The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051738	Escherichia coli strain SCU-105 chromosome, complete genome	5166012	569157	622470	5166012	capsid,plate,tail,transposase,protease,tRNA,integrase	Burkholderia_virus(37.21%)	66	574242:574257	630208:630223
WP_001107467.1|569157_571092_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|571181_572030_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_000071137.1|572022_573360_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001295556.1|573587_573920_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
574242:574257	attL	CTTCTCGATAAACCAT	NA	NA	NA	NA
WP_000459036.1|576303_576948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001610543.1|577042_577279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109547887.1|577296_577683_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.2	3.0e-27
WP_071045905.1|577654_578107_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	9.5e-25
WP_000123380.1|578096_578312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016238301.1|578301_578532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169063097.1|578528_579212_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.5	3.8e-33
WP_000763553.1|579208_579424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299260.1|579438_579735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109547884.1|579744_580017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|580305_580836_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000843445.1|580863_581133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960680.1|581135_582302_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	9.7e-122
WP_021518096.1|582312_584106_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	52.8	9.2e-172
WP_021518097.1|584102_584456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021518098.1|584448_585381_-	hypothetical protein	NA	J9RW58	Pseudomonas_phage	47.2	3.8e-60
WP_021518099.1|585390_585696_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	57.0	3.0e-22
WP_021518100.1|585745_585934_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	1.8e-17
WP_021518101.1|586015_586369_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_021518102.1|586485_587250_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_021518103.1|587432_587657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021518104.1|587710_588454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793145.1|588584_588935_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.9	9.0e-23
WP_001104438.1|588937_589675_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.5	2.9e-63
WP_001756572.1|589661_590315_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	31.9	3.3e-10
WP_000175097.1|590311_590638_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227704.1|590637_590949_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	4.0e-30
WP_000533684.1|590951_591494_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	53.3	4.9e-44
WP_001576695.1|591490_593014_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.7	6.2e-185
WP_169063098.1|593013_594510_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.8	1.2e-167
WP_000117556.1|594490_595312_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.5	3.1e-98
WP_169063099.1|595314_595773_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.2e-30
WP_001273074.1|595987_597103_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286908.1|597117_598071_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_000537457.1|598080_598419_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|598420_598867_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|598866_599331_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_012602372.1|599327_599582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|599571_600999_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_162832341.1|600995_601520_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_001513983.1|601522_601804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513982.1|601901_602237_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|602160_602319_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_169063100.1|602394_605607_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.2	5.5e-82
WP_000458386.1|605606_606491_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_010989167.1|606487_606703_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
WP_001756576.1|606690_607845_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_169063101.1|607841_608438_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	44.7	3.5e-35
WP_000859111.1|608492_608840_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001219102.1|608830_609934_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	55.2	8.3e-107
WP_000138756.1|609926_610505_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_169063102.1|610507_611974_+|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	40.7	1.0e-22
WP_001106831.1|611995_612436_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	9.5e-54
WP_169063103.1|612407_613001_-|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	63.0	1.3e-58
WP_169063262.1|613000_613465_-|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	92.2	3.4e-78
WP_000904922.1|613524_614097_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_000207680.1|614327_615671_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|616301_616754_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031055.1|616781_618269_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|618293_620966_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001040205.1|621124_621526_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000089698.1|621525_622470_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
630208:630223	attR	CTTCTCGATAAACCAT	NA	NA	NA	NA
>prophage 2
NZ_CP051738	Escherichia coli strain SCU-105 chromosome, complete genome	5166012	978601	996977	5166012	integrase	Salmonella_phage(27.27%)	19	971493:971507	1006330:1006344
971493:971507	attL	GGAGGCTTTAGCATT	NA	NA	NA	NA
WP_001587386.1|978601_979354_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
WP_001580988.1|979670_980885_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.1	1.6e-138
WP_001580987.1|981013_981811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001580986.1|982038_982236_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000776707.1|982311_983136_+	antA/AntB antirepressor family protein	NA	A0A0A7RVQ9	Clostridium_phage	43.3	8.3e-19
WP_021543050.1|983128_983686_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	61.6	1.1e-51
WP_024188802.1|983854_984052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000094456.1|984109_984307_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	43.1	9.5e-06
WP_111961088.1|984380_984716_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001336359.1|984708_984966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021543048.1|984968_985271_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001580979.1|985267_987394_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	53.5	2.4e-174
WP_000126713.1|987604_988030_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_021543045.1|988066_988564_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	46.3	9.2e-13
WP_001580975.1|988544_988961_+	hypothetical protein	NA	A0A077SLR9	Escherichia_phage	71.0	1.2e-21
