The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	0	47042	5329017	protease,capsid,tail,terminase,plate,portal,head,lysis,holin,transposase	Yersinia_virus(60.0%)	53	NA	NA
WP_001540303.1|0_2286_+	replication endonuclease	NA	Q858T4	Yersinia_virus	99.9	0.0e+00
WP_032141994.1|2285_2735_+	DUF3850 domain-containing protein	NA	Q858T3	Yersinia_virus	100.0	6.4e-82
WP_001540306.1|3222_4161_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	97.8	7.2e-184
WP_000688782.1|4161_5154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001540309.1|5140_6259_-	ParB N-terminal domain-containing protein	NA	Q858T2	Yersinia_virus	100.0	2.6e-172
WP_001540313.1|6634_7669_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	100.0	1.4e-201
WP_000156872.1|7668_9441_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085953.1|9614_10469_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_060682065.1|10527_11601_+|capsid	phage major capsid protein, P2 family	capsid	Q94MJ7	Enterobacteria_phage	99.7	3.9e-202
WP_001540320.1|11604_12348_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	100.0	9.8e-128
WP_000988628.1|12447_12957_+|head	head completion/stabilization protein	head	Q858W4	Yersinia_virus	100.0	3.0e-91
WP_000846411.1|12956_13160_+|tail	tail protein X	tail	Q858W3	Yersinia_virus	100.0	3.0e-31
WP_000123123.1|13163_13445_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|13444_13942_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_001540323.1|13956_14382_+	hypothetical protein	NA	Q858W1	Yersinia_virus	100.0	3.2e-67
WP_001540324.1|14369_14795_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	100.0	5.0e-68
WP_072174950.1|14766_14940_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
WP_000917151.1|14902_15370_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	100.0	6.1e-83
WP_001001786.1|15362_15815_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_001540326.1|15881_16517_+|plate	phage baseplate assembly protein V	plate	Q858V7	Yersinia_virus	100.0	1.1e-114
WP_000127163.1|16513_16861_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121478.1|16865_17774_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
WP_001285334.1|17766_18297_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	100.0	1.0e-102
WP_001540327.1|18307_21049_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	99.9	0.0e+00
WP_001540328.1|21052_21580_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	100.0	2.7e-95
WP_001540329.1|21731_22511_-	hypothetical protein	NA	Q858R7	Enterobacteria_phage	100.0	3.7e-117
WP_001540330.1|22911_24102_+|tail	phage tail sheath protein	tail	Q858V1	Yersinia_virus	100.0	1.9e-226
WP_001540332.1|24114_24633_+|tail	phage major tail tube protein	tail	Q858V0	Yersinia_virus	100.0	1.4e-93
WP_001031303.1|24690_24966_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_032668170.1|24998_25118_+|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	100.0	1.8e-15
WP_001540334.1|25110_27558_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	100.0	0.0e+00
WP_001540336.1|27572_28052_+|tail	phage tail protein	tail	Q858U6	Yersinia_virus	100.0	2.3e-85
WP_001540338.1|28051_29215_+	phage late control D family protein	NA	Q858U5	Yersinia_virus	99.7	1.7e-206
WP_021517629.1|29295_29514_+	prophage transcriptional regulator OgrK	NA	Q858U4	Yersinia_virus	100.0	2.8e-38
WP_001076748.1|29749_30652_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_001318165.1|30832_31795_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758726.1|32114_33104_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_001298413.1|33210_33966_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|34020_34788_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802217.1|34895_35495_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|35595_36036_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|36247_36547_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|36573_37002_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796345.1|37006_37753_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_096972706.1|37849_38860_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136804.1|39030_40539_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|40561_41407_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|41831_42077_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000547185.1|42165_43494_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000872908.1|43599_44085_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|44177_45104_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|45170_46502_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|46511_47042_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	59712	64306	5329017		Pandoravirus(100.0%)	3	NA	NA
WP_001540354.1|59712_61263_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	35.4	4.4e-05
WP_000105536.1|61495_62620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000694066.1|62752_64306_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.2	1.0e-09
>prophage 3
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	71119	78360	5329017		Synechococcus_phage(33.33%)	5	NA	NA
WP_001540356.1|71119_71782_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	4.2e-29
WP_001540357.1|71793_74295_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_115766381.1|74603_75677_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|75691_76012_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184862.1|76062_78360_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 4
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	90504	91719	5329017		Oenococcus_phage(100.0%)	1	NA	NA
WP_000691039.1|90504_91719_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.1	7.7e-45
>prophage 5
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	97159	102942	5329017	tRNA	Burkholderia_virus(50.0%)	5	NA	NA
WP_000125464.1|97159_98476_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.4	1.6e-59
WP_122083113.1|98579_99230_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_000806411.1|99229_99589_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_000187001.1|99628_100729_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000591376.1|101097_102942_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	9.3e-10
>prophage 6
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	111282	114335	5329017		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|111282_112233_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|113150_114335_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 7
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	118330	126659	5329017		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|118330_122359_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653952.1|122435_126659_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.3	5.5e-66
>prophage 8
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	134954	136718	5329017		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|134954_135626_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000941119.1|135668_136259_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|136445_136718_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 9
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	142080	143670	5329017		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187554.1|142080_143670_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.1	3.2e-67
>prophage 10
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	157367	161051	5329017		Dickeya_phage(100.0%)	1	NA	NA
WP_001540407.1|157367_161051_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 11
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	185391	186507	5329017		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|185391_186507_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 12
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	194040	194649	5329017		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|194040_194649_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 13
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	199687	202235	5329017		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|199687_201103_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|201155_202235_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 14
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	207805	209224	5329017		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000103920.1|207805_209224_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.5	9.6e-39
>prophage 15
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	219341	222955	5329017		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357768.1|219341_222164_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
WP_000168305.1|222418_222955_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 16
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	226771	228121	5329017		Moraxella_phage(100.0%)	1	NA	NA
WP_000106892.1|226771_228121_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 17
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	234418	236377	5329017		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078222.1|234418_236377_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.0	4.8e-89
>prophage 18
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	246313	247841	5329017		Planktothrix_phage(100.0%)	2	NA	NA
WP_000156927.1|246313_247018_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.6e-21
WP_000132446.1|247004_247841_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	8.8e-16
>prophage 19
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	251758	253906	5329017		Escherichia_phage(100.0%)	1	NA	NA
WP_011076734.1|251758_253906_-	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 20
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	259151	265520	5329017		Tetraselmis_virus(50.0%)	5	NA	NA
WP_001540450.1|259151_261137_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	4.9e-150
WP_001171678.1|261409_262339_-	allose kinase	NA	NA	NA	NA	NA
WP_001314355.1|262322_263018_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507111.1|263028_264009_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_000235240.1|263987_265520_-	D-allose ABC transporter ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	6.3e-20
>prophage 21
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	271642	273192	5329017		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611411.1|271642_272323_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	1.1e-05
WP_096972723.1|272433_273192_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.0	3.6e-16
>prophage 22
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	278796	279585	5329017		Pithovirus(100.0%)	1	NA	NA
WP_001193413.1|278796_279585_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	1.9e-12
>prophage 23
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	284424	285927	5329017		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296659.1|284424_285927_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 24
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	305493	308705	5329017	tRNA	Catovirus(50.0%)	2	NA	NA
WP_000003806.1|305493_307011_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856826.1|307247_308705_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
>prophage 25
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	316225	316459	5329017		Vibrio_phage(100.0%)	1	NA	NA
WP_000614748.1|316225_316459_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.0	8.4e-09
>prophage 26
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	329299	329773	5329017		Burkholderia_phage(100.0%)	1	NA	NA
WP_001222997.1|329299_329773_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	37.1	3.8e-24
>prophage 27
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	334196	335441	5329017	integrase	Stenotrophomonas_phage(100.0%)	1	331856:331869	338315:338328
331856:331869	attL	CCGCCAGTTTTTCC	NA	NA	NA	NA
WP_001219071.1|334196_335441_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.4	7.8e-85
WP_001219071.1|334196_335441_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.4	7.8e-85
338315:338328	attR	CCGCCAGTTTTTCC	NA	NA	NA	NA
>prophage 28
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	343757	345741	5329017		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|343757_344051_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|344094_345741_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 29
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	349945	350479	5329017		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|349945_350479_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 30
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	355399	356377	5329017		Tupanvirus(100.0%)	1	NA	NA
WP_001540513.1|355399_356377_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.1	5.2e-28
>prophage 31
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	364097	364643	5329017		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|364097_364643_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 32
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	368558	381583	5329017	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_001540520.1|368558_369890_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.5	3.3e-17
WP_001298688.1|369899_371747_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	3.4e-60
WP_001280357.1|371739_372690_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|372775_373084_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460357.1|373159_374440_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312479.1|374525_375785_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|375787_376792_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|376873_377071_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|377174_378473_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|378677_379103_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076332.1|379141_381583_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
>prophage 33
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	390637	391801	5329017		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943981.1|390637_391801_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	6.4e-81
>prophage 34
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	403223	406296	5329017		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001545733.1|403223_403868_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	33.8	2.2e-27
WP_000692330.1|403886_404108_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186727.1|404170_404647_-	RadC family protein	NA	NA	NA	NA	NA
WP_001350782.1|404662_405136_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
WP_169062247.1|405477_406296_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	6.7e-45
>prophage 35
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	433402	435526	5329017		Bacillus_phage(100.0%)	1	NA	NA
WP_000376544.1|433402_435526_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.7	8.4e-47
>prophage 36
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	439777	442090	5329017	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_169062250.1|439777_441316_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	4.9e-299
WP_021548229.1|441365_441713_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	2.4e-60
WP_001171554.1|441709_442090_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
>prophage 37
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	458935	459982	5329017		Bacillus_virus(100.0%)	1	NA	NA
WP_001545794.1|458935_459982_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	1.4e-34
>prophage 38
