The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051866	Acinetobacter baumannii strain Ab-C63 chromosome, complete genome	3873866	1003928	1024708	3873866	terminase,portal	Acinetobacter_phage(57.14%)	34	NA	NA
WP_169024954.1|1003928_1004588_-	hypothetical protein	NA	A0A2H4JDC0	uncultured_Caudovirales_phage	58.6	2.8e-78
WP_169024955.1|1004584_1005523_-	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	82.0	9.8e-141
WP_064192166.1|1005532_1005748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064192167.1|1005774_1006152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140968406.1|1006148_1006961_-	hypothetical protein	NA	E2GLY5	Acinetobacter_phage	47.4	7.6e-57
WP_169024956.1|1006953_1007220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169025100.1|1007206_1007407_-	hypothetical protein	NA	A0A1B1P9G9	Acinetobacter_phage	70.1	1.8e-15
WP_025467970.1|1007618_1008575_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	36.5	2.1e-53
WP_140975762.1|1008623_1008839_-	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	97.2	3.6e-30
WP_000370562.1|1008854_1009601_-	helix-turn-helix domain-containing protein	NA	A0A1B1P9J5	Acinetobacter_phage	79.7	3.3e-107
WP_001100148.1|1009706_1009895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166816.1|1009903_1010179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000047869.1|1010264_1010432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169024957.1|1010428_1011322_+	GntR family transcriptional regulator	NA	A0A068C8G6	Acinetobacter_phage	48.6	9.3e-48
WP_038405696.1|1011321_1012647_+	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	92.1	5.3e-233
WP_169024958.1|1012643_1012940_+	winged helix-turn-helix domain-containing protein	NA	A0A1B1P9H6	Acinetobacter_phage	96.9	2.3e-48
WP_169024959.1|1012936_1013113_+	hypothetical protein	NA	A0A1B1P9H7	Acinetobacter_phage	94.8	2.9e-22
WP_169024960.1|1013109_1013457_+	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	38.3	5.1e-10
WP_064191927.1|1013657_1014098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064191926.1|1014184_1014637_+	hypothetical protein	NA	A0A0P0HSP6	Acinetobacter_phage	94.7	2.2e-74
WP_064191925.1|1014636_1014909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169024961.1|1014921_1015383_+	hypothetical protein	NA	A0A2H4J353	uncultured_Caudovirales_phage	75.8	4.5e-62
WP_031975123.1|1015892_1016081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169024962.1|1016084_1016255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064191921.1|1016247_1016523_+	DUF968 domain-containing protein	NA	A0A0D4DC07	Acinetobacter_phage	78.0	3.3e-36
WP_064191920.1|1016667_1016892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064191919.1|1016961_1017450_+	recombination protein NinB	NA	A0A2H4JDI9	uncultured_Caudovirales_phage	49.7	8.7e-32
WP_096877406.1|1017457_1017919_+|terminase	terminase small subunit	terminase	A0A0D4DCN4	Acinetobacter_phage	89.6	1.2e-59
WP_086610877.1|1017896_1019348_+	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	60.8	3.5e-177
WP_096877407.1|1019347_1021588_+|portal	portal protein p19	portal	A0A0E3GMB1	Rhodoferax_phage	29.2	2.0e-75
WP_096877408.1|1021568_1022360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046023819.1|1022363_1023596_+	hypothetical protein	NA	C8CLI7	Xylella_phage	34.1	7.0e-54
WP_096877409.1|1023634_1024069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096877410.1|1024072_1024708_+	hypothetical protein	NA	I3PUX2	Vibrio_phage	27.9	4.3e-07
>prophage 2
NZ_CP051866	Acinetobacter baumannii strain Ab-C63 chromosome, complete genome	3873866	1151531	1166328	3873866		Acinetobacter_phage(100.0%)	10	NA	NA
WP_001187844.1|1151531_1152080_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
WP_140968427.1|1152342_1153842_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	97.2	1.5e-279
WP_169024965.1|1153843_1156219_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	98.1	0.0e+00
WP_140968429.1|1156225_1157209_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	97.2	3.1e-185
WP_000066126.1|1157219_1157915_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_000608308.1|1157924_1158731_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	99.6	1.8e-146
WP_001982145.1|1158740_1159790_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_140968430.1|1160145_1162878_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	98.2	0.0e+00
WP_103891433.1|1162887_1165656_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	98.4	0.0e+00
WP_000566784.1|1165752_1166328_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	3.2e-110
>prophage 3