WP_000995640.1|989326_989533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169063115.1|989629_992161_+	hypothetical protein	NA	Q858G0	Salmonella_phage	78.8	0.0e+00
WP_021543042.1|992160_994221_+	hypothetical protein	NA	Q858F9	Salmonella_phage	59.9	3.6e-204
WP_169063116.1|994220_996977_+	hypothetical protein	NA	Q858F8	Salmonella_phage	88.9	0.0e+00
1006330:1006344	attR	GGAGGCTTTAGCATT	NA	NA	NA	NA
>prophage 3
NZ_CP051738	Escherichia coli strain SCU-105 chromosome, complete genome	5166012	1800085	1905043	5166012	capsid,tail,head,holin,tRNA,portal,terminase	Enterobacteria_phage(46.38%)	109	NA	NA
WP_000569372.1|1800085_1801012_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.3	1.1e-22
WP_000783145.1|1801016_1801748_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1801728_1801836_-	protein YohO	NA	NA	NA	NA	NA
WP_032300430.1|1801895_1802597_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.9	8.8e-102
WP_000063640.1|1802617_1803904_-	DUF3596 domain-containing protein	NA	H6WZF6	Escherichia_phage	99.8	1.3e-252
WP_001193437.1|1803937_1804192_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_001030157.1|1804210_1804345_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.5	1.9e-21
WP_000457723.1|1804348_1804591_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_000628767.1|1804675_1805620_-	hypothetical protein	NA	A0A0H4IU61	Shigella_phage	58.6	2.6e-80
WP_001289973.1|1806133_1806619_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.1e-42
WP_104858319.1|1806615_1807302_-	ead/Ea22-like family protein	NA	A5VWB1	Enterobacteria_phage	68.2	2.3e-38
WP_001378249.1|1807288_1807603_-	hypothetical protein	NA	B1GS43	Salmonella_phage	84.9	6.1e-39
WP_000179800.1|1807556_1807874_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	82.6	5.2e-38
WP_001199104.1|1808122_1808704_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	65.1	1.9e-70
WP_032202504.1|1808709_1808898_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	3.0e-09
WP_000141093.1|1809092_1809299_-	hypothetical protein	NA	Q8W651	Enterobacteria_phage	94.1	1.3e-29
WP_094171724.1|1809589_1810135_-	helix-turn-helix transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	71.9	7.9e-42
WP_000800136.1|1810280_1810970_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.2	6.1e-116
WP_001695592.1|1811103_1811376_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	90.9	1.6e-35
WP_000867914.1|1811446_1811740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001440724.1|1811859_1812567_+	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	98.7	2.7e-127
WP_032186471.1|1812675_1813527_+	Rha family transcriptional regulator	NA	A0A1C9IHV9	Salmonella_phage	66.2	1.1e-93
WP_032186470.1|1813523_1813718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000618007.1|1813714_1813939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032186469.1|1813935_1814235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000092416.1|1814231_1815224_+	hypothetical protein	NA	Q8W642	Enterobacteria_phage	96.4	4.6e-56
WP_000988266.1|1815234_1816134_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	2.3e-139
WP_169063144.1|1816130_1817531_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.2	4.9e-245
WP_001065351.1|1817527_1817785_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	70.1	1.6e-21
WP_089633252.1|1817837_1818827_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.9	4.9e-191
WP_001204795.1|1818844_1819237_+	antitermination protein Q	NA	Q8W638	Enterobacteria_phage	57.6	2.7e-36
WP_032283388.1|1819303_1819921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917767.1|1820154_1820352_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000024332.1|1820503_1821553_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	91.4	4.1e-188
WP_096956190.1|1822338_1824192_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	91.6	0.0e+00
WP_000372595.1|1824341_1824557_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000731196.1|1824561_1825368_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	99.6	4.8e-152
WP_000551290.1|1825377_1825692_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	100.0	4.7e-55
WP_001092910.1|1825820_1826354_+	lysozyme	NA	Q08J98	Stx2-converting_phage	96.6	1.1e-101
WP_001151823.1|1826510_1826693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280932.1|1826707_1826839_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_071587457.1|1827061_1827247_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	9.9e-21
WP_000347013.1|1827659_1827800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|1827932_1828118_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_001102145.1|1828505_1829054_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.7	6.1e-58
WP_012601968.1|1828983_1830954_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.7	9.6e-263
WP_000259002.1|1830937_1831144_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_005104612.1|1831140_1832733_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.8e-185
WP_079407350.1|1832722_1834228_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.8	3.9e-99
WP_000256824.1|1834264_1834612_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	6.8e-23
WP_000522589.1|1834669_1835698_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	7.3e-113
WP_000201501.1|1835749_1836133_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204556.1|1836125_1836479_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
WP_000975005.1|1836493_1837069_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	1.6e-48
WP_000683079.1|1837065_1837461_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235111.1|1837468_1838221_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	2.7e-133
WP_000479111.1|1838234_1838666_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
WP_000533402.1|1838692_1839106_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_115202137.1|1839086_1841648_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.4	0.0e+00
WP_000847298.1|1841644_1841974_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001328631.1|1841973_1842672_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	3.2e-128
WP_001407207.1|1842682_1843426_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	1.6e-146
WP_032300536.1|1843371_1844004_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_169063145.1|1844347_1847737_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	87.0	0.0e+00
WP_169063146.1|1847804_1848404_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	3.4e-102
WP_169063147.1|1848468_1850844_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_033871082.1|1850843_1851125_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	1.2e-17
WP_169063148.1|1851134_1852175_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.0	4.2e-124
WP_104858460.1|1852217_1852505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104858310.1|1852622_1852871_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	7.0e-38
WP_001544722.1|1853385_1855071_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.3	2.1e-303
WP_001308766.1|1855067_1855787_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1855833_1856304_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1856345_1856807_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001309586.1|1856931_1858932_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001292789.1|1858928_1860065_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.3e-163