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	467021	468203	5329017	integrase	Enterobacteria_phage(100.0%)	1	463460:463474	470251:470265
463460:463474	attL	CACAGCCAGAAGGGC	NA	NA	NA	NA
WP_001131670.1|467021_468203_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	47.9	2.2e-97
WP_001131670.1|467021_468203_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	47.9	2.2e-97
470251:470265	attR	CACAGCCAGAAGGGC	NA	NA	NA	NA
>prophage 39
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	473348	473963	5329017	transposase	Helicobacter_phage(100.0%)	1	NA	NA
WP_001540545.1|473348_473963_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	3.1e-42
>prophage 40
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	494596	501084	5329017		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|494596_495127_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|495436_496393_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000210557.1|496532_498035_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001540558.1|498048_499071_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|499057_500053_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|500085_501084_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 41
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	505272	508033	5329017		Vibrio_phage(100.0%)	2	NA	NA
WP_001106222.1|505272_505737_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
WP_000187778.1|505894_508033_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 42
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	511671	517768	5329017		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|511671_512619_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|512803_512857_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471900.1|512997_515694_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|515899_516286_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|516358_516820_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|516832_517768_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 43
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	526196	535472	5329017	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_000416379.1|526196_529052_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.0e-140
WP_000786399.1|529051_529495_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|529848_531360_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584107.1|531626_532727_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|532726_533809_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001540570.1|533969_535472_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	5.1e-83
>prophage 44
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	540601	544753	5329017	transposase	Acanthamoeba_polyphaga_mimivirus(50.0%)	2	NA	NA
WP_001350789.1|540601_541621_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_102384962.1|543524_544753_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
>prophage 45
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	554185	560965	5329017	holin,transposase	Vibrio_phage(25.0%)	5	NA	NA
WP_001293436.1|554185_556183_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_085947616.1|556336_557493_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000177057.1|558426_558684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|559240_560008_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_096972784.1|560008_560965_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.2	8.2e-18
>prophage 46
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	581135	583545	5329017		Yersinia_phage(33.33%)	4	NA	NA
WP_169062255.1|581135_581954_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	2.1e-46
WP_001350782.1|582295_582769_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
WP_001186775.1|582784_583261_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|583323_583545_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 47
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	606484	607465	5329017		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000991438.1|606484_607465_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.6	4.7e-101
>prophage 48
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	610827	612504	5329017		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|610827_611430_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|611907_612504_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 49
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	622771	624232	5329017		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208176.1|622771_624232_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	6.2e-49
>prophage 50
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	630803	631358	5329017		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|630803_631358_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 51
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	637303	638224	5329017	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_001513532.1|637303_638224_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	6.4e-60
>prophage 52
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	643100	647069	5329017		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001387312.1|643100_644570_-	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.6e-34
WP_001513536.1|644636_647069_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
>prophage 53
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	652310	653975	5329017		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000919584.1|652310_653975_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	5.3e-12
>prophage 54
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	664601	665881	5329017		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|664601_665339_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_001535806.1|665341_665881_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	3.8e-28
>prophage 55
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	673711	676587	5329017		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175940.1|673711_675301_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|675693_676299_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|676425_676587_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 56
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	682274	683597	5329017		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|682274_683597_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 57
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	690317	696127	5329017		Enterococcus_phage(33.33%)	5	NA	NA
WP_000093832.1|690317_691550_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.3	2.7e-82
WP_001298496.1|691641_691974_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000007436.1|691975_692260_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000046754.1|692315_693983_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000409429.1|694189_696127_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 58
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	699404	701518	5329017		Bacillus_phage(50.0%)	2	NA	NA
WP_001188687.1|699404_700094_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219585.1|700093_701518_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	3.2e-10
>prophage 59
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	713285	714239	5329017		Cyanophage(100.0%)	1	NA	NA
WP_001540649.1|713285_714239_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 60
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	717374	731898	5329017	tRNA	Chrysochromulina_ericina_virus(16.67%)	12	NA	NA
WP_000516135.1|717374_719291_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|719379_720510_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001181672.1|720614_720824_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_001274832.1|721381_722143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001443162.1|722162_723656_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	28.3	3.6e-28
WP_000494929.1|723784_725044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681384.1|725278_726445_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	9.8e-90
WP_000062878.1|726504_727410_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_001274021.1|727505_727769_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001337277.1|727871_728090_+	DUF2575 family protein	NA	NA	NA	NA	NA
WP_000767329.1|728097_729039_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001286825.1|729081_731898_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	2.1e-77
>prophage 61
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	736324	737473	5329017		Halovirus(100.0%)	1	NA	NA
WP_001540660.1|736324_737473_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	2.8e-49
>prophage 62
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	742973	748622	5329017		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001298634.1|742973_744527_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.9	2.7e-34
WP_000349942.1|744599_745817_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|745934_747077_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787104.1|747107_748622_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 63
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	756516	758477	5329017		Bacillus_phage(50.0%)	4	NA	NA
WP_000624375.1|756516_756996_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000125568.1|757081_757315_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_001160966.1|757317_757632_+	CcdB family protein	NA	NA	NA	NA	NA
WP_000257181.1|757628_758477_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 64
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	766222	771645	5329017		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117001.1|766222_769129_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_001556757.1|769293_771645_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	6.7e-37
>prophage 65
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	779921	780620	5329017		Planktothrix_phage(100.0%)	1	NA	NA
WP_001540674.1|779921_780620_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	1.1e-22
>prophage 66
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	792098	793823	5329017		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001774153.1|792098_793823_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	4.1e-36
>prophage 67
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	819793	820837	5329017		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|819793_820837_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 68
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	827745	830949	5329017		Burkholderia_virus(50.0%)	4	NA	NA
WP_001576620.1|827745_828360_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	41.1	1.3e-24
WP_001576618.1|828361_828955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135168.1|829416_830310_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_000923703.1|830397_830949_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 69
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	842093	843518	5329017		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|842093_843518_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 70
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	851338	857806	5329017		Mamastrovirus(33.33%)	5	NA	NA
WP_001540713.1|851338_852889_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.1e-18
WP_087891401.1|852935_855326_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|855531_856068_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|856108_856771_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150638.1|856879_857806_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 71
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	861068	861953	5329017		Sodalis_phage(100.0%)	1	NA	NA
WP_000339934.1|861068_861953_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	48.8	4.7e-60
>prophage 72
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	871850	878656	5329017	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|871850_873269_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937411.1|873307_874234_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|874270_874726_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396047.1|874903_875608_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294708.1|875622_876153_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001540734.1|876226_878656_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.8	2.1e-41
>prophage 73
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	883806	884604	5329017		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|883806_884604_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 74
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	890515	890860	5329017		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|890515_890860_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 75
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	894789	896214	5329017	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753942.1|894789_896214_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 77
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	980465	982448	5329017		Ralstonia_phage(100.0%)	1	NA	NA
WP_169062259.1|980465_982448_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.6e-23
>prophage 78
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	992022	995345	5329017		Caulobacter_phage(50.0%)	4	NA	NA
WP_000284050.1|992022_992601_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001538302.1|992805_993573_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|993543_994284_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093934.1|994595_995345_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
>prophage 79
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1009519	1014044	5329017		Hokovirus(50.0%)	4	NA	NA
WP_001538316.1|1009519_1009915_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	49.3	5.6e-29
WP_115766363.1|1009926_1010466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000220508.1|1010458_1011280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001538317.1|1011605_1014044_-	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	43.4	1.6e-33
>prophage 80
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1038549	1039701	5329017		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001335538.1|1038549_1039701_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	7.8e-31
>prophage 81
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1044378	1053989	5329017		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000749900.1|1044378_1045434_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.0e-117
WP_001285288.1|1045722_1046826_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_001538333.1|1046837_1048091_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	6.4e-95
WP_000772639.1|1048435_1048774_+	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	48.6	5.6e-22
WP_001298126.1|1049208_1049733_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001556836.1|1049858_1053989_-	vacuolating autotransporter toxin Vat	NA	Q9LA54	Enterobacteria_phage	40.7	3.3e-281
>prophage 82
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1072279	1073131	5329017		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001538337.1|1072279_1073131_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	8.8e-48
>prophage 83
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1079176	1082481	5329017		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001538339.1|1079176_1080046_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.4e-53
