The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051698	Escherichia coli strain SCU-152 chromosome, complete genome	4757546	1143865	1151005	4757546		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1143865_1144504_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590388.1|1144500_1145763_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
WP_000847985.1|1145759_1146668_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1146863_1147631_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141325.1|1147681_1148338_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	1.6e-49
WP_001272897.1|1148443_1151005_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
NZ_CP051698	Escherichia coli strain SCU-152 chromosome, complete genome	4757546	1521150	1566160	4757546	integrase,holin,capsid,head,tRNA,tail,plate,terminase,portal	Enterobacteria_phage(84.09%)	54	1524570:1524593	1569976:1569999
WP_000683799.1|1521150_1523157_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|1523315_1524536_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
1524570:1524593	attL	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
WP_000127749.1|1524819_1525998_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615813.1|1525994_1526990_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000215759.1|1527219_1528011_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.1	1.1e-65
WP_001353016.1|1527955_1528153_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000078916.1|1528388_1528529_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488105.1|1528719_1528980_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132800.1|1529022_1530132_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	1.3e-195
WP_000005360.1|1530289_1531474_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	1.6e-225
WP_000290450.1|1531473_1531986_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665314.1|1532040_1532406_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333494.1|1532414_1532570_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000853388.1|1532556_1535364_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.8	0.0e+00
WP_000979954.1|1535376_1535865_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000905059.1|1535891_1536491_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.4	1.9e-97
WP_000972164.1|1537518_1538052_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.3	9.3e-96
WP_000972093.1|1538080_1538608_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	95.4	4.0e-91
WP_169059538.1|1538609_1540772_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	75.5	4.2e-288
WP_001443704.1|1540774_1541305_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	9.6e-93
WP_001111925.1|1541297_1542194_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.3	7.1e-157
WP_000213447.1|1542197_1542548_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271922.1|1542544_1543126_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	2.5e-102
WP_000356320.1|1543122_1543758_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	1.5e-113
WP_000920594.1|1543750_1544218_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780572.1|1544355_1544763_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000072327.1|1544759_1545152_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|1545148_1545472_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|1545474_1545675_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063093.1|1545674_1546169_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	1.6e-89
WP_000632345.1|1546270_1547071_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.1	6.0e-131
WP_001055107.1|1547116_1548169_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	3.9e-194
WP_001262639.1|1548192_1549029_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.6	2.1e-147
WP_064506808.1|1549183_1550935_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_000087812.1|1550934_1551981_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_021529557.1|1553628_1553940_-	phage stability/partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.9e-48
WP_169059539.1|1553944_1554904_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.9e-180
WP_169059540.1|1555005_1557822_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.1	0.0e+00
WP_000564231.1|1557818_1558208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106901708.1|1558204_1558822_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.7	5.3e-10
WP_054623006.1|1558833_1559133_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	91.9	2.5e-42
WP_000153674.1|1559129_1559375_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_000985159.1|1559371_1559575_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000021656.1|1559661_1559775_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000357024.1|1559771_1560014_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.5e-37
WP_042094569.1|1560025_1560313_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	1.7e-32
WP_000813367.1|1560323_1560665_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	6.6e-55
WP_169059541.1|1560917_1561124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004249.1|1561130_1561418_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
WP_001390705.1|1561531_1561852_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_000023401.1|1561948_1562953_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	56.0	1.5e-99
WP_000004833.1|1563111_1564269_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	7.9e-23
WP_032264070.1|1564334_1565348_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283581.1|1565347_1566160_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
1569976:1569999	attR	GATGCGACGCTGGCGCGTCTTATC	NA	NA	NA	NA
>prophage 3
NZ_CP051698	Escherichia coli strain SCU-152 chromosome, complete genome	4757546	1765774	1775216	4757546		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|1765774_1766701_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1766705_1767437_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|1767417_1767525_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1767584_1768316_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001615312.1|1768537_1770223_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	3.3e-304
WP_000598641.1|1770219_1770939_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1770985_1771456_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1771496_1771958_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|1772082_1774083_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_169059550.1|1774079_1775216_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 4
NZ_CP051698	Escherichia coli strain SCU-152 chromosome, complete genome	4757546	2298438	2366266	4757546	integrase,lysis,tail,protease,terminase,portal	Enterobacteria_phage(44.23%)	79	2306014:2306029	2335702:2335717
WP_001260849.1|2298438_2299260_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2299359_2299443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|2299535_2299871_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091849.1|2300267_2301521_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2301627_2302521_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2302655_2303876_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|2304000_2304696_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_169059565.1|2304648_2305941_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2306014:2306029	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000148710.1|2306099_2306714_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|2306756_2307611_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_021542129.1|2307612_2308230_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	2.8e-75
WP_169059628.1|2308240_2310664_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	7.5e-209
WP_000041554.1|2310724_2313151_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
WP_001307224.1|2313349_2313655_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2313762_2314473_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2314475_2315036_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2315070_2315412_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2315546_2315873_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2316078_2317293_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836057.1|2317304_2318324_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001360138.1|2318381_2318492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774504.1|2318511_2319792_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_000005552.1|2319826_2320078_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001774503.1|2320150_2322622_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_001296931.1|2322714_2322906_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2322902_2323091_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_141086970.1|2323577_2324153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2324154_2324310_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448563.1|2324476_2324884_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2324967_2325198_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705346.1|2325181_2325703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|2325683_2326649_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_001774502.1|2326689_2327112_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	84.9	3.4e-61