NZ_CP051866	Acinetobacter baumannii strain Ab-C63 chromosome, complete genome	3873866	2521580	2534937	3873866	tail	Acinetobacter_phage(40.0%)	11	NA	NA
WP_169025020.1|2521580_2522126_-	hypothetical protein	NA	A0A0P0IW03	Acinetobacter_phage	95.5	1.5e-96
WP_001100986.1|2522187_2522367_-	hypothetical protein	NA	A0A0D4DCA7	Acinetobacter_phage	100.0	9.2e-24
WP_001021568.1|2522392_2522935_-	hypothetical protein	NA	A0A0D4DBW7	Acinetobacter_phage	100.0	5.7e-101
WP_000433923.1|2523046_2523436_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	99.2	4.3e-66
WP_169025021.1|2523500_2525990_-	hypothetical protein	NA	A0A1I9L2F3	Xanthomonas_phage	23.1	1.5e-07
WP_002126537.1|2525990_2526425_-	C40 family peptidase	NA	A0A0B5A615	Paracoccus_phage	33.3	5.9e-08
WP_005128472.1|2526479_2527133_-	metallophosphoesterase	NA	K7PJZ5	Enterobacterial_phage	43.8	1.6e-41
WP_169025022.1|2527129_2530192_-	CotH kinase family protein	NA	H7BUR7	unidentified_phage	33.8	4.7e-06
WP_049590659.1|2530255_2531113_-	DUF2163 domain-containing protein	NA	A0A2D1GNT2	Pseudomonas_phage	25.5	3.2e-13
WP_057048910.1|2531109_2531895_-	DUF2460 domain-containing protein	NA	NA	NA	NA	NA
WP_169025023.1|2531904_2534937_-|tail	phage tail protein	tail	A0A1Q1PW43	Pseudoalteromonas_phage	45.8	2.6e-41
>prophage 4
NZ_CP051866	Acinetobacter baumannii strain Ab-C63 chromosome, complete genome	3873866	2538749	2547884	3873866	capsid,terminase	Acinetobacter_phage(40.0%)	11	NA	NA
WP_002126831.1|2538749_2539730_-	DUF2184 domain-containing protein	NA	H9C0E5	Vibrio_phage	22.2	1.1e-06
WP_004888040.1|2539733_2540204_-	hypothetical protein	NA	M4T3R5	Psychrobacter_phage	42.5	4.0e-18
WP_032015054.1|2540222_2541422_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	34.3	1.1e-24
WP_004888043.1|2541482_2542097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004888044.1|2542154_2542964_-|capsid	minor capsid protein	capsid	M4T3R2	Psychrobacter_phage	41.0	6.2e-51
WP_004888046.1|2542908_2544243_-	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	38.9	4.4e-86
WP_004888048.1|2544251_2545778_-|terminase	phage terminase large subunit	terminase	E5AGA3	Erwinia_phage	40.1	3.6e-92
WP_000729394.1|2545755_2546232_-	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	53.6	4.5e-33
WP_002056383.1|2546290_2546932_-	hypothetical protein	NA	A0A0P0I8J9	Acinetobacter_phage	87.8	7.7e-113
WP_032014249.1|2546900_2547368_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	84.1	3.3e-65
WP_169025025.1|2547428_2547884_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	93.4	2.2e-77
>prophage 5
NZ_CP051866	Acinetobacter baumannii strain Ab-C63 chromosome, complete genome	3873866	2551671	2568839	3873866		Acinetobacter_phage(69.57%)	30	NA	NA
WP_000783468.1|2551671_2552160_-	hypothetical protein	NA	A0A0P0I4C3	Acinetobacter_phage	68.7	6.4e-59
WP_002056372.1|2552156_2552552_-	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.9	1.5e-66
WP_169025026.1|2552551_2552767_-	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	42.3	9.4e-07
WP_000778995.1|2552759_2553161_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	48.4	1.7e-25
WP_000017854.1|2553157_2553565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169025027.1|2553561_2554311_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	97.2	3.8e-135
WP_169025028.1|2554303_2555230_-	DUF1376 domain-containing protein	NA	A0A0P0I481	Acinetobacter_phage	96.8	5.1e-166
WP_001267985.1|2555222_2555585_-	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	99.1	2.4e-55
WP_002059544.1|2555581_2555878_-	hypothetical protein	NA	J7HXM0	Acinetobacter_phage	99.0	1.4e-48
WP_001180657.1|2555874_2556147_-	hypothetical protein	NA	A0A0P0J0B9	Acinetobacter_phage	97.8	1.5e-41
WP_001289843.1|2556196_2556697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000210973.1|2556751_2557000_-	helix-turn-helix domain-containing protein	NA	A0A0R6PH31	Moraxella_phage	58.6	8.0e-18
WP_000187985.1|2557002_2557794_+	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	52.1	1.4e-10
WP_001101440.1|2558021_2558462_+	hypothetical protein	NA	A0A0D4DBH9	Acinetobacter_phage	100.0	2.3e-76
WP_038344486.1|2558461_2558752_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	97.9	3.5e-49
WP_031974081.1|2558744_2559068_+	hypothetical protein	NA	A0A0P0IRC4	Acinetobacter_phage	98.1	5.7e-56
WP_000206152.1|2559079_2559847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169025029.1|2559861_2561070_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	50.5	1.2e-93
WP_000654847.1|2561071_2561317_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.5e-40
WP_169025030.1|2561320_2561731_+	hypothetical protein	NA	A0A0P0I8H3	Acinetobacter_phage	100.0	7.6e-13