WP_169063149.1|1860057_1862337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033871191.1|1862347_1863436_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000116029.1|1864619_1864925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169063150.1|1864985_1868618_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000860763.1|1868627_1872389_-	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001215561.1|1872401_1876199_-	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001306372.1|1876339_1878373_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.3e-54
WP_001005448.1|1878504_1879614_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001046488.1|1879876_1880158_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|1880452_1880995_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677328.1|1881075_1881750_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945425.1|1881765_1884246_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000702202.1|1884261_1885296_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153073.1|1885377_1885716_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134572.1|1885934_1886759_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1886879_1887152_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195596.1|1887374_1888163_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822280.1|1888159_1888960_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001306379.1|1889024_1889843_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.9	1.7e-24
WP_044697680.1|1889894_1890641_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011941.1|1890614_1891580_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846212.1|1891576_1892581_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	1.5e-14
WP_000858471.1|1892577_1893855_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1894111_1895164_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000853852.1|1896274_1897537_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182900.1|1897546_1897999_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823282.1|1898029_1898314_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490661.1|1898317_1899673_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000844212.1|1899720_1900761_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|1900860_1901640_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807371.1|1901721_1902621_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
WP_001303579.1|1903035_1903353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476039.1|1903681_1905043_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	2.5e-217
>prophage 4
NZ_CP051738	Escherichia coli strain SCU-105 chromosome, complete genome	5166012	2039359	2096783	5166012	capsid,lysis,tail,transposase,head,holin,integrase,portal,terminase	Enterobacteria_phage(40.38%)	70	2035956:2035970	2065748:2065762
2035956:2035970	attL	ATGATATTCACCACG	NA	NA	NA	NA
WP_016245382.1|2039359_2040385_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_000096344.1|2040384_2040588_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_139496770.1|2040646_2043088_-	3'-5' exoribonuclease	NA	V5UQJ3	Shigella_phage	46.8	9.2e-114
WP_001070255.1|2043181_2043373_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854564.1|2043369_2043558_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001299931.1|2043958_2044123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|2044126_2044345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000362155.1|2044926_2045346_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391949.1|2045446_2045728_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_169063155.1|2045711_2046137_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262379.1|2046208_2047273_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	7.9e-62
WP_001151225.1|2047313_2047736_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	3.3e-64
WP_000403785.1|2047793_2048150_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001224662.1|2048243_2048426_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000753059.1|2048418_2048595_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	9.7e-26
WP_000813254.1|2049516_2049672_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001429486.1|2050130_2050409_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	4.3e-12
WP_001265034.1|2050410_2051460_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	2.9e-109
WP_000904092.1|2051472_2051829_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	1.8e-34
WP_000762890.1|2051843_2052665_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	6.1e-78
WP_033871093.1|2053557_2053704_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	4.1e-06
WP_000871291.1|2053969_2054305_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874243.1|2054565_2054754_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001327246.1|2054750_2054912_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	2.0e-14
WP_000372595.1|2055061_2055277_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193293.1|2055281_2055626_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000370546.1|2055591_2055864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992105.1|2055969_2056503_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
WP_001327248.1|2056499_2056967_+|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	89.7	5.0e-69
WP_001139682.1|2056954_2057107_+	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
WP_001059340.1|2057309_2057834_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	93.6	2.9e-86
WP_001537735.1|2058136_2058547_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	77.8	2.7e-55
WP_000105081.1|2058604_2058838_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	4.3e-21
WP_000453587.1|2059226_2059772_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_021515552.1|2059746_2061672_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|2061668_2061875_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_169063156.1|2061871_2063473_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	8.5e-310
WP_169063157.1|2063453_2064773_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	5.8e-232
WP_001295978.1|2064782_2065115_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_033871090.1|2065169_2066195_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	1.7e-186
2065748:2065762	attR	CGTGGTGAATATCAT	NA	NA	NA	NA
WP_000158899.1|2066236_2066632_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_000753019.1|2066643_2066997_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_033871089.1|2067009_2067588_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	7.8e-80
WP_000683105.1|2067584_2067980_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_033871102.1|2067987_2068728_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	4.7e-130
WP_000479152.1|2068743_2069166_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	2.5e-72
WP_096860564.1|2069147_2069582_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.0e-63
WP_096860563.1|2069574_2072136_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_049068102.1|2072132_2072462_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	9.3e-54