WP_001774471.1|2327349_2328684_-	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	34.1	2.0e-06
WP_122083109.1|2329276_2329384_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000884073.1|2329428_2329641_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_000980999.1|2329857_2330109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309521.1|2330175_2330454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774470.1|2330455_2331505_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	5.7e-113
WP_001047131.1|2331518_2332271_+	antitermination protein	NA	Q8SBE4	Shigella_phage	94.4	1.4e-129
WP_120795389.1|2332548_2332638_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2332692_2332905_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2333205_2333421_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2334174_2334390_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_001309518.1|2334373_2334706_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.3	1.1e-25
WP_001092973.1|2334702_2335236_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	92.7	8.4e-97
WP_001071769.1|2335232_2335730_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2335702:2335717	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000066495.1|2336091_2336304_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2336314_2336503_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2336505_2336571_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2336650_2336806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531698.1|2337306_2337717_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	91.2	5.0e-65
WP_001031431.1|2338017_2338224_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000421825.1|2338769_2339309_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_169059566.1|2339317_2341417_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.3	0.0e+00
WP_001072975.1|2341413_2341626_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985923.1|2341625_2343134_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	1.1e-287
WP_001136590.1|2343078_2345106_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097055.1|2345192_2345516_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	2.5e-51
WP_001283153.1|2345508_2345784_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677119.1|2345795_2346386_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	79.6	2.1e-80
WP_001079412.1|2346382_2346784_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	97.7	1.2e-71
WP_169059567.1|2346794_2347538_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	96.8	2.3e-129
WP_001366333.1|2347598_2347985_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	96.9	7.5e-63
WP_001161009.1|2347993_2348323_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_169059568.1|2348294_2351360_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.1	0.0e+00
WP_000447253.1|2351359_2351689_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_024009052.1|2351698_2352397_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	1.7e-134
WP_052934050.1|2352402_2353146_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.9e-148
WP_000741589.1|2353043_2353691_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_137569860.1|2353751_2357150_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_016233036.1|2357216_2357816_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	97.5	2.0e-110
WP_137468693.1|2357880_2360832_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	58.3	1.2e-64
WP_024009049.1|2360831_2361407_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.1e-101
WP_000087133.1|2361505_2362096_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.1e-24
WP_000836765.1|2362414_2362648_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_120795384.1|2362716_2362830_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2363433_2364717_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527751.1|2364805_2366266_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
>prophage 5
NZ_CP051698	Escherichia coli strain SCU-152 chromosome, complete genome	4757546	2715225	2815770	4757546	integrase,capsid,lysis,head,tRNA,tail,terminase,transposase,portal	Enterobacteria_phage(63.79%)	112	2737155:2737170	2817739:2817754
WP_000152933.1|2715225_2715810_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|2715926_2717018_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_073533555.1|2717857_2720725_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001205414.1|2720824_2722753_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733728.1|2722971_2724042_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_000059412.1|2724052_2724685_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001297541.1|2724695_2726114_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_000841709.1|2726433_2728131_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_000615067.1|2728209_2728650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000511313.1|2728827_2729082_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020161.1|2729282_2730017_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_001301104.1|2730018_2730630_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_044861892.1|2730729_2731644_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|2731738_2733475_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197840.1|2733860_2734931_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|2734940_2736239_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190854.1|2736568_2738101_+	SpoVR family protein	NA	NA	NA	NA	NA
2737155:2737170	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|2738152_2738872_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|2739093_2740635_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943462.1|2740780_2741311_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_021542090.1|2741356_2742625_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	6.0e-210
WP_000897378.1|2742624_2743044_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000807626.1|2744533_2744995_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|2745071_2745731_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001297679.1|2745802_2746096_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000695223.1|2746337_2746739_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056831.1|2746858_2747227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|2747746_2748442_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|2748465_2749278_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|2749281_2749548_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001131446.1|2750298_2750418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001325743.1|2750378_2750564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|2750664_2750838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304448.1|2750899_2751184_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_000979977.1|2751187_2751523_+	YmgD family protein	NA	NA	NA	NA	NA
WP_021542089.1|2751579_2753901_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.8	1.5e-89
WP_001307135.1|2754017_2754227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299921.1|2754626_2754845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169059580.1|2754976_2756500_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001065752.1|2756831_2757080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888772.1|2757192_2757459_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000857995.1|2757487_2757760_-	two-component-system connector protein YmgA	NA	NA	NA	NA	NA
WP_000554144.1|2757802_2758039_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_001299269.1|2758352_2759564_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000332319.1|2759768_2760500_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
WP_000373101.1|2760720_2761125_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032141808.1|2761177_2761288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001307134.1|2761820_2762144_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_000539892.1|2762264_2762417_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_000207931.1|2763129_2764251_-	5-methylcytosine-specific restriction endonuclease system specificity protein McrC	NA	NA	NA	NA	NA
WP_021558813.1|2764247_2766203_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	28.6	9.8e-26
WP_085948466.1|2766429_2767592_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_088550200.1|2767824_2768409_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	2.7e-104
