	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_038343036.1|2969234_2970140_-	AEC family transporter	NA	NA	NA	NA	NA
WP_000144737.1|2970256_2971141_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001181774.1|2971443_2972631_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	36.0	2.4e-43
WP_000184466.1|2972783_2973482_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000559381.1|2973482_2974817_-	two-component system sensor histidine kinase PmrB	NA	NA	NA	NA	NA
WP_000161506.1|2974843_2975518_-	DNA-binding response regulator PmrA	NA	NA	NA	NA	NA
WP_031944804.1|2975532_2977182_-	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_038343033.1|2977364_2978669_-	porin	NA	NA	NA	NA	NA
WP_162540306.1|2979214_2980435_-	MFS transporter	NA	NA	NA	NA	NA
WP_000434847.1|2980589_2981216_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_000684978.1|2981283_2982201_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_169041009.1|2982306_2982768_+	NfeD family protein	NA	NA	NA	NA	NA
WP_001143941.1|2982796_2983651_+	SPFH/Band 7/PHB domain protein	NA	S4VVY8	Pandoravirus	29.3	4.0e-08
WP_002126298.1|2983713_2984088_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000097109.1|2984147_2985059_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_038343028.1|2985219_2986407_-	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_002016863.1|2986786_2988142_+	amino acid permease	NA	NA	NA	NA	NA
WP_000343018.1|2989071_2990280_+|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
WP_000425406.1|2991216_2991930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001178549.1|2992053_2992266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002126289.1|2992268_2992931_+	phage antirepressor KilAC domain-containing protein	NA	A0A0K1LJZ5	Vibrio_phage	46.8	2.1e-41
WP_001055585.1|2994140_2994524_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000618092.1|2994520_2994856_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001094410.1|2994930_2996514_+|transposase	IS66-like element ISAba25 family transposase	transposase	A0A218MNE7	uncultured_virus	53.8	2.1e-143
WP_002125436.1|2996953_2998114_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	24.5	1.1e-08
WP_004739641.1|2998500_2999433_-|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
WP_000343018.1|2999679_3000888_+|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
WP_004739641.1|3001077_3002010_-|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP051863	Acinetobacter baumannii strain Ab-C102 plasmid pAb-C102_1, complete sequence	90089	2403	76468	90089	transposase,integrase	Escherichia_phage(25.0%)	56	38635:38655	71341:71361
WP_002048759.1|2403_3336_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	43.9	1.5e-64
WP_005199967.1|3484_3949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169041043.1|3934_6673_-	UvrD-helicase domain-containing protein	NA	A0A1V0SG90	Hokovirus	25.9	3.6e-18
WP_005199963.1|7104_7881_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005199962.1|7880_8447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047473329.1|8448_11841_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	27.6	4.5e-50
WP_151686052.1|11940_12696_+	multiubiquitin domain-containing protein	NA	NA	NA	NA	NA
WP_169041044.1|12670_13855_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_005199958.1|13848_14313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000058345.1|14576_15167_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001058024.1|15259_16099_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002055813.1|16123_16663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693745.1|17047_19003_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	41.1	2.1e-129
WP_016805832.1|19507_20833_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001140620.1|20916_21219_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004967307.1|21211_21568_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000480968.1|21788_22625_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|22624_23428_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_086374392.1|23503_24436_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.0	1.6e-58
WP_051626581.1|24443_24698_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|24784_25600_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_085940648.1|25689_26779_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_169041045.1|26801_27830_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_023434504.1|27913_28582_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.1	5.5e-37
WP_169041046.1|29817_30522_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.5e-138
WP_000018326.1|30651_31467_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_000902128.1|31620_31800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067856.1|31891_32596_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_000214119.1|34276_35491_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	4.2e-19
WP_001067784.1|36373_37078_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_000073658.1|37656_38484_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
38635:38655	attL	GTGCTTCAAAAAGTATGCTGC	NA	NA	NA	NA
WP_002002480.1|39454_40297_-	carbapenem-hydrolyzing class D beta-lactamase OXA-58	NA	NA	NA	NA	NA
WP_008942541.1|40882_42208_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_002054947.1|42379_42997_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_002058850.1|43344_44046_+	VIT family protein	NA	NA	NA	NA	NA
WP_008942541.1|44355_45681_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_169041047.1|45875_46178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169041048.1|46324_47029_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	84.9	1.6e-119
WP_004977490.1|47097_47286_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_169041049.1|47727_49032_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	61.1	8.0e-157
WP_169041050.1|49047_49626_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	58.4	3.6e-53
WP_169041051.1|49880_51428_+	N-6 DNA methylase	NA	A0A2H4PQP4	Staphylococcus_phage	27.7	7.7e-50
WP_169041052.1|51424_52603_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_074163987.1|52657_53686_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_171547565.1|53715_56958_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.3	1.9e-66
WP_169041060.1|57028_57238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169041054.1|57697_58870_-	replication initiation protein	NA	NA	NA	NA	NA
WP_001274705.1|59724_60498_+	AAA family ATPase	NA	Q8JL10	Natrialba_phage	33.3	4.4e-14
WP_151711071.1|60511_61423_+	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	35.4	2.4e-14
WP_169041055.1|62620_63649_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_169041056.1|64397_64847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169041057.1|64857_67371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169041058.1|67357_71173_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_167588477.1|71933_73589_+	HNH endonuclease	NA	NA	NA	NA	NA
71341:71361	attR	GTGCTTCAAAAAGTATGCTGC	NA	NA	NA	NA
WP_096911334.1|74032_75265_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_169041059.1|75763_76468_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
>prophage 2
NZ_CP051863	Acinetobacter baumannii strain Ab-C102 plasmid pAb-C102_1, complete sequence	90089	80436	88366	90089	integrase	uncultured_Caudovirales_phage(33.33%)	7	68616:68629	89157:89170
68616:68629	attL	GGTTCAATCCTTAT	NA	NA	NA	NA
WP_004826947.1|80436_81732_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	53.4	3.0e-132
WP_004826946.1|81746_82373_-	hypothetical protein	NA	A0A2H4J538	uncultured_Caudovirales_phage	42.8	1.8e-26
WP_002046584.1|82484_83126_-	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	53.3	3.4e-52
WP_000482094.1|83372_84479_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	26.5	1.4e-29
WP_001052588.1|84491_85202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001986287.1|86059_86773_+	hypothetical protein	NA	A0A0R6PHM5	Moraxella_phage	41.7	3.9e-41
WP_005144684.1|87166_88366_+|integrase	tyrosine-type recombinase/integrase	integrase	E5AGD0	Erwinia_phage	29.5	2.0e-37
89157:89170	attR	GGTTCAATCCTTAT	NA	NA	NA	NA