WP_000048743.1|2561723_2562008_+	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	94.7	2.2e-43
WP_000015928.1|2562011_2562269_+	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	90.5	2.2e-42
WP_000362184.1|2562270_2562486_+	hypothetical protein	NA	A0A0R6PG25	Moraxella_phage	55.9	3.7e-11
WP_001185176.1|2562695_2563976_+	aspartate kinase	NA	NA	NA	NA	NA
WP_000906487.1|2564222_2564477_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
WP_000495832.1|2564547_2565114_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	3.1e-25
WP_000735757.1|2565179_2565569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064192240.1|2565809_2566367_+	cytochrome b	NA	NA	NA	NA	NA
WP_001077401.1|2566409_2567408_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000729980.1|2567519_2568839_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	7.8e-59
>prophage 6
NZ_CP051866	Acinetobacter baumannii strain Ab-C63 chromosome, complete genome	3873866	2694454	2786496	3873866	capsid,integrase,portal,head,protease,holin,terminase,tail	Acinetobacter_phage(59.52%)	130	2732257:2732316	2786994:2787056
WP_169025033.1|2694454_2695819_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PGY7	Moraxella_phage	42.9	1.0e-85
WP_003115393.1|2695802_2695997_-	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	54.1	3.6e-13
WP_169025034.1|2696232_2696601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169025035.1|2696600_2697110_-	glycoside hydrolase family protein	NA	A0A0B5L5F7	Acinetobacter_phage	58.6	2.6e-47
WP_000774828.1|2697093_2697360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057047096.1|2697424_2697604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169025036.1|2697603_2702583_-|tail	phage tail protein	tail	A0A0R6PIC9	Moraxella_phage	60.3	1.1e-310
WP_169025037.1|2702638_2703295_-|tail	tail assembly protein	tail	G3ENB6	Psychrobacter_phage	44.2	6.4e-38
WP_169025038.1|2703278_2704070_-	Mov34/MPN/PAD-1 family protein	NA	A0A0R6PIM4	Moraxella_phage	51.9	5.3e-79
WP_169025039.1|2704076_2704871_-|tail	phage minor tail protein L	tail	A0A0R6PIG8	Moraxella_phage	63.4	1.3e-88
WP_169025040.1|2704857_2706018_-	hypothetical protein	NA	U5PW98	Acinetobacter_phage	59.4	5.1e-38
WP_049594708.1|2706071_2706413_-|tail	phage tail protein	tail	A0A0R6PHH7	Moraxella_phage	44.6	2.6e-14
WP_169025122.1|2706405_2706720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169025041.1|2706807_2710482_-	transglycosylase SLT domain-containing protein	NA	A0A0U4JEA4	Pseudomonas_phage	40.4	6.1e-45
WP_001031956.1|2710547_2710877_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	43.1	2.9e-15
WP_002021720.1|2710953_2711169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024437292.1|2711204_2711720_-|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_169025042.1|2711719_2712193_-	structural protein 3 family protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	60.5	1.7e-53
WP_000568017.1|2712269_2712641_-	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	47.1	1.2e-20
WP_169025043.1|2712640_2713126_-	HK97 gp10 family phage protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	44.0	1.4e-26
WP_169025044.1|2713129_2713486_-|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	50.9	9.5e-20
WP_000631203.1|2713487_2713775_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	47.5	1.1e-18
WP_000666091.1|2713771_2713948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169025045.1|2713995_2715168_-|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	52.8	1.7e-102
WP_000375469.1|2715160_2715823_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	62.3	6.2e-73
WP_094327773.1|2715815_2717042_-|portal	phage portal protein	portal	A0A2H4J6S3	uncultured_Caudovirales_phage	75.6	8.8e-182
WP_169025046.1|2717038_2718739_-|terminase	terminase large subunit	terminase	A0A2H4J559	uncultured_Caudovirales_phage	62.5	7.1e-198
WP_169025047.1|2718926_2719409_-|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	47.8	1.3e-24
WP_041172109.1|2719578_2719761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079769541.1|2719757_2720057_-	HNH endonuclease	NA	A0A0R6PH58	Moraxella_phage	61.2	6.5e-22
WP_169025048.1|2719986_2720277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169025049.1|2720254_2720518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063944.1|2720510_2720693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169025050.1|2720682_2721213_-	hypothetical protein	NA	A0A2H4JB76	uncultured_Caudovirales_phage	43.4	1.7e-36
WP_169025051.1|2721228_2721627_-	hypothetical protein	NA	T1S9H7	Salmonella_phage	38.7	7.3e-13