WP_169063158.1|2072461_2073160_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.0	2.2e-129
WP_096860561.1|2073165_2073909_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	3.3e-147
WP_072007052.1|2073845_2074478_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.6	5.5e-95
WP_169063159.1|2074538_2077934_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.7	0.0e+00
WP_033871084.1|2078001_2078601_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	7.5e-102
WP_169063147.1|2078665_2081041_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_033871082.1|2081040_2081322_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	1.2e-17
WP_089541817.1|2081887_2083116_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000355601.1|2083750_2084044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000488336.1|2084299_2085190_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|2085208_2085715_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2085751_2086252_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2086330_2086513_-	general stress protein	NA	NA	NA	NA	NA
WP_001544647.1|2088041_2088692_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001544646.1|2088948_2089584_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740078.1|2089584_2090589_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920132.1|2090697_2091111_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001339045.1|2091243_2091915_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826807.1|2091914_2093273_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_169063160.1|2093379_2094231_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_162886171.1|2095569_2096783_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	6.0e-167
>prophage 5
NZ_CP051738	Escherichia coli strain SCU-105 chromosome, complete genome	5166012	2140730	2176871	5166012	capsid,plate,tail,head,holin,integrase,portal,terminase	Enterobacteria_phage(89.47%)	46	2139668:2139727	2176978:2177098
2139668:2139727	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_000078920.1|2140730_2140871_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|2141061_2141322_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_097365112.1|2141611_2142751_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_000132847.1|2143150_2144251_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.1e-203
WP_000005439.1|2144408_2145593_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
WP_000290450.1|2145592_2146105_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|2146159_2146525_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000333495.1|2146533_2146689_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000853454.1|2146675_2149483_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.7	0.0e+00
WP_000979948.1|2149495_2149984_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	2.6e-84
WP_000954196.1|2150140_2150713_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144010.1|2150756_2151335_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
WP_032276832.1|2151334_2153467_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	2.7e-130
WP_000071738.1|2153469_2154000_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_032281061.1|2153992_2154889_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	5.7e-154
WP_000213447.1|2154892_2155243_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271909.1|2155239_2155821_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
WP_000356339.1|2155817_2156453_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001342220.1|2156445_2156913_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_112933288.1|2156936_2158814_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	83.7	0.0e+00
WP_000780555.1|2158952_2159360_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000072343.1|2159356_2159749_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
WP_001342221.1|2159745_2160069_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864911.1|2160071_2160272_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
WP_000063100.1|2160271_2160766_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632311.1|2160867_2161668_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
WP_024219921.1|2161713_2162766_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.6	4.9e-189
WP_001262655.1|2162789_2163626_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_032280322.1|2163780_2165532_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_000087812.1|2165531_2166578_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001594304.1|2167063_2167333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211267.1|2167697_2168009_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_000708312.1|2168013_2168973_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.5e-176
WP_032280321.1|2169049_2171890_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.5	0.0e+00
WP_097365110.1|2171886_2172276_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_000985152.1|2172599_2172803_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000021647.1|2172889_2173003_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	2.4e-09
WP_000357025.1|2172999_2173242_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000158976.1|2173253_2173532_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
WP_000742491.1|2173542_2173893_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
WP_000014504.1|2173914_2174118_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2174189_2174327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|2174416_2174821_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290352.1|2174836_2175487_+	membrane protein	NA	NA	NA	NA	NA
WP_000865208.1|2175516_2175864_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001342226.1|2175869_2176871_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
2176978:2177098	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP051738	Escherichia coli strain SCU-105 chromosome, complete genome	5166012	3010048	3055994	5166012	transposase,holin	Stx2-converting_phage(30.0%)	35	NA	NA
WP_085949589.1|3010048_3011261_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
WP_001329787.1|3011674_3011953_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000840364.1|3012021_3012288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016234078.1|3012587_3012764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000221544.1|3013508_3014078_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270978.1|3014337_3014739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|3014726_3015161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147726656.1|3015581_3015896_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.0	9.1e-51
WP_000612632.1|3015892_3016240_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
WP_000998091.1|3016289_3017675_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.0e-258