WP_088550201.1|2768408_2771768_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_016233036.1|2771832_2772432_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	97.5	2.0e-110
WP_169059581.1|2772498_2775897_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.8	0.0e+00
WP_000090917.1|2775957_2776590_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_087906052.1|2776526_2777270_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	8.6e-148
WP_001152535.1|2777275_2777974_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.8e-131
WP_000847333.1|2777973_2778303_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	3.1e-57
WP_000459457.1|2780852_2781287_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|2781268_2781691_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000683105.1|2782405_2782801_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|2782797_2783376_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|2783387_2783741_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000158905.1|2783752_2784151_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_000063280.1|2784192_2785218_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001297109.1|2785273_2785606_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_087906123.1|2785615_2786935_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	3.3e-235
WP_087906124.1|2786915_2788517_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198149.1|2788513_2788720_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_087906125.1|2788716_2790642_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453587.1|2790616_2791162_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000738423.1|2791826_2792120_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|2792210_2792393_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135280.1|2792609_2793107_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_000839596.1|2793106_2793322_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737283.1|2793910_2795008_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_062893049.1|2795197_2795581_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000971095.1|2795666_2795807_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_032236357.1|2795803_2796166_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	93.2	5.2e-58
WP_000774498.1|2796162_2796453_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	6.7e-48
WP_000224914.1|2796445_2796616_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_087906133.1|2796615_2797071_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	65.6	1.3e-58
WP_087906132.1|2797261_2797528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169059629.1|2797672_2798041_-	hypothetical protein	NA	K7P7P8	Enterobacteria_phage	64.8	4.2e-23
WP_087906131.1|2798151_2798313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709083.1|2798466_2799993_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_123058386.1|2800050_2800200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|2800247_2800580_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145900.1|2800647_2800950_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788886.1|2800946_2801648_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	99.6	9.9e-130
WP_016244339.1|2801644_2802574_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	1.0e-110
WP_001400028.1|2802660_2803200_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	1.5e-61
WP_000184665.1|2803230_2803458_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_000712396.1|2803568_2804261_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	2.5e-109
WP_000741702.1|2804390_2805530_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_016244337.1|2805526_2806039_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_016244336.1|2806520_2806727_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	83.8	9.3e-28
WP_016244335.1|2806802_2807099_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	95.9	2.6e-47
WP_000100847.1|2807104_2807890_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000611716.1|2807886_2808567_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000149533.1|2808563_2808722_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_021557045.1|2808718_2809783_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	65.1	2.0e-134
WP_087906181.1|2809936_2810155_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	97.2	8.3e-35
WP_000488406.1|2810202_2810442_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|2810581_2810818_+	excisionase	NA	NA	NA	NA	NA
WP_087906182.1|2810807_2811950_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	99.4	2.4e-205
WP_000444492.1|2812063_2813314_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	1.4e-22
WP_001248691.1|2813485_2814139_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2814148_2814610_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|2814663_2815770_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2817739:2817754	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
>prophage 6
NZ_CP051698	Escherichia coli strain SCU-152 chromosome, complete genome	4757546	3753367	3815533	4757546	plate,protease,transposase,tRNA	Cronobacter_phage(12.5%)	51	NA	NA
WP_000611748.1|3753367_3753781_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|3753784_3755635_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3755598_3756681_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_169059605.1|3756705_3757986_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3757982_3758507_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246437.1|3758509_3759841_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343302.1|3759845_3760607_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_169059606.1|3760615_3763375_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	2.7e-82
WP_000088873.1|3763371_3764115_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240543.1|3764119_3765535_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_169059632.1|3765643_3769078_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000377958.1|3769088_3770441_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001284199.1|3770464_3770947_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908057.1|3770990_3771905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|3772530_3773316_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|3773851_3774583_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|3774647_3775115_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|3775111_3775834_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|3775867_3776623_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3776694_3778053_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211726.1|3778100_3778871_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|3778948_3779749_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648576.1|3779989_3780904_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997037.1|3780900_3781704_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.6e-38
WP_001140186.1|3787440_3788013_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|3788200_3789232_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|3789224_3789878_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|3789917_3790733_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3790850_3791255_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|3791251_3791959_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|3792070_3793789_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001297208.1|3793842_3794667_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000399648.1|3794869_3795850_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|3796099_3796810_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|3796823_3797246_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185293.1|3797242_3797788_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3797953_3798154_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|3798140_3798401_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176573.1|3798449_3799748_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|3799812_3800202_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|3800258_3802400_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|3802498_3803458_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294774.1|3803470_3806953_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|3806989_3807586_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139659.1|3807582_3808731_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|3808730_3809519_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3809522_3809978_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|3810082_3811108_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3811111_3811597_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_021542017.1|3811718_3814151_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001325807.1|3814180_3815533_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