WP_169025052.1|2721709_2722138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380484.1|2722462_2722633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169025053.1|2722650_2722863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169025054.1|2722984_2723287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060708.1|2723381_2723879_-	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	34.2	1.4e-16
WP_001003589.1|2723878_2724049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169025055.1|2724045_2724498_-	hypothetical protein	NA	A0A068CBJ8	Acinetobacter_phage	45.7	2.4e-07
WP_169025056.1|2724568_2724952_-	hypothetical protein	NA	I2GUD2	Acinetobacter_phage	88.7	2.4e-21
WP_169025057.1|2725039_2725324_-	hypothetical protein	NA	A0A0A0RTI7	Acinetobacter_phage	51.2	2.3e-21
WP_169025058.1|2725320_2725599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171527659.1|2725595_2726927_-	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	55.7	1.8e-127
WP_057045419.1|2726926_2727811_-	DUF1376 domain-containing protein	NA	A0A2I7RGZ2	Vibrio_phage	62.4	1.7e-30
WP_169025060.1|2727810_2728107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031971960.1|2728165_2728351_-	hypothetical protein	NA	A0A2H4JCB6	uncultured_Caudovirales_phage	50.9	6.6e-09
WP_031971961.1|2728479_2729172_+	LexA family transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	48.5	5.7e-53
WP_169025061.1|2729421_2730153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169025062.1|2730155_2730572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033502952.1|2730794_2731058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169025099.1|2731351_2731549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169025063.1|2731545_2731758_+	hypothetical protein	NA	I2GUB6	Acinetobacter_phage	95.7	2.6e-33
WP_169025064.1|2731760_2732039_+	DNA-binding protein	NA	NA	NA	NA	NA
2732257:2732316	attL	TGAACTTTAGGGTTCAAGGGTAACGACATGCAGCGGCATCTTCGGAGCATTTATTTTTAA	NA	NA	NA	NA
WP_064192235.1|2732458_2733844_+|integrase	integrase family protein	integrase	A0A0R6PGY7	Moraxella_phage	40.8	9.6e-76
WP_103891262.1|2734147_2734948_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_064191998.1|2735027_2735672_+	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	47.9	3.0e-56
WP_064191997.1|2735787_2736285_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	59.6	4.5e-44
WP_070171025.1|2736281_2737577_+	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	62.6	4.1e-161
WP_103891263.1|2737639_2738884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064194226.1|2739203_2739749_-	N-acetylmuramidase	NA	A0A0B5L5G0	Acinetobacter_phage	95.5	1.9e-96
WP_000200152.1|2739806_2740031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999698.1|2740011_2740305_-|holin	holin	holin	NA	NA	NA	NA
WP_002051631.1|2740391_2741231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064192290.1|2741223_2741583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064192289.1|2745602_2746268_-|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	47.7	5.1e-43
WP_064192288.1|2746251_2747043_-	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	53.0	3.1e-79
WP_064192287.1|2747049_2747856_-|tail	phage minor tail protein L	tail	A0A0R6PGU8	Moraxella_phage	63.8	1.7e-93
WP_064192286.1|2747842_2748706_-	hypothetical protein	NA	G3ENB2	Psychrobacter_phage	42.4	4.8e-49
WP_049068714.1|2748758_2749103_-|tail	phage tail protein	tail	A0A0R6PHH7	Moraxella_phage	41.3	1.1e-12
WP_057048951.1|2749516_2749792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049594680.1|2750042_2750303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064192282.1|2750313_2754426_-	tape measure protein	NA	A0A220VZA0	Acinetobacter_phage	51.5	2.6e-262
WP_004736741.1|2754484_2755426_-	hypothetical protein	NA	A0A0N7IRE6	Acinetobacter_phage	85.6	5.0e-153
WP_064192760.1|2755457_2755781_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_140968340.1|2755789_2755966_-	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	59.6	6.3e-09
WP_064194277.1|2756021_2756384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103891264.1|2756501_2757134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016804099.1|2757151_2757478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016804100.1|2757495_2758206_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_064192281.1|2758524_2758758_-	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	85.3	4.6e-31
WP_064192280.1|2758760_2759285_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	61.2	1.3e-46
WP_023060482.1|2759332_2760262_-	hypothetical protein	NA	A0A1B1P9E0	Acinetobacter_phage	97.1	1.2e-167
WP_064192279.1|2760367_2760580_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	84.1	8.4e-24