WP_000823243.1|3017913_3019272_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|3020004_3020262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|3022012_3022534_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001513690.1|3022530_3023484_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188248.1|3023570_3025895_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879153.1|3025939_3026842_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125175.1|3026838_3027837_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|3027833_3028790_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|3028790_3029558_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|3030115_3030373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189123.1|3031023_3032532_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_160371899.1|3034107_3034950_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001333382.1|3034952_3036041_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_001300030.1|3036045_3036996_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_169063194.1|3037060_3038005_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_024167707.1|3038185_3039325_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.0e-67
WP_001293435.1|3039478_3041476_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_001505014.1|3041538_3042816_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_169063195.1|3044647_3046117_+	amino acid permease	NA	NA	NA	NA	NA
WP_000671170.1|3046221_3048591_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_071526750.1|3048722_3050165_+	amino acid permease	NA	NA	NA	NA	NA
WP_000262195.1|3052045_3053344_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000677247.1|3053409_3054129_-	amino acid racemase	NA	NA	NA	NA	NA
WP_075210367.1|3054473_3055418_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000526135.1|3055535_3055994_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
>prophage 7
NZ_CP051738	Escherichia coli strain SCU-105 chromosome, complete genome	5166012	3220859	3266138	5166012	transposase,plate,tRNA	Stx2-converting_phage(21.43%)	39	NA	NA
WP_000886683.1|3220859_3222152_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_169063204.1|3222242_3223586_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.7	3.6e-80
WP_001295343.1|3223596_3224208_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077077.1|3224366_3228473_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3228607_3229102_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|3229647_3230613_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043583.1|3230735_3232502_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202195.1|3232502_3234224_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	3.8e-21
WP_001241678.1|3234265_3234970_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3235254_3235473_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_032186262.1|3236889_3237084_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_032186261.1|3237103_3237592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032186260.1|3237588_3237966_-	toxin	NA	NA	NA	NA	NA
WP_032186258.1|3238055_3238424_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692329.1|3238586_3238808_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_032186257.1|3238870_3239347_-	RadC family protein	NA	NA	NA	NA	NA
WP_032186255.1|3239362_3239848_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_072855048.1|3239902_3240721_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.9	5.7e-44
WP_001119729.1|3240820_3241054_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000581504.1|3241132_3241588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348608.1|3241663_3244180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169063205.1|3244300_3247423_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_169063206.1|3247793_3248645_-	GTPase family protein	NA	NA	NA	NA	NA
WP_089541817.1|3248629_3249858_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_001282172.1|3252091_3252481_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	97.7	4.3e-66
WP_000612626.1|3252477_3252825_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_032186535.1|3252873_3254412_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.1e-294
WP_032186534.1|3254705_3255182_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_032186533.1|3255184_3256663_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_075210315.1|3256684_3257182_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_032186531.1|3257189_3257606_+	lysozyme family protein	NA	NA	NA	NA	NA
WP_032186530.1|3257598_3259401_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032186529.1|3259391_3260324_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032186528.1|3260336_3262313_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	36.4	2.1e-12
WP_032186527.1|3262323_3262785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032186526.1|3262799_3263099_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032186525.1|3263102_3264182_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_032186524.1|3264188_3264740_+	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_032186523.1|3264758_3266138_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP051738	Escherichia coli strain SCU-105 chromosome, complete genome	5166012	3278622	3318692	5166012	transposase,integrase,protease	Enterobacteria_phage(25.0%)	25	3298984:3298998	3328115:3328129
WP_162886171.1|3278622_3279836_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	6.0e-167
WP_000422741.1|3279992_3280418_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|3280414_3280765_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_032186535.1|3281014_3282553_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.1e-294
WP_000612626.1|3282601_3282949_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_077476405.1|3282945_3283293_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.0	2.7e-51
WP_001016257.1|3283343_3284090_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|3284104_3285646_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_049036874.1|3287171_3289616_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_024165530.1|3290180_3290363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001499171.1|3290372_3290675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169063208.1|3290661_3300462_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.5	2.1e-28
3298984:3298998	attL	ATCATCGCTCACCAG	NA	NA	NA	NA
WP_049036871.1|3300474_3302241_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.2	2.7e-22
WP_001367158.1|3302839_3303733_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	38.4	1.2e-31
WP_000175355.1|3303729_3304356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162886171.1|3304794_3306008_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	6.0e-167
WP_169063209.1|3306059_3308048_-	DEAD/DEAH box helicase family protein	NA	M1HHW6	Paramecium_bursaria_Chlorella_virus	33.1	1.3e-22
WP_169063210.1|3308200_3308764_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001258873.1|3310138_3311974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070931.1|3312074_3312362_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_005067490.1|3312333_3313863_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_033868275.1|3314032_3315250_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_012602745.1|3315548_3315947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934041.1|3316064_3318341_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3318371_3318692_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
3328115:3328129	attR	CTGGTGAGCGATGAT	NA	NA	NA	NA
>prophage 9