WP_001298546.1|1080205_1080799_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474088.1|1080810_1081047_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046332.1|1081155_1082481_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	3.8e-114
>prophage 84
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1092393	1099962	5329017	integrase,holin	Escherichia_phage(33.33%)	5	1091667:1091681	1112283:1112297
1091667:1091681	attL	CAGAAATCGCTCATA	NA	NA	NA	NA
WP_001295805.1|1092393_1092957_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001159135.1|1094024_1095713_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	5.3e-60
WP_001538343.1|1095726_1097199_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001375032.1|1097212_1097800_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131041.1|1097928_1099962_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
1112283:1112297	attR	TATGAGCGATTTCTG	NA	NA	NA	NA
>prophage 85
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1111084	1112134	5329017		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001538349.1|1111084_1112134_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.3	1.4e-71
>prophage 86
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1119781	1121668	5329017		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001538352.1|1119781_1121668_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
>prophage 87
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1126627	1133909	5329017		Herpes_simplex_virus(33.33%)	5	NA	NA
WP_001538356.1|1126627_1129702_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.1	0.0e+00
WP_024186801.1|1129824_1130907_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.2	5.4e-191
WP_001538358.1|1131108_1131648_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000419066.1|1131873_1132707_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000842109.1|1132799_1133909_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.9	4.0e-32
>prophage 88
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1139201	1139969	5329017		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939359.1|1139201_1139969_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
>prophage 89
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1146877	1148035	5329017		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001538363.1|1146877_1148035_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	6.7e-06
>prophage 90
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1155450	1156566	5329017		Bacillus_phage(100.0%)	1	NA	NA
WP_000484068.1|1155450_1156566_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 91
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1160852	1170950	5329017		Bacillus_phage(60.0%)	7	NA	NA
WP_001366457.1|1160852_1161764_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219315.1|1161888_1162797_+	fructokinase	NA	NA	NA	NA	NA
WP_001331503.1|1163065_1164250_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_115766343.1|1164375_1167519_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221287.1|1167515_1168718_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	1.8e-06
WP_000113933.1|1168907_1169597_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893603.1|1169654_1170950_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 92
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1177901	1186744	5329017	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|1177901_1179029_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|1179051_1179384_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934823.1|1179411_1181259_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|1181269_1182241_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|1182370_1182718_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295827.1|1182755_1183640_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001538377.1|1183938_1184478_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|1184628_1185078_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150440.1|1185081_1186185_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.3e-54
WP_001021161.1|1186273_1186744_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 93
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1212204	1217251	5329017	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|1212204_1212828_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|1212953_1214228_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|1214415_1216770_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|1216978_1217251_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 94
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1220391	1221087	5329017		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|1220391_1221087_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 95
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1224410	1227957	5329017		Bacillus_phage(100.0%)	2	NA	NA
WP_001235630.1|1224410_1226183_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	2.3e-50
WP_001538391.1|1226175_1227957_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	5.2e-42
>prophage 96
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1236794	1239944	5329017		Leptospira_phage(100.0%)	1	NA	NA
WP_001132480.1|1236794_1239944_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 97
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1246952	1255397	5329017		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|1246952_1247504_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122015.1|1247632_1249564_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|1249616_1249946_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|1249945_1250551_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678189.1|1250660_1252535_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	1.0e-117
WP_001313630.1|1252715_1253360_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250114.1|1253491_1254454_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801820.1|1254428_1255397_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.0	6.0e-16
>prophage 98
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1263633	1266875	5329017		Escherichia_phage(66.67%)	3	NA	NA
WP_000057523.1|1263633_1263936_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	80.0	1.3e-41
WP_000806442.1|1263971_1264313_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083948.1|1264370_1266875_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	1.0e-115
>prophage 99
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1274372	1275050	5329017		Bacillus_virus(100.0%)	1	NA	NA
WP_001538400.1|1274372_1275050_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	8.9e-27
>prophage 100
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1278186	1278873	5329017		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110575.1|1278186_1278873_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 101
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1285308	1287090	5329017		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001524200.1|1285308_1287090_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	7.8e-38
>prophage 102
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1293284	1294430	5329017		Streptococcus_phage(100.0%)	1	NA	NA
WP_001556850.1|1293284_1294430_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	43.0	4.8e-49
>prophage 103
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1306464	1310940	5329017	tRNA,tail	Moumouvirus(33.33%)	5	NA	NA
WP_000912345.1|1306464_1307850_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143516.1|1307885_1308407_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1308514_1308727_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|1308728_1309595_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001111235.1|1310583_1310940_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	66.9	4.2e-52
>prophage 104
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1321164	1321848	5329017		Bacillus_phage(100.0%)	1	NA	NA
WP_000770953.1|1321164_1321848_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 105
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1324993	1328137	5329017		Leptospira_phage(100.0%)	1	NA	NA
WP_001538423.1|1324993_1328137_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.5	7.5e-60
>prophage 106
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1337628	1339173	5329017		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001556852.1|1337628_1339173_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	7.0e-19
>prophage 107
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1350561	1356604	5329017		Tupanvirus(50.0%)	3	NA	NA
WP_001556853.1|1350561_1354443_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	3.8e-61
WP_001538440.1|1354658_1355792_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140646.1|1355788_1356604_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 108
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1370895	1372718	5329017		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502940.1|1370895_1371525_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
WP_096972735.1|1371497_1372718_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.3	6.1e-58
>prophage 109
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1375823	1377938	5329017		Bacillus_virus(50.0%)	2	NA	NA
WP_032141769.1|1375823_1377389_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	3.2e-43
WP_001295855.1|1377509_1377938_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	4.3e-19
>prophage 110
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1392026	1392673	5329017		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|1392026_1392236_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|1392289_1392673_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 111
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1396888	1399328	5329017		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|1396888_1398100_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001538448.1|1398239_1399328_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 112
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1406338	1411461	5329017	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_169062264.1|1406338_1408921_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	2.6e-183
WP_001044880.1|1409155_1409638_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001207539.1|1409682_1410618_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631389.1|1410735_1411461_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 113
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1419405	1420446	5329017		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|1419405_1420446_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 114
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1424584	1426249	5329017		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|1424584_1426249_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 115
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1430874	1432821	5329017		Vibrio_phage(100.0%)	1	NA	NA
WP_001023115.1|1430874_1432821_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 116
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1435875	1436634	5329017		Moraxella_phage(100.0%)	1	NA	NA
WP_000480546.1|1435875_1436634_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.8	1.1e-44
>prophage 117
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1441127	1443773	5329017	tRNA	Escherichia_phage(100.0%)	2	NA	NA
WP_000679501.1|1441127_1441889_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	7.4e-30
WP_001287134.1|1442108_1443773_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
>prophage 118
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1447917	1448682	5329017		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773279.1|1447917_1448682_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 119
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1455337	1467170	5329017		Hokovirus(40.0%)	10	NA	NA
WP_000186082.1|1455337_1456015_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_001538464.1|1456011_1458696_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	1.1e-11
WP_001538465.1|1458688_1459261_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087998.1|1459269_1461318_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.5	3.5e-26
WP_001538466.1|1461340_1463014_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001365534.1|1463013_1463103_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_001538467.1|1463415_1463622_+	YbfA family protein	NA	NA	NA	NA	NA
WP_001075778.1|1463722_1464232_+	YbgA family protein	NA	NA	NA	NA	NA
WP_000207172.1|1464228_1465647_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	8.1e-62
WP_096972753.1|1465688_1467170_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	5.5e-45
>prophage 120
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1470548	1471340	5329017		Kaumoebavirus(100.0%)	1	NA	NA
WP_001538470.1|1470548_1471340_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.2	2.0e-09
>prophage 121
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1498905	1502425	5329017		Vibrio_phage(33.33%)	4	NA	NA
WP_000345406.1|1498905_1499625_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
WP_001538475.1|1499621_1500563_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
WP_001538476.1|1500676_1501057_-	homeobox protein	NA	NA	NA	NA	NA
WP_001538477.1|1501372_1502425_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	48.8	2.2e-80
>prophage 122
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1506788	1513363	5329017		Tupanvirus(33.33%)	7	NA	NA
WP_001265443.1|1506788_1507805_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_001538478.1|1508066_1509539_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.8	1.1e-13
WP_001147437.1|1509606_1510395_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|1510523_1510673_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000113014.1|1510839_1511613_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604037.1|1511612_1512302_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891664.1|1512304_1513363_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	7.4e-20
>prophage 123
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1523675	1526206	5329017	transposase	Phage_Gifsy-1(50.0%)	2	NA	NA
WP_000817269.1|1523675_1524806_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	86.4	9.5e-191
WP_001350189.1|1524916_1526206_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 124
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1532532	1533441	5329017		Streptococcus_phage(100.0%)	1	NA	NA
WP_001331964.1|1532532_1533441_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	3.7e-28
>prophage 125
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1544038	1555701	5329017		Anomala_cuprea_entomopoxvirus(20.0%)	10	NA	NA
WP_001538488.1|1544038_1545775_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	1.8e-18
WP_000976403.1|1545767_1546766_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001295890.1|1546765_1547437_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007119.1|1547665_1549027_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001218658.1|1549563_1551714_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	6.3e-42
WP_000386549.1|1551741_1552704_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443514.1|1552844_1553930_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_001538491.1|1554158_1554419_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146357.1|1554683_1554950_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000990159.1|1555023_1555701_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	29.7	1.5e-18