WP_064192278.1|2760581_2760980_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	80.3	4.2e-61
WP_064192277.1|2760981_2761350_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	80.3	1.1e-52
WP_064192276.1|2761315_2761729_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	93.3	1.7e-65
WP_169025065.1|2761740_2761911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103891265.1|2761950_2762619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064192275.1|2762656_2763025_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	94.3	2.1e-62
WP_064192274.1|2763026_2763416_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	97.7	2.1e-65
WP_064192273.1|2763420_2764086_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	89.1	1.5e-103
WP_064192272.1|2764154_2765102_-	Ig domain-containing protein	NA	A0A0D4DBM4	Acinetobacter_phage	93.9	8.0e-167
WP_000770052.1|2765129_2765897_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	99.6	1.7e-119
WP_064192271.1|2766014_2766326_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	47.5	5.7e-13
WP_064192270.1|2766477_2767581_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	95.1	1.2e-198
WP_064194276.1|2767582_2769034_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	90.7	3.6e-259
WP_016684846.1|2769030_2770458_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	88.8	1.1e-252
WP_064192269.1|2770447_2770918_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	98.1	7.4e-81
WP_000435247.1|2770976_2771618_-	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	98.1	1.5e-124
WP_001003044.1|2771586_2772021_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	86.8	6.0e-69
WP_001136781.1|2772072_2772534_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	88.7	9.2e-76
WP_057048929.1|2773230_2773467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103891266.1|2773684_2774029_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	37.5	1.7e-10
WP_070165889.1|2774303_2774522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070165891.1|2774593_2774833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070114949.1|2775065_2775545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992312.1|2775689_2776115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000097327.1|2776117_2776525_-	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	51.8	5.2e-22
WP_103891267.1|2776521_2776635_-	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	78.4	1.7e-07
WP_000993072.1|2776631_2777402_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	97.2	4.6e-144
WP_169025066.1|2777398_2778286_-	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	92.9	2.1e-148
WP_064192247.1|2778344_2778530_-	hypothetical protein	NA	J7I4N3	Acinetobacter_phage	96.6	1.8e-22
WP_000094161.1|2778526_2778823_-	hypothetical protein	NA	J7HXM0	Acinetobacter_phage	92.9	5.4e-45
WP_002156401.1|2778819_2779092_-	hypothetical protein	NA	A0A0D4DCC3	Acinetobacter_phage	87.8	1.4e-34
WP_000041059.1|2779279_2779636_-	transcriptional regulator	NA	J7I452	Acinetobacter_phage	95.8	8.2e-56
WP_000165919.1|2779645_2779831_-	hypothetical protein	NA	J7HXD2	Acinetobacter_phage	98.4	1.4e-27
WP_000792749.1|2779908_2780673_+	LexA family transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	98.4	3.6e-141
WP_064192761.1|2780687_2780903_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	95.7	3.0e-29
WP_000182538.1|2781536_2782091_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000092985.1|2782077_2782398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064192245.1|2782596_2783037_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	96.6	4.1e-73
WP_064192244.1|2783039_2783363_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	81.3	1.0e-44
WP_000206153.1|2783374_2784142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064192243.1|2784156_2785116_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	93.1	3.4e-165
WP_000654848.1|2785117_2785369_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.7	1.1e-38
WP_000147323.1|2785369_2785777_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
WP_064192242.1|2785773_2786496_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	87.3	1.4e-54
2786994:2787056	attR	TGAACTTTAGGGTTCAAGGGTAACGACATGCAGCGGCATCTTCGGAGCATTTATTTTTAAATA	NA	NA	NA	NA
>prophage 1
NZ_CP051867	Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_1, complete sequence	81353	2424	67516	81353	protease,transposase,integrase	Escherichia_phage(18.18%)	56	55113:55128	71448:71463
WP_169025134.1|2424_6240_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_169025135.1|6371_7530_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.1	1.1e-48