NZ_CP051738	Escherichia coli strain SCU-105 chromosome, complete genome	5166012	3359413	3394992	5166012	capsid,lysis,plate,tail,head,integrase,portal,terminase	Salmonella_phage(82.93%)	48	3359323:3359349	3395067:3395093
3359323:3359349	attL	ATGGGTTTTTTGTTGCCTGAAATTTAT	NA	NA	NA	NA
WP_000972391.1|3359413_3359632_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_169063213.1|3359722_3360823_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	1.6e-174
WP_000980414.1|3360819_3361305_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	1.8e-66
WP_115442958.1|3361301_3364379_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000763311.1|3364371_3364491_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3364505_3364808_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_021513024.1|3364862_3365378_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	6.2e-89
WP_001522722.1|3365387_3366560_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	1.6e-204
WP_021513022.1|3367244_3368117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021513021.1|3368140_3368419_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	82.7	1.0e-29
WP_021513020.1|3368390_3368984_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.8	5.4e-60
WP_169063214.1|3368983_3370489_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	66.6	8.8e-176
WP_021513018.1|3370485_3371091_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.0	2.2e-109
WP_021513017.1|3371083_3371992_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	1.3e-142
WP_021513016.1|3371978_3372338_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.9	2.3e-50
WP_021513015.1|3372334_3372913_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	2.3e-92
WP_050483768.1|3372995_3373892_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	47.0	1.4e-72
WP_021513013.1|3373888_3374332_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	4.3e-62
WP_001039945.1|3374324_3374756_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_021513012.1|3374851_3375280_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	91.5	1.1e-59
WP_001069911.1|3375276_3375792_-	lysozyme	NA	E5G6N1	Salmonella_phage	93.6	1.9e-90
WP_000171569.1|3375772_3375988_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	78.9	3.1e-26
WP_000868175.1|3375991_3376195_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673523.1|3376194_3376659_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000059198.1|3376754_3377405_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	2.5e-111
WP_000742511.1|3377408_3378467_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_021513011.1|3378483_3379317_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	87.4	7.4e-124
WP_001098431.1|3379459_3381226_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_032204462.1|3381225_3382251_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	86.2	8.4e-170
WP_021513009.1|3382286_3383417_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_021513008.1|3383433_3383934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115442873.1|3384371_3384797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3384956_3385190_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3385200_3385389_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_115442872.1|3385541_3387956_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.1	0.0e+00
WP_032217041.1|3387952_3388810_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	1.2e-161
WP_000752613.1|3388806_3389034_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244228.1|3389033_3389267_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_001311552.1|3389334_3389676_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956182.1|3389639_3389840_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460883.1|3389847_3390357_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|3390389_3390611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009008398.1|3390756_3391656_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.1	2.5e-37
WP_169063215.1|3391656_3392004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169063216.1|3392208_3392439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021570730.1|3392441_3393512_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.5	4.2e-71
WP_000866326.1|3393489_3393861_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	54.8	5.6e-31
WP_069915926.1|3393939_3394992_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	8.0e-107
3395067:3395093	attR	ATGGGTTTTTTGTTGCCTGAAATTTAT	NA	NA	NA	NA
>prophage 10
NZ_CP051738	Escherichia coli strain SCU-105 chromosome, complete genome	5166012	3451441	3521734	5166012	capsid,plate,tail,transposase,head,protease,holin,portal,terminase	Shigella_phage(52.73%)	85	NA	NA
WP_100222095.1|3451441_3452789_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000443544.1|3452992_3454078_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386513.1|3454218_3455181_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001309370.1|3455208_3457359_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.0	6.3e-42
WP_001145139.1|3457478_3457961_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	53.1	7.5e-36
WP_000007147.1|3458196_3459561_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.6	3.3e-52
WP_001296991.1|3459789_3460461_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000976400.1|3460460_3461459_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001309369.1|3461451_3463188_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_000070131.1|3463180_3464314_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|3464324_3465431_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|3465392_3465803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001113348.1|3465935_3466697_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|3466693_3467935_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045450.1|3467934_3468891_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000446924.1|3468926_3469316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373624.1|3469520_3470225_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_001544393.1|3470361_3470814_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598612.1|3470815_3471061_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|3471053_3471539_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084639.1|3471541_3472054_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001295301.1|3472075_3473065_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001304790.1|3473461_3474370_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	8.3e-28
WP_000042533.1|3474407_3476429_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044833.1|3477007_3477685_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246782.1|3477677_3478433_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118805.1|3478419_3479574_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|3479570_3480611_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001309367.1|3480697_3481987_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000767422.1|3482045_3482522_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000931964.1|3482970_3483333_+	GtrA family protein	NA	U5P0S6	Shigella_phage	86.7	3.9e-53
WP_000703624.1|3483329_3484247_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	89.1	2.8e-156