>prophage 126
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1562264	1564711	5329017		Planktothrix_phage(50.0%)	3	NA	NA
WP_000569080.1|1562264_1562987_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|1562983_1563643_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000065240.1|1563955_1564711_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
>prophage 127
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1568597	1570767	5329017		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692329.1|1568597_1568819_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186726.1|1568881_1569358_-	RadC family protein	NA	NA	NA	NA	NA
WP_021522473.1|1569372_1569858_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.2	2.9e-11
WP_077532164.1|1569948_1570767_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.9	2.3e-45
>prophage 128
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1579096	1584292	5329017	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_077532141.1|1579096_1581145_+	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	1.1e-11
WP_000952376.1|1583119_1584292_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	4.1e-229
>prophage 129
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1594318	1594570	5329017	transposase	Stx2-converting_phage(100.0%)	1	NA	NA
WP_169062307.1|1594318_1594570_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	97.6	2.4e-38
>prophage 130
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1617442	1622558	5329017	integrase	Enterobacteria_phage(33.33%)	6	1608210:1608223	1623058:1623071
1608210:1608223	attL	TATTTTCCTTGTGT	NA	NA	NA	NA
WP_001131673.1|1617442_1618621_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	48.7	2.8e-100
WP_000843866.1|1618849_1619596_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|1619999_1620503_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|1620802_1621690_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|1621924_1621990_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|1622042_1622558_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
1623058:1623071	attR	TATTTTCCTTGTGT	NA	NA	NA	NA
>prophage 131
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1627554	1634438	5329017		Tupanvirus(33.33%)	5	NA	NA
WP_000961458.1|1627554_1629147_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000114251.1|1629346_1630162_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_087891391.1|1630307_1632740_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	3.6e-09
WP_001298571.1|1632745_1633645_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001298570.1|1633775_1634438_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.7	3.7e-25
>prophage 132
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1637653	1639525	5329017		Planktothrix_phage(100.0%)	1	NA	NA
WP_021528017.1|1637653_1639525_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
>prophage 133
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1650858	1652061	5329017		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|1650858_1652061_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 134
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1660627	1663001	5329017		Vibrio_phage(50.0%)	4	NA	NA
WP_001195231.1|1660627_1660885_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201570.1|1661044_1661332_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189165.1|1661315_1662038_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001538500.1|1662098_1663001_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
>prophage 135
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1668647	1669775	5329017		Streptococcus_phage(100.0%)	1	NA	NA
WP_001538502.1|1668647_1669775_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.7	6.7e-27
>prophage 136
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1672900	1675638	5329017		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|1672900_1673629_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001538503.1|1673846_1674362_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|1674487_1674811_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255186.1|1674807_1675638_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 137
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1679225	1680944	5329017		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815372.1|1679225_1680944_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
>prophage 138
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1690067	1713810	5329017	protease,tRNA	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_001538507.1|1690067_1692014_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1692086_1692311_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_001538508.1|1692633_1692954_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	2.6e-13
WP_001538509.1|1692984_1695261_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.4	3.3e-166
WP_001040187.1|1696004_1696223_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241673.1|1696507_1697212_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202199.1|1697253_1698975_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001043558.1|1698975_1700742_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.9	4.1e-23
WP_000537432.1|1700864_1701830_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|1702373_1702868_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001675097.1|1703002_1706992_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|1707150_1707762_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_096972685.1|1707772_1709116_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	1.6e-80
WP_000886683.1|1709206_1710499_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_001538513.1|1710737_1713182_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	4.3e-220
WP_000213098.1|1713192_1713810_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 139
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1716895	1720110	5329017		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|1716895_1717636_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|1717827_1720110_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 140
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1724250	1725339	5329017		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057159.1|1724250_1725339_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 141
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1730426	1734966	5329017		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|1730426_1730711_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_001538517.1|1730916_1733181_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551259.1|1733217_1734966_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
>prophage 142
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1749671	1760620	5329017	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_096972692.1|1749671_1750220_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	1.2e-05
WP_001109453.1|1750246_1750894_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462681.1|1750943_1752134_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977927.1|1752318_1753407_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	53.7	9.1e-98
WP_000117881.1|1754008_1755409_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001538521.1|1755577_1756780_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001538523.1|1757045_1759658_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.2	1.2e-18
WP_001090487.1|1759852_1760620_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
>prophage 143
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1769375	1771283	5329017		Tupanvirus(100.0%)	1	NA	NA
WP_000053130.1|1769375_1771283_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	1.6e-52
>prophage 144
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1783883	1785938	5329017		Bacillus_phage(100.0%)	1	NA	NA
WP_001538528.1|1783883_1785938_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 145
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1790171	1790831	5329017	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001538531.1|1790171_1790831_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
>prophage 146
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1801825	1814344	5329017		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|1801825_1802038_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1802048_1802237_+	cold-shock protein	NA	NA	NA	NA	NA
WP_012896763.1|1802211_1802442_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1802431_1802605_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818456.1|1802653_1803727_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_100228301.1|1803809_1806542_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	5.4e-38
WP_001264953.1|1806624_1807653_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|1807625_1808318_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230247.1|1808447_1809620_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001538536.1|1809619_1812166_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_001538537.1|1812162_1812762_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024569.1|1813118_1813424_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420625.1|1813423_1814344_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 147
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1818725	1821748	5329017		Shigella_phage(100.0%)	2	NA	NA
WP_169062268.1|1818725_1819496_-	hypothetical protein	NA	A0A291AY96	Shigella_phage	59.8	3.1e-76
WP_169062269.1|1819669_1821748_-	tape measure protein	NA	A0A2K9VKD1	Shigella_phage	28.3	7.7e-61
>prophage 148
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1827334	1830968	5329017		Enterobacteria_phage(75.0%)	4	NA	NA
WP_169062273.1|1827334_1827883_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.7	4.5e-21
WP_001273658.1|1828868_1829042_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001298362.1|1829124_1830453_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	1.4e-233
WP_001028102.1|1830473_1830968_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	5.5e-50
>prophage 149
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1845565	1846354	5329017		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533536.1|1845565_1846354_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	2.7e-91
>prophage 150
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1853173	1854541	5329017		Bacillus_phage(100.0%)	1	NA	NA
WP_096972689.1|1853173_1854541_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	2.5e-20
>prophage 151
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1857931	1858765	5329017		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1857931_1858765_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 152
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1862901	1863435	5329017		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|1862901_1863435_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 153
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1872742	1873663	5329017		Morganella_phage(100.0%)	1	NA	NA
WP_001295958.1|1872742_1873663_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.9	3.9e-57
>prophage 154
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1878325	1878571	5329017		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1878325_1878571_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 155
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1894451	1895393	5329017		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001305885.1|1894451_1895393_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 156
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1907749	1908931	5329017		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|1907749_1908484_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|1908694_1908931_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 157
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1912203	1913846	5329017		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257002.1|1912203_1912845_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267913.1|1912841_1913846_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	40.0	6.4e-05
>prophage 158
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	1926170	2005731	5329017	capsid,tail,terminase,tRNA,integrase,portal,head,lysis,holin,transposase	Escherichia_phage(36.07%)	96	1924532:1924549	1994847:1994864
1924532:1924549	attL	GGTAGGCCTGATAAGACG	NA	NA	NA	NA
WP_000800153.1|1926170_1926428_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
WP_000526115.1|1926643_1927102_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
WP_012578883.1|1927220_1928183_-	L,D-transpeptidase LdtC	NA	NA	NA	NA	NA
WP_024186828.1|1928325_1931772_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_001538568.1|1931899_1932973_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_000284714.1|1933233_1934433_+	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_001538569.1|1934425_1935127_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	2.4e-35
WP_001251368.1|1935126_1936371_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291301.1|1936399_1937311_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001538573.1|1937326_1938148_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	3.3e-23
WP_000723290.1|1938285_1939074_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_001298471.1|1939070_1939532_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_000759310.1|1939589_1940636_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1940632_1941427_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074983.1|1941593_1942712_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_096972691.1|1942680_1942950_-	excisionase	NA	NA	NA	NA	NA
WP_000102132.1|1943011_1945450_-	exonuclease	NA	V5UQJ3	Shigella_phage	45.0	2.3e-112
WP_000199475.1|1945542_1945731_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|1945727_1945916_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_023148810.1|1946324_1946471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394528.1|1946456_1946831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001545903.1|1946853_1947072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1947231_1947387_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000103685.1|1947659_1948376_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.0e-52
WP_000471549.1|1948425_1948641_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693943.1|1948637_1949063_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_021546386.1|1949085_1950048_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_001545904.1|1950054_1950801_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.4	2.6e-112
WP_001529168.1|1950822_1951539_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	8.7e-73
WP_072146789.1|1951571_1951853_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	78.5	3.4e-33
WP_001545907.1|1951849_1952152_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	89.9	1.6e-47
WP_001529163.1|1952408_1953032_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	93.5	5.4e-103
WP_000403785.1|1953009_1953366_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001224662.1|1953459_1953642_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000753058.1|1953634_1953811_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	4.3e-26
WP_001529162.1|1953807_1954122_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	71.6	3.0e-25
WP_000813254.1|1954730_1954886_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_023141427.1|1955053_1955326_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_001545908.1|1955327_1956386_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	4.9e-88