WP_004778435.1|7851_9084_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000506885.1|9356_9686_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_169025136.1|9893_10760_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_169025137.1|10770_11382_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_169025138.1|11398_11974_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_169025139.1|12015_15696_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_169025140.1|15742_19270_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	A0A2R2ZGH5	Clostridioides_phage	21.8	3.1e-06
WP_169025141.1|19272_21213_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_169025142.1|21209_23834_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_087537462.1|23863_25903_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_125318495.1|26022_26439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020753579.1|26416_27145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020753578.1|27141_28083_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_020753577.1|28079_28595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020753576.1|28602_29568_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000678311.1|31171_31738_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	50.0	4.1e-25
WP_004856455.1|31980_33168_-	tetracycline efflux MFS transporter Tet(39)	NA	NA	NA	NA	NA
WP_004787586.1|33233_33875_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000286964.1|34029_34332_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	49.0	9.5e-21
WP_000985609.1|34332_34614_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.3	5.7e-12
WP_001180106.1|34693_35113_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_000897307.1|35252_35573_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000369781.1|35565_35838_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000052512.1|36330_37806_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|37861_38746_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_015060246.1|38935_39547_-	recombinase family protein	NA	NA	NA	NA	NA
WP_019838421.1|40072_41431_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	70.2	6.4e-32
WP_026438269.1|41433_42354_-	chromate resistance protein	NA	NA	NA	NA	NA
WP_039048355.1|42487_42958_+	DUF1643 domain-containing protein	NA	A0A0U1W068	Pseudomonas_phage	42.9	1.1e-28
WP_001067856.1|43417_44122_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_000902128.1|44213_44393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018326.1|44546_45362_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_000381802.1|45412_45946_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_001067856.1|46082_46787_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_063862810.1|46886_47729_-	OXA-58 family carbapenem-hydrolyzing class D beta-lactamase OXA-420	NA	NA	NA	NA	NA
WP_001067856.1|47825_48530_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_001082319.1|49958_50762_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|50761_51598_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_006581702.1|52998_53247_+	phenol hydrolase assembly protein	NA	NA	NA	NA	NA
WP_170628443.1|53410_53770_+	phenol hydroxylase	NA	NA	NA	NA	NA
WP_085940648.1|53966_55057_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
55113:55128	attL	TTTGTCGTGTACAGAG	NA	NA	NA	NA
WP_001043260.1|55146_55962_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_169025153.1|56212_56659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032491181.1|56662_57172_-	trimethoprim-resistant dihydrofolate reductase DfrA20	NA	U5J9P6	Bacillus_phage	43.7	7.9e-28
WP_169025143.1|57199_57580_-	hypothetical protein	NA	A0A1B4XWX5	Tenacibaculum_phage	56.9	2.0e-15
WP_001067784.1|58504_59209_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_100243282.1|59364_59583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004826947.1|59586_60882_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	53.4	3.0e-132
WP_004826946.1|60896_61523_-	hypothetical protein	NA	A0A2H4J538	uncultured_Caudovirales_phage	42.8	1.8e-26
WP_002046584.1|61634_62276_-	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	53.3	3.4e-52
WP_000482094.1|62522_63629_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	26.5	1.4e-29
WP_001052588.1|63641_64352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001986287.1|65209_65923_+	hypothetical protein	NA	A0A0R6PHM5	Moraxella_phage	41.7	3.9e-41
WP_169025144.1|66316_67516_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	28.8	2.8e-39
71448:71463	attR	TTTGTCGTGTACAGAG	NA	NA	NA	NA