WP_001673698.1|3484243_3485719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071593801.1|3486017_3486302_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	62.5	3.5e-17
WP_001673696.1|3486422_3487355_-	hypothetical protein	NA	U5P0I1	Shigella_phage	95.2	7.9e-50
WP_001673695.1|3487358_3487943_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	1.0e-111
WP_000785306.1|3487933_3488992_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	99.4	9.5e-201
WP_000424729.1|3488978_3489404_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	3.9e-81
WP_001259079.1|3489403_3489952_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	100.0	2.3e-97
WP_000999527.1|3489951_3491031_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	6.9e-207
WP_001673694.1|3491030_3492356_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	99.1	4.2e-246
WP_071593209.1|3492384_3492771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001673693.1|3492802_3494635_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.5	1.8e-303
WP_000661054.1|3494776_3495046_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090998.1|3495045_3495402_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_001673692.1|3495401_3496898_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	96.4	1.6e-265
WP_000497758.1|3496881_3497052_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_000779292.1|3497060_3497621_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000224835.1|3497617_3498124_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_169063217.1|3498098_3498509_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.1	3.0e-70
WP_000927711.1|3498505_3498829_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|3498831_3499032_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257509.1|3499081_3500287_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.8	5.3e-224
WP_001193631.1|3500301_3500952_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466265.1|3500929_3502171_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	1.5e-242
WP_000605606.1|3502170_3502353_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_096954127.1|3502364_3503861_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	100.0	8.8e-301
WP_000929173.1|3504094_3504589_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.3e-88
WP_001135217.1|3504714_3505065_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	5.2e-63
WP_001247186.1|3505122_3505629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001673689.1|3505965_3506358_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	88.2	4.5e-55
WP_001075794.1|3506354_3506969_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	98.0	4.1e-111
WP_000422366.1|3506968_3507250_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001673688.1|3507236_3507623_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	89.1	2.7e-52
WP_001673687.1|3507716_3508502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075730.1|3508695_3509385_-	antitermination protein	NA	NA	NA	NA	NA
WP_001673686.1|3509406_3510402_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.8e-194
WP_001061381.1|3510409_3511219_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.9	1.6e-152
WP_000767124.1|3511238_3511628_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8SBE7	Shigella_phage	100.0	7.1e-69
WP_000210178.1|3511624_3511951_-	LexA repressor	NA	U5P451	Shigella_phage	97.2	2.9e-52
WP_000066917.1|3511947_3512601_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_074160031.1|3512600_3513095_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	3.3e-87
WP_001673684.1|3513091_3514033_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	92.7	2.4e-139
WP_001250269.1|3514022_3514202_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515869.1|3514377_3514935_-	protein YmfL	NA	U5P4K1	Shigella_phage	96.8	8.8e-97
WP_000205494.1|3514972_3515173_-	cell division protein	NA	NA	NA	NA	NA
WP_000450738.1|3515270_3515897_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_000559922.1|3516124_3516640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001546523.1|3517109_3517472_+	hypothetical protein	NA	U5P4J6	Shigella_phage	99.2	3.3e-60
WP_000081287.1|3517537_3518362_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_001673683.1|3518489_3519026_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	97.8	9.0e-99
WP_001546522.1|3519016_3519379_+	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	7.5e-65
WP_000206811.1|3519378_3519684_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	4.9e-49
WP_001303849.1|3519798_3520017_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_089541817.1|3520505_3521734_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
>prophage 11
NZ_CP051738	Escherichia coli strain SCU-105 chromosome, complete genome	5166012	4039103	4081926	5166012	transposase	Shigella_phage(27.27%)	38	NA	NA
WP_085949589.1|4039103_4040317_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
WP_000643334.1|4040841_4041798_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667052.1|4041794_4043993_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	6.2e-37
WP_000122401.1|4044002_4044959_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171079.1|4045139_4046267_-	MFS transporter	NA	NA	NA	NA	NA
WP_001586705.1|4046408_4047467_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001119037.1|4047731_4048616_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000893270.1|4049742_4050996_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.4e-96
WP_001285288.1|4051007_4052111_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4052398_4053454_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174684.1|4053492_4053894_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|4053951_4055196_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4055287_4055746_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4056006_4057464_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_024198968.1|4057511_4057754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000469791.1|4057770_4058280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000602121.1|4058341_4058956_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_012602708.1|4058952_4060104_-	RNA ligase RtcB family protein	NA	A0A222ZKP1	Mycobacterium_phage	30.7	1.9e-29
WP_001059547.1|4060282_4060735_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000554757.1|4061145_4061439_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226152.1|4061490_4062546_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_072146790.1|4062616_4063402_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001314494.1|4063346_4065086_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_085949589.1|4065413_4066626_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
WP_169063230.1|4066684_4067182_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000093873.1|4067358_4068108_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001225679.1|4068408_4069149_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|4069119_4069887_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4070092_4070671_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973081.1|4070910_4073355_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4073397_4073871_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118007.1|4074024_4074795_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_001306803.1|4075066_4075555_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000227713.1|4075645_4076149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000420763.1|4076268_4077405_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001306804.1|4077851_4079102_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	3.6e-29