WP_000139998.1|1956386_1956749_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	9.6e-36
WP_000762885.1|1956763_1957585_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.1e-78
WP_000562553.1|1958480_1958612_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_001323611.1|1958892_1959228_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	73.8	6.8e-44
WP_072147991.1|1959473_1959677_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	5.9e-27
WP_001309421.1|1959673_1959835_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
WP_000284506.1|1959984_1960200_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001545911.1|1960204_1961095_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.6	4.7e-108
WP_021546389.1|1961131_1961665_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	3.6e-100
WP_001151823.1|1961822_1962005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021546326.1|1962019_1962151_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	5.2e-08
WP_032142285.1|1962153_1962621_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_000830178.1|1962932_1963259_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001322427.1|1963381_1963735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001538594.1|1964203_1964752_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.0	1.4e-57
WP_089502733.1|1964681_1966652_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.4	6.2e-262
WP_000258993.1|1966635_1966842_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001538596.1|1966838_1968431_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	8.4e-185
WP_001538597.1|1968420_1969926_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	2.7e-100
WP_000256835.1|1969962_1970310_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_000522592.1|1970367_1971396_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
WP_000201498.1|1971447_1971831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204533.1|1971823_1972177_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_001538599.1|1972192_1972726_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	1.1e-56
WP_000683079.1|1972722_1973118_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_001538600.1|1973125_1973872_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	1.5e-123
WP_001299690.1|1973890_1974322_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_001538601.1|1974348_1974762_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001538602.1|1974742_1977304_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.7	0.0e+00
WP_000847298.1|1977300_1977630_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001327694.1|1977629_1978328_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	7.6e-130
WP_001351101.1|1978333_1979077_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
WP_032300536.1|1979022_1979655_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_137056723.1|1979993_1983686_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.7	0.0e+00
WP_096972809.1|1983753_1984353_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	5.0e-106
WP_016238843.1|1984504_1986568_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	62.5	2.4e-147
WP_001204581.1|1986564_1986843_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_001513565.1|1986852_1987140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217553.1|1987257_1987506_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000891620.1|1987860_1988427_-	hydrolase	NA	NA	NA	NA	NA
WP_001258675.1|1988736_1990509_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077393227.1|1990501_1990954_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|1990982_1991723_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|1991757_1992279_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024913.1|1992280_1992883_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072093883.1|1992952_1993018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|1993156_1993768_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|1993776_1994787_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571479.1|1994931_1995717_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
1994847:1994864	attR	CGTCTTATCAGGCCTACC	NA	NA	NA	NA
WP_000202996.1|1995713_1996469_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001347089.1|1996547_1997480_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|1997495_1998818_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001296141.1|1998936_1999908_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000483766.1|1999941_2001288_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000091149.1|2001478_2002921_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056695.1|2003048_2003918_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000301727.1|2004255_2005731_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 159
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2013787	2018256	5329017		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|2013787_2014450_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_096972765.1|2014473_2015130_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|2015231_2015462_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168747.1|2015600_2015975_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879311.1|2015978_2016851_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000984819.1|2016863_2017205_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812744.1|2017599_2018256_+	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	49.5	6.8e-56
>prophage 160
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2025753	2027802	5329017		Moraxella_phage(100.0%)	1	NA	NA
WP_001055794.1|2025753_2027802_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 161
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2034573	2034783	5329017		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2034573_2034783_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 162
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2040423	2041980	5329017		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|2040423_2041980_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 163
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2045842	2053957	5329017	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000855012.1|2045842_2047204_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.7	1.5e-41
WP_000457334.1|2047277_2047457_+	YoaH family protein	NA	NA	NA	NA	NA
WP_071525875.1|2047576_2047936_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|2048297_2048642_-	RidA family protein	NA	NA	NA	NA	NA
WP_096972766.1|2048773_2050684_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.2	6.5e-91
WP_001220981.1|2050741_2051437_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290578.1|2051476_2052058_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_115766391.1|2052262_2053957_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.6e-35
>prophage 164
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2062924	2066748	5329017	transposase	Bacillus_phage(50.0%)	3	NA	NA
WP_001298230.1|2062924_2064415_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_000621384.1|2064595_2066071_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000526115.1|2066289_2066748_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
>prophage 165
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2071530	2072385	5329017		Indivirus(100.0%)	1	NA	NA
WP_001296125.1|2071530_2072385_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 166
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2081198	2085284	5329017		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000723717.1|2081198_2082179_+	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	3.0e-07
WP_000719088.1|2082315_2083074_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001357805.1|2083191_2084550_+	MFS transporter	NA	NA	NA	NA	NA
WP_001135068.1|2084642_2085284_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	2.9e-19
>prophage 167
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2090210	2094224	5329017		Streptococcus_phage(50.0%)	2	NA	NA
WP_001538825.1|2090210_2092157_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
WP_001538824.1|2092523_2094224_+	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	38.8	6.2e-93
>prophage 168
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2100533	2101187	5329017		Bacillus_phage(100.0%)	1	NA	NA
WP_001538821.1|2100533_2101187_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	1.5e-10
>prophage 169
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2107941	2109162	5329017		Klosneuvirus(100.0%)	1	NA	NA
WP_001538818.1|2107941_2109162_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	2.7e-26
>prophage 170
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2116638	2117466	5329017		Bacillus_virus(100.0%)	1	NA	NA
WP_000175018.1|2116638_2117466_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	2.7e-73
>prophage 171
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2123592	2125854	5329017		Tupanvirus(100.0%)	1	NA	NA
WP_021528224.1|2123592_2125854_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	1.1e-142
>prophage 172
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2135230	2153112	5329017	tRNA,tail	Enterobacteria_phage(64.29%)	19	NA	NA
WP_001144202.1|2135230_2137159_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_001700733.1|2137162_2137705_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|2137801_2137999_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2138051_2138408_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2138530_2138575_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_001538809.1|2138858_2139842_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672319.1|2139856_2142244_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|2142248_2142548_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000078916.1|2142854_2142995_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488107.1|2143185_2143446_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000146940.1|2143703_2145287_-	DUF262 domain-containing protein	NA	E5E3X3	Burkholderia_phage	54.9	2.9e-161
WP_115766333.1|2145636_2146746_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.0	1.2e-193
WP_021511921.1|2146903_2148088_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.7	1.7e-222
WP_000290462.1|2148087_2148600_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_097464258.1|2148655_2149030_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	72.4	2.6e-36
WP_000333503.1|2149038_2149194_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_021511920.1|2149180_2151988_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.4	0.0e+00
WP_000979945.1|2152000_2152489_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905058.1|2152524_2153112_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	99.0	2.7e-104
>prophage 173
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2157184	2191287	5329017	capsid,tail,terminase,plate,integrase,portal,head,holin	Enterobacteria_phage(79.31%)	42	2171634:2171649	2184705:2184720
WP_000071721.1|2157184_2157715_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	100.0	1.3e-94
WP_001111962.1|2157707_2158604_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.0	1.2e-156
WP_000213447.1|2158607_2158958_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271926.1|2158954_2159536_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	1.9e-102
WP_000356358.1|2159532_2160168_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_000920594.1|2160160_2160628_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_021511916.1|2160765_2161173_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.8	7.7e-66
WP_000072335.1|2161169_2161562_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	9.9e-71
WP_000104350.1|2161558_2161882_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864897.1|2161884_2162085_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000063094.1|2162084_2162579_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	3.0e-88
WP_000632362.1|2162680_2163481_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	1.3e-130
WP_001055107.1|2163526_2164579_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	3.9e-194
WP_001262670.1|2164602_2165439_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	8.7e-149
WP_000613760.1|2165593_2167345_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_031624902.1|2167344_2168391_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	4.4e-206
WP_000717775.1|2168939_2170316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000781372.1|2170327_2170672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012565106.1|2170655_2171447_+	hypothetical protein	NA	NA	NA	NA	NA
2171634:2171649	attL	TTATTATTAATTTTTA	NA	NA	NA	NA
WP_021511912.1|2171657_2174441_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	85.5	0.0e+00
WP_021511911.1|2174437_2174827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000985152.1|2175150_2175354_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000021664.1|2175441_2175555_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	3.1e-09
WP_000357024.1|2175551_2175794_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.5e-37
WP_021511909.1|2175805_2176084_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	5.3e-34
WP_021511908.1|2176094_2176433_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	82.8	3.0e-47
WP_000163908.1|2176447_2176726_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000094527.1|2176817_2177129_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_001247219.1|2177217_2178156_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	3.9e-81
WP_001383222.1|2178188_2178521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997174.1|2178628_2178958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956502.1|2179166_2180147_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154199.1|2180208_2180760_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029464.1|2180759_2181509_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209785.1|2181586_2182051_+	C40 family peptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_001298229.1|2182297_2183011_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001538808.1|2183073_2184510_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001313872.1|2184513_2184705_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|2184836_2185883_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
2184705:2184720	attR	TAAAAATTAATAATAA	NA	NA	NA	NA
WP_115766336.1|2186039_2186873_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069357.1|2187205_2189584_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	1.4e-172
WP_001538806.1|2189640_2191287_-	medium-chain fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.9	2.6e-19
>prophage 174
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2209760	2214844	5329017		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367169.1|2209760_2210129_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	5.6e-15
WP_001304330.1|2210137_2211625_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948882.1|2211634_2212381_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	9.9e-11
WP_000907966.1|2212355_2213627_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_001538803.1|2213623_2214844_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	7.6e-93
>prophage 175
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2223134	2225401	5329017		Escherichia_phage(50.0%)	3	NA	NA
WP_001362847.1|2223134_2223803_+	4Fe-4S binding protein	NA	A0A077SL61	Escherichia_phage	36.5	6.5e-22
WP_001538799.1|2223799_2224585_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587583.1|2224588_2225401_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 176
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2230907	2239699	5329017		Orpheovirus(20.0%)	9	NA	NA
WP_000493948.1|2230907_2231549_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098896.1|2231588_2232737_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_001182336.1|2233027_2234239_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_001538795.1|2234351_2235284_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|2235280_2236306_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|2236604_2236694_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701050.1|2236859_2238029_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|2238174_2238756_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101199.1|2238883_2239699_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 177
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2244114	2245613	5329017		Indivirus(50.0%)	2	NA	NA
WP_000250640.1|2244114_2245011_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	31.3	1.6e-07
WP_001298528.1|2245091_2245613_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
>prophage 178
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2252540	2309689	5329017	protease,capsid,tail,terminase,integrase,portal,head,tRNA	uncultured_Caudovirales_phage(66.67%)	58	2271218:2271234	2297898:2297914
WP_001295400.1|2252540_2253815_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_001296097.1|2253876_2254737_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_000765756.1|2254780_2255386_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100937.1|2255491_2256994_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030339.1|2257604_2258240_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289646.1|2258239_2258935_-	electron transport complex subunit RsxE	NA	NA	NA	NA	NA
WP_000920791.1|2258938_2259559_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_001538790.1|2259562_2260621_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_001538789.1|2260621_2262751_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991809.1|2262743_2263322_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133193.1|2263321_2263903_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_000214176.1|2263979_2264420_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217951.1|2264505_2264721_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001296096.1|2264993_2265119_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_001282531.1|2265361_2266402_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000567511.1|2266437_2267439_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459359.1|2267542_2268715_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125604.1|2268724_2270317_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000179503.1|2270491_2271520_+	mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
2271218:2271234	attL	ACCATCAGCGCCGTGGT	NA	NA	NA	NA
WP_000483362.1|2271631_2272399_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000969092.1|2272627_2273218_+	DNA-binding transcriptional regulator UidR	NA	NA	NA	NA	NA
WP_001538788.1|2273607_2275419_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
WP_001075831.1|2275415_2276789_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001538786.1|2276827_2278093_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_001043353.1|2278137_2279646_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170679.1|2279746_2280922_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066639.1|2281120_2282767_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001538785.1|2282909_2284313_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_001538784.1|2284309_2285239_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_001538783.1|2285314_2286616_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.9	5.0e-18
WP_001298660.1|2286619_2287339_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524861.1|2287467_2287803_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000520815.1|2287799_2288522_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412374.1|2288558_2289941_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769318.1|2290126_2291071_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001298661.1|2291594_2293127_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|2293137_2294526_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_032153848.1|2295632_2296862_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	3.2e-131
WP_000953272.1|2297227_2297416_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_032145563.1|2297473_2298496_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
2297898:2297914	attR	ACCACGGCGCTGATGGT	NA	NA	NA	NA
WP_000076671.1|2298492_2298723_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	49.1	4.5e-07
WP_115773945.1|2298712_2298937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551751.1|2298929_2299295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|2299287_2299521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204964.1|2299513_2299747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000761836.1|2300047_2301802_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.0	3.2e-92
WP_000557476.1|2302090_2302369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126693.1|2302365_2302776_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233313.1|2302788_2303061_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001137337.1|2303348_2304506_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.3e-137
WP_000504056.1|2304545_2305118_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_000267605.1|2305119_2306331_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_001020662.1|2306327_2306666_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
WP_000134109.1|2306662_2306959_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	64.3	6.9e-32
WP_115773943.1|2306958_2307399_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	9.5e-62
WP_000174068.1|2307382_2307565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|2307687_2308044_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001560954.1|2308027_2309689_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.7	8.9e-278
>prophage 179
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2319640	2335077	5329017		Escherichia_phage(44.44%)	14	NA	NA
WP_000148695.1|2319640_2320255_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	5.1e-29
WP_001538777.1|2321152_2321770_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_074162010.1|2321780_2324204_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	6.3e-208
WP_001538775.1|2324264_2326691_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.3e-213
WP_000778146.1|2326889_2327195_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001350228.1|2327302_2328013_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2328015_2328576_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705201.1|2328610_2328952_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2329086_2329413_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001298659.1|2329618_2330833_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	2.8e-47
WP_000836075.1|2330844_2331864_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	5.7e-17
WP_000151242.1|2331921_2333289_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001538772.1|2333377_2334838_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	1.1e-42
WP_000214712.1|2334873_2335077_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 180
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2339464	2340355	5329017		Bacillus_phage(100.0%)	1	NA	NA
WP_000592831.1|2339464_2340355_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	39.0	9.6e-21
>prophage 181
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2347747	2349877	5329017		Pandoravirus(50.0%)	3	NA	NA
WP_001538766.1|2347747_2349187_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	2.8e-30
WP_000803536.1|2349243_2349462_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091198.1|2349493_2349877_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 182
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2356620	2358039	5329017		Bacillus_phage(100.0%)	1	NA	NA
WP_000558456.1|2356620_2358039_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 183
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2381064	2383464	5329017		Klosneuvirus(100.0%)	1	NA	NA
WP_001538754.1|2381064_2383464_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	20.9	4.6e-09
>prophage 184
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2386871	2388630	5329017		Escherichia_phage(66.67%)	3	NA	NA
WP_000642412.1|2386871_2387882_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	2.8e-24
WP_000605675.1|2388067_2388346_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	60.9	1.1e-26
WP_021528209.1|2388345_2388630_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 185
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2400054	2401599	5329017		Escherichia_phage(100.0%)	1	NA	NA
WP_000702528.1|2400054_2401599_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 186
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2408089	2410495	5329017		Ralstonia_phage(100.0%)	1	NA	NA
WP_169062276.1|2408089_2410495_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.5	6.6e-24
>prophage 187
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2415662	2417627	5329017		Ralstonia_phage(100.0%)	1	NA	NA
WP_113336510.1|2415662_2417627_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	2.4e-24
>prophage 188
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2422252	2424355	5329017		Salmonella_phage(100.0%)	1	NA	NA
WP_001538743.1|2422252_2424355_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.9	1.8e-134
>prophage 189
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2429852	2430866	5329017		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000220417.1|2429852_2430866_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	4.6e-27
>prophage 190
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2434495	2436457	5329017		Phage_TP(100.0%)	1	NA	NA
WP_001350247.1|2434495_2436457_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
>prophage 191
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2449618	2450567	5329017		Moraxella_phage(50.0%)	2	NA	NA
WP_000731859.1|2449618_2449792_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001350640.1|2450036_2450567_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 192
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2454507	2458410	5329017		Klosneuvirus(100.0%)	1	NA	NA
WP_000139619.1|2454507_2458410_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 193
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2471995	2473223	5329017	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_102384962.1|2471995_2473223_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
>prophage 194
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2477814	2478804	5329017		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|2477814_2478804_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 195
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2483763	2493184	5329017	tRNA	Enterobacteria_phage(20.0%)	6	NA	NA
WP_001538721.1|2483763_2484897_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	53.8	4.4e-103
WP_001295593.1|2485037_2485472_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001157412.1|2487798_2488734_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_000123774.1|2488862_2490236_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	3.3e-52
WP_000387388.1|2490713_2491697_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_096972740.1|2491951_2493184_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	43.2	5.2e-17
>prophage 196
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2497722	2498238	5329017		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945019.1|2497722_2498238_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 197
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2515463	2516546	5329017		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057991.1|2515463_2516546_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	2.5e-23
>prophage 198
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2535889	2537907	5329017		Bacillus_virus(50.0%)	2	NA	NA
WP_000573407.1|2535889_2536696_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000135019.1|2536743_2537907_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	2.8e-28
>prophage 199
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2546847	2548782	5329017		Lactococcus_phage(100.0%)	1	NA	NA
WP_000485012.1|2546847_2548782_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.1	2.8e-33
>prophage 200
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2556595	2557186	5329017		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176294.1|2556595_2557186_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 201
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2562096	2633343	5329017	protease,capsid,tail,terminase,integrase,head,lysis,holin	Escherichia_phage(38.46%)	89	2579481:2579506	2633482:2633507
WP_001304419.1|2562096_2564694_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_001031530.1|2565073_2565325_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422063.1|2565360_2566410_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_096972736.1|2566629_2567388_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	1.3e-05
WP_001278898.1|2567384_2567975_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_021528134.1|2568014_2568890_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_024186832.1|2569102_2570992_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2571019_2571640_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001538692.1|2571636_2572518_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2572655_2572700_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001538691.1|2572791_2574354_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763537.1|2574353_2575949_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001538690.1|2575952_2577311_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000209513.1|2577322_2578516_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001357405.1|2578515_2579322_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000350514.1|2579372_2579495_-	membrane protein	NA	NA	NA	NA	NA
2579481:2579506	attL	GGTATCGATATCCATGTACCAGACCG	NA	NA	NA	NA
WP_001304589.1|2579960_2580413_-	VapA/VapB family virulence-associated protein	NA	NA	NA	NA	NA
WP_001304590.1|2580598_2580931_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000355614.1|2581048_2581345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204581.1|2581354_2581633_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_016238843.1|2581629_2583693_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	62.5	2.4e-147
WP_096972809.1|2583844_2584444_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	5.0e-106
WP_169062278.1|2584511_2588204_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.1	0.0e+00
WP_071781460.1|2588542_2589175_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	9.3e-103
WP_000194709.1|2589120_2589864_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	8.6e-148
WP_021524657.1|2589874_2590573_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	1.9e-128
WP_000807940.1|2590572_2590914_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_000212987.1|2590906_2594149_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.0	0.0e+00