WP_089541817.1|4079603_4080831_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_097742542.1|4080969_4081926_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP051738	Escherichia coli strain SCU-105 chromosome, complete genome	5166012	4576378	4605248	5166012	transposase,protease	Escherichia_phage(14.29%)	34	NA	NA
WP_001309930.1|4576378_4577575_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.7	1.3e-206
WP_001526538.1|4577582_4578197_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	8.9e-42
WP_001305664.1|4578639_4579434_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4579504_4579954_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4579995_4580223_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4580227_4580542_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216677.1|4580548_4580944_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492918.1|4581270_4581546_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170835.1|4581675_4582362_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949501.1|4582361_4583216_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4583225_4583876_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776522.1|4583889_4584354_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4584363_4584669_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001305665.1|4584684_4586082_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|4586436_4587501_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_169063247.1|4587608_4588364_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569713.1|4588360_4589110_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4589291_4589621_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4589769_4590045_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001305666.1|4590161_4591787_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4591870_4593034_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101676.1|4593036_4593675_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4593684_4594083_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012565.1|4594100_4594760_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|4594810_4595509_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220123.1|4595527_4595929_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4596055_4596787_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|4596877_4599319_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|4599357_4599783_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4599987_4601286_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_162886171.1|4601436_4602649_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	6.0e-167
WP_001089295.1|4602702_4602900_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4602981_4603986_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4603988_4605248_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 13
NZ_CP051738	Escherichia coli strain SCU-105 chromosome, complete genome	5166012	5103077	5142925	5166012	transposase,integrase,tRNA	Bacillus_phage(22.22%)	37	5113445:5113462	5147935:5147952
WP_000499788.1|5103077_5104967_+|tRNA	tRNA uridine(34) 5-carboxymethylaminomethyl synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_000932864.1|5105030_5105654_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_000116695.1|5106270_5106651_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_000135618.1|5106659_5107475_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_000429386.1|5107521_5107761_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_001052219.1|5107822_5108293_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_001288587.1|5108307_5108841_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_001176745.1|5108853_5110395_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_000896498.1|5110445_5111309_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_000190506.1|5111335_5112718_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_001251965.1|5112738_5113158_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
5113445:5113462	attL	AAAAATGTAGTTTTTTCA	NA	NA	NA	NA
WP_000933736.1|5113508_5114879_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334086.1|5115040_5116870_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_001029679.1|5117029_5117851_+	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000267723.1|5117837_5119946_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|5119942_5121610_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001243518.1|5121612_5123139_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000251879.1|5123139_5124756_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001271300.1|5124986_5125364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|5125773_5126145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444089.1|5126205_5126703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206315.1|5126778_5127567_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000704156.1|5127624_5128149_-	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_000777554.1|5128243_5128717_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000071896.1|5129048_5129585_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000497519.1|5129699_5130026_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
WP_001353740.1|5130213_5130453_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_000827811.1|5131249_5131822_+	long polar fimbria major subunit LpfA-O113	NA	NA	NA	NA	NA
WP_000088124.1|5131869_5132601_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_001545041.1|5132625_5135148_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001046010.1|5135158_5136229_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000867161.1|5136476_5137517_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|5137604_5138564_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|5138563_5139454_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|5139544_5140318_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_000377785.1|5140332_5141058_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_089541817.1|5141697_5142925_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
5147935:5147952	attR	AAAAATGTAGTTTTTTCA	NA	NA	NA	NA
>prophage 1
NZ_CP051739	Escherichia coli strain SCU-105 plasmid pSCU-105-1, complete sequence	172627	102768	111092	172627	transposase	Salmonella_phage(66.67%)	8	NA	NA
WP_001067855.1|102768_103473_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001757034.1|103733_104015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169063307.1|104120_104405_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_169063280.1|104411_107387_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	99.5	0.0e+00
WP_001161490.1|107390_107951_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001323888.1|107939_108107_+	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_001323889.1|108260_109838_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_001016257.1|110345_111092_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