WP_001538679.1|2594196_2594406_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	2.0e-33
WP_000710952.1|2594501_2594876_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275433.1|2594893_2595607_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	2.3e-126
WP_000133388.1|2595672_2596017_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573362.1|2596013_2596460_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_001007909.1|2596456_2596807_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	4.6e-59
WP_000125984.1|2596819_2597146_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063027.1|2599672_2599894_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_000173054.1|2599938_2601876_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	97.8	0.0e+00
WP_001304597.1|2601940_2603602_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.6	0.0e+00
WP_000958372.1|2603598_2604162_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_000829186.1|2604453_2604819_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	1.7e-61
WP_001304598.1|2604860_2605061_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000736383.1|2605259_2605484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082534.1|2605480_2605975_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	90.7	1.1e-74
WP_000992075.1|2606273_2606807_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	1.4e-99
WP_000731250.1|2606870_2607221_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	92.1	2.6e-54
WP_000284510.1|2607225_2607441_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001304600.1|2607517_2607763_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
WP_001304601.1|2607800_2607983_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
WP_000874510.1|2608118_2610080_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	3.3e-239
WP_000216690.1|2611045_2611210_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	2.6e-17
WP_001304604.1|2611206_2611638_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	95.1	8.1e-66
WP_000935524.1|2612101_2613160_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.9	5.2e-207
WP_000917767.1|2613310_2613508_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_071701801.1|2613734_2614556_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	2.5e-79
WP_000904111.1|2614570_2614927_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_001265091.1|2614939_2615986_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
WP_001403449.1|2615987_2616260_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
WP_000687431.1|2616319_2616493_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	68.5	6.8e-16
WP_000401168.1|2616650_2617754_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001004956.1|2617734_2618385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2618550_2618763_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000206826.1|2618997_2619342_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
WP_000207997.1|2619338_2619506_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000224216.1|2619516_2619780_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
WP_001142588.1|2619781_2620000_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	3.6e-30
WP_000510387.1|2620001_2620217_-	hypothetical protein	NA	A0A222YWK2	Escherichia_phage	94.4	2.2e-35
WP_001289986.1|2620217_2620577_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	73.5	1.7e-37
WP_000753053.1|2620573_2620750_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_001224665.1|2620742_2620925_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_000403782.1|2621020_2621377_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.4e-58
WP_001209475.1|2621354_2621816_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_001266130.1|2621812_2622109_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001141099.1|2622105_2622498_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_000450705.1|2622513_2623284_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	9.7e-86
WP_001309414.1|2623317_2623860_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_001262415.1|2623771_2624812_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	89.8	1.0e-98
WP_000702041.1|2624883_2625309_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001053425.1|2625292_2625568_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
WP_000753626.1|2625675_2626137_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
WP_000379612.1|2626390_2626546_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_001171958.1|2626705_2626924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001586951.1|2626946_2627267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001351093.1|2627244_2627682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021533632.1|2628096_2628951_+	Rha family transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	62.7	1.4e-64
WP_000450218.1|2628961_2629150_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_001093951.1|2629146_2629350_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_021533631.1|2629429_2631922_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_000113189.1|2631986_2632235_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2632212_2633343_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2633482:2633507	attR	GGTATCGATATCCATGTACCAGACCG	NA	NA	NA	NA
>prophage 202
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2641275	2643290	5329017		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|2641275_2642280_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110950.1|2642276_2643290_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 203
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2652856	2664186	5329017	transposase	Citrobacter_phage(20.0%)	11	NA	NA
WP_000068076.1|2652856_2653474_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_001287378.1|2654077_2654491_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718993.1|2654634_2655543_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.1e-59
WP_001538656.1|2655744_2656758_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_024186830.1|2656849_2657755_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001538653.1|2657867_2658326_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|2658375_2659218_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001111618.1|2660011_2661211_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	62.5	1.2e-138
WP_001160110.1|2661263_2661941_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571681.1|2661940_2662651_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_096972750.1|2662647_2664186_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.7	4.8e-20
>prophage 204
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2675305	2681574	5329017		Spodoptera_litura_granulovirus(33.33%)	8	NA	NA
WP_001146444.1|2675305_2675536_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
WP_000063608.1|2675805_2676906_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000170954.1|2677311_2677419_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_000811065.1|2677566_2678421_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257054.1|2678456_2679266_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200375.1|2679269_2679662_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456474.1|2679658_2680492_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|2680491_2681574_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 205
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2684710	2687462	5329017		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|2684710_2685658_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033350.1|2685782_2687462_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	6.0e-24
>prophage 206
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2699908	2700667	5329017		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_001538640.1|2699908_2700667_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	2.6e-14
>prophage 207
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2716695	2718383	5329017		Salmonella_phage(50.0%)	2	NA	NA
WP_000457596.1|2716695_2717964_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	82.5	9.6e-208
WP_000897376.1|2717963_2718383_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	61.3	6.9e-38
>prophage 208
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2731416	2827018	5329017	protease,tail,terminase,holin,portal,lysis,tRNA,transposase	Enterobacteria_phage(58.23%)	102	NA	NA
WP_000332315.1|2731416_2732148_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	51.0	1.6e-53
WP_000373104.1|2732368_2732773_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_001445545.1|2732825_2732951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539892.1|2733034_2733187_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001256622.1|2734114_2735029_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983702.1|2735028_2735856_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	1.5e-07
WP_001101732.1|2735852_2736710_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968127.1|2736706_2737564_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000654168.1|2737961_2738240_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
WP_021528130.1|2738236_2740297_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.5	3.3e-125
WP_050575893.1|2740355_2743766_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.9	0.0e+00
WP_000839596.1|2743942_2744158_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|2744747_2745830_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204794.1|2746018_2746402_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
WP_000971095.1|2746487_2746628_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001538628.1|2746624_2746987_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.9	2.1e-59
WP_000774478.1|2746983_2747274_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	6.7e-48
WP_001538627.1|2747266_2747437_-	protein ninE	NA	K7P7K0	Enterobacteria_phage	67.9	4.1e-13
WP_001053004.1|2747436_2747892_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.2e-59
WP_072093903.1|2747888_2747990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700202.1|2748339_2749383_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_169062279.1|2749419_2753328_-	adhesin	NA	NA	NA	NA	NA
WP_001538625.1|2753577_2754279_-	replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.3	1.0e-126
WP_001538622.1|2755509_2756586_-|transposase	IS110-like element ISEc21 family transposase	transposase	NA	NA	NA	NA
WP_001254932.1|2757468_2758620_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001556896.1|2760532_2761390_-	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	38.9	8.3e-54
WP_001556895.1|2761389_2762907_-	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	53.0	8.1e-145
WP_000444487.1|2763343_2764594_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248679.1|2764765_2765419_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2765428_2765890_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001298466.1|2765943_2767050_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001295971.1|2767085_2767727_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001538616.1|2767730_2769101_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265481.1|2769270_2769942_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2769941_2771402_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|2771477_2772599_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|2772647_2773874_-	peptidase T	NA	NA	NA	NA	NA
WP_000531578.1|2774123_2775260_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_001538615.1|2775243_2776107_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	27.8	5.1e-11
WP_000937496.1|2776339_2776606_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.3	2.3e-18
WP_001538613.1|2776674_2777331_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071586406.1|2777385_2777484_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_000355700.1|2777523_2777817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204581.1|2777826_2778105_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_169062280.1|2778101_2780168_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	62.5	2.4e-147
WP_016231003.1|2780232_2780832_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
WP_137056723.1|2780899_2784592_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.7	0.0e+00
WP_071781460.1|2784838_2785471_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	9.3e-103
WP_001520730.1|2785416_2786160_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.4	8.3e-143
WP_001520731.1|2786170_2786869_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	92.2	1.4e-123
WP_000847405.1|2786868_2787198_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_016231007.1|2787194_2790269_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	94.4	0.0e+00
WP_001161009.1|2790240_2790570_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001298500.1|2790578_2790965_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_000211128.1|2791025_2791769_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
WP_001079411.1|2791779_2792181_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.4e-72
WP_001520733.1|2792177_2792768_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	79.6	2.1e-80
WP_001283153.1|2792779_2793055_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|2793047_2793371_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001520734.1|2793457_2795485_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_000985947.1|2795429_2796938_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
WP_001072975.1|2796937_2797150_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001520735.1|2797146_2799246_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	97.3	0.0e+00
WP_000421825.1|2799254_2799794_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_122996799.1|2800364_2800550_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	1.7e-17
WP_001520737.1|2800766_2801300_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	92.7	1.5e-98
WP_001520738.1|2801363_2801714_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	92.9	7.1e-36
WP_000839574.1|2801718_2801934_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	100.0	2.4e-34
WP_000935517.1|2802674_2803724_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	5.2e-199
WP_000917767.1|2803874_2804072_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000209290.1|2804325_2805483_+	DUF262 domain-containing protein	NA	A0A0R6PJX3	Moraxella_phage	37.4	2.3e-59
WP_000052342.1|2805485_2806175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025378.1|2806143_2807184_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	50.9	9.3e-100
WP_001205451.1|2807247_2807616_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.0	2.2e-56
WP_001520742.1|2807615_2807873_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	100.0	4.4e-35
WP_001520743.1|2807869_2809270_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	97.6	3.5e-259
WP_001520744.1|2809266_2810166_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	2.3e-139
WP_001520746.1|2810176_2811103_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	91.2	1.3e-156
WP_001520748.1|2811099_2811324_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	51.4	4.9e-14
WP_000626792.1|2811320_2811515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001520749.1|2811511_2812363_-	Rha family transcriptional regulator	NA	Q8HA97	Salmonella_phage	68.6	2.1e-102
WP_023151474.1|2812359_2813022_-	ash family protein	NA	Q8W643	Enterobacteria_phage	87.3	3.5e-100
WP_001520752.1|2813130_2813838_-	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	91.1	3.1e-115
WP_000867909.1|2813957_2814251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000838344.1|2814642_2815299_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	97.7	3.1e-125
WP_000608404.1|2815402_2815906_+	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	96.2	1.8e-64
WP_000141093.1|2816193_2816400_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	94.1	1.3e-29
WP_021532424.1|2816594_2816801_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.0	2.8e-08
WP_001199104.1|2816806_2817388_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	65.1	1.9e-70
WP_001520753.1|2817636_2817927_+	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	77.1	8.5e-35
WP_001520754.1|2817923_2818658_+	ead/Ea22-like family protein	NA	A0A2I6TCG8	Escherichia_phage	98.3	1.8e-41
WP_001289973.1|2818654_2819140_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.1e-42
WP_000224220.1|2819141_2819405_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_001520755.1|2819415_2819928_+	hypothetical protein	NA	A0A1U9AJ59	Stx1_converting_phage	96.7	1.1e-77
WP_000457723.1|2820012_2820255_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_001030158.1|2820258_2820405_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	2.8e-23
WP_000528718.1|2820413_2820650_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_001520756.1|2820705_2822019_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	95.4	2.1e-245
WP_072170775.1|2822000_2822447_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	2.7e-72
WP_096972662.1|2822500_2824024_+	recombinase family protein	NA	NA	NA	NA	NA
WP_096972663.1|2824038_2824812_-	hypothetical protein	NA	A0A0F6TIY9	Escherichia_coli_O157_typing_phage	76.1	6.1e-88
WP_096972664.1|2824969_2827018_-	tape measure protein	NA	S4TQY7	Salmonella_phage	29.3	3.4e-53
>prophage 209
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2835558	2836302	5329017		Synechococcus_phage(100.0%)	1	NA	NA
WP_000019588.1|2835558_2836302_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 210
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2842917	2844651	5329017	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|2842917_2844651_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 211
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2849178	2853447	5329017		Tupanvirus(33.33%)	4	NA	NA
WP_000763860.1|2849178_2849568_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.7e-06
WP_096972669.1|2849582_2850632_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_001533408.1|2850634_2851495_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001313042.1|2851785_2853447_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 212
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2863534	2865049	5329017		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001538880.1|2863534_2865049_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	5.7e-13
>prophage 213
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2877042	2877795	5329017		Bacillus_virus(100.0%)	1	NA	NA
WP_001273000.1|2877042_2877795_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
>prophage 214
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2889596	2891861	5329017		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001538888.1|2889596_2890265_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.4e-80
WP_000737290.1|2890778_2891861_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.1	6.0e-166
>prophage 215
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2908188	2920557	5329017		Bacillus_phage(33.33%)	12	NA	NA
WP_001773944.1|2908188_2909883_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.1	1.5e-17
WP_000009302.1|2910053_2910236_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001773945.1|2910314_2911232_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|2911404_2912325_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228686.1|2912313_2912784_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001157268.1|2912764_2914183_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_001298512.1|2914249_2914945_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001330593.1|2914984_2915350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824392.1|2915914_2916973_+	porin	NA	Q1MVN1	Enterobacteria_phage	49.3	1.5e-92
WP_000218217.1|2917568_2918420_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826707.1|2918527_2919886_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001347103.1|2919885_2920557_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 216
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2924607	2925828	5329017	integrase	Ralstonia_phage(100.0%)	1	2923360:2923373	2926384:2926397
2923360:2923373	attL	CAGATAAAACCAAA	NA	NA	NA	NA
WP_001773946.1|2924607_2925828_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.8	7.4e-80
WP_001773946.1|2924607_2925828_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.8	7.4e-80
2926384:2926397	attR	TTTGGTTTTATCTG	NA	NA	NA	NA
>prophage 217
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2946017	2946887	5329017		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001608367.1|2946017_2946887_+	restriction endonuclease	NA	A0A2H4J8H9	uncultured_Caudovirales_phage	28.7	7.0e-16
>prophage 218
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	2953069	2980593	5329017	integrase	Bacillus_phage(33.33%)	11	2947160:2947175	2993133:2993148
2947160:2947175	attL	GTTATCGCATTTTGAT	NA	NA	NA	NA
WP_001773977.1|2953069_2953288_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	51.9	1.2e-09
WP_001773978.1|2953504_2954341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001325918.1|2954802_2955600_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_033548673.1|2955937_2957200_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	2.0e-72
WP_000703047.1|2957393_2958698_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001286281.1|2958725_2960006_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_001295637.1|2959998_2961801_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_001327262.1|2961787_2963500_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	1.8e-31
WP_000970688.1|2963756_2964716_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000623030.1|2964906_2971014_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	3.1e-33
WP_000369530.1|2971101_2980593_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.2e-49
2993133:2993148	attR	GTTATCGCATTTTGAT	NA	NA	NA	NA
>prophage 219
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3000060	3001332	5329017	integrase	Stenotrophomonas_phage(100.0%)	1	2996419:2996432	3015035:3015048
2996419:2996432	attL	GATATGGCGGTGAT	NA	NA	NA	NA
WP_021522130.1|3000060_3001332_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.5	1.2e-72
WP_021522130.1|3000060_3001332_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.5	1.2e-72
3015035:3015048	attR	ATCACCGCCATATC	NA	NA	NA	NA
>prophage 220
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3006890	3035109	5329017		Tupanvirus(80.0%)	7	NA	NA
WP_033548669.1|3006890_3011258_-	colibactin non-ribosomal peptide synthetase ClbN	NA	A0A2K9KZV5	Tupanvirus	22.8	4.3e-37
WP_000217768.1|3011254_3012694_-	precolibactin export MATE transporter ClbM	NA	NA	NA	NA	NA
WP_001297937.1|3012755_3014219_-	colibactin biosynthesis amidase ClbL	NA	NA	NA	NA	NA
WP_000222467.1|3014211_3020676_-	colibactin hybrid non-ribosomal peptide synthetase/type I polyketide synthase ClbK	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-43
WP_096972676.1|3020686_3027187_-	colibactin non-ribosomal peptide synthetase ClbJ	NA	A0A2K9KZV5	Tupanvirus	23.4	4.3e-102
WP_000829570.1|3027230_3030263_-	colibactin polyketide synthase ClbI	NA	D0R7J2	Paenibacillus_phage	37.9	4.0e-50
WP_001304254.1|3030312_3035109_-	colibactin non-ribosomal peptide synthetase ClbH	NA	A0A2K9L3I8	Tupanvirus	28.7	3.0e-44
>prophage 221
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3041353	3050974	5329017		Tupanvirus(100.0%)	1	NA	NA
WP_001518711.1|3041353_3050974_-	colibactin hybrid non-ribosomal peptide synthetase/type I polyketide synthase ClbB	NA	A0A2K9KZV5	Tupanvirus	23.8	5.0e-46
>prophage 222
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3061978	3063831	5329017		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502870.1|3061978_3062623_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
WP_001362826.1|3062607_3063831_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	1.5e-61
>prophage 223
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3078183	3079412	5329017	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_102384962.1|3078183_3079412_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
>prophage 224
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3083188	3084990	5329017	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_001297947.1|3083188_3083968_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_000255956.1|3083967_3084990_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
>prophage 225
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3088500	3089268	5329017		Bacillus_virus(100.0%)	1	NA	NA
WP_000016205.1|3088500_3089268_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	1.7e-13
>prophage 226
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3100400	3102740	5329017		Yersinia_phage(33.33%)	4	NA	NA
WP_001234571.1|3100400_3101222_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.1	7.5e-44
WP_001537423.1|3101484_3101958_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	9.7e-12
WP_021531870.1|3101973_3102450_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|3102518_3102740_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 227
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3107081	3108248	5329017		Stx2-converting_phage(100.0%)	1	NA	NA
WP_033548239.1|3107081_3108248_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	1.0e-227
>prophage 228
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3114445	3115345	5329017		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|3114445_3115345_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 229
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3121718	3127757	5329017	transposase	Saccharomonospora_phage(33.33%)	5	NA	NA
WP_000526115.1|3121718_3122177_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
WP_000547185.1|3122317_3123646_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_033548249.1|3123813_3124791_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_000704860.1|3124937_3126104_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
WP_000043506.1|3126350_3127757_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
>prophage 230
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3134648	3140966	5329017		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001100795.1|3134648_3135206_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.6	1.6e-50
WP_000857501.1|3135213_3136089_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001023638.1|3136146_3137046_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_001557078.1|3137045_3138131_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.3e-101
WP_000183053.1|3138503_3139397_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
WP_033548385.1|3139571_3140966_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.7e-19
>prophage 231
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3147064	3153849	5329017		Bacillus_phage(25.0%)	6	NA	NA
WP_052895686.1|3147064_3148435_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.9e-32
WP_001543324.1|3148627_3150064_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.0	3.7e-46
WP_096972641.1|3150066_3151281_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_032171531.1|3151277_3151757_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043606.1|3151759_3152725_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_000048190.1|3152727_3153849_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 232
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3158093	3168314	5329017		Catovirus(20.0%)	9	NA	NA
WP_001538930.1|3158093_3158933_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A1V0S9B9	Catovirus	28.3	4.1e-05
WP_169062283.1|3159061_3161224_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	28.8	1.9e-17
WP_000482901.1|3161226_3161670_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978098.1|3161675_3162815_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_162829205.1|3163123_3163273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000454700.1|3163473_3165057_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001538933.1|3165124_3166978_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234777.1|3166999_3167581_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001538935.1|3167672_3168314_-	uridine kinase	NA	A0A2K9L178	Tupanvirus	41.8	7.1e-34
>prophage 233
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3173040	3174393	5329017		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001538937.1|3173040_3174393_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	9.2e-07
>prophage 234
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3187488	3193591	5329017	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_000675178.1|3187488_3188892_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_001538945.1|3188888_3189611_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	1.4e-30
WP_001300972.1|3189790_3190123_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476012.1|3190269_3191631_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	2.5e-217
WP_001361579.1|3191959_3192277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001538947.1|3192691_3193591_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.7	7.5e-13
>prophage 235
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3204169	3207726	5329017		Serratia_phage(50.0%)	4	NA	NA
WP_001538954.1|3204169_3205174_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.4e-14
WP_000011944.1|3205170_3206136_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434049.1|3206109_3206856_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001538956.1|3206907_3207726_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	7.2e-23
>prophage 236
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3218375	3220409	5329017	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001538964.1|3218375_3220409_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.2	6.8e-54
>prophage 237
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3232415	3241860	5329017		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001538973.1|3232415_3233552_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
WP_001538974.1|3233548_3235552_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|3235676_3236138_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|3236178_3236649_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3236695_3237415_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001538977.1|3237411_3239097_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	1.6e-303
WP_001240405.1|3239318_3240050_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001216963.1|3240109_3240217_+	protein YohO	NA	NA	NA	NA	NA
WP_001538978.1|3240197_3240929_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001538980.1|3240933_3241860_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 238
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3262210	3263731	5329017		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255034.1|3262210_3263731_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 239
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3267425	3271211	5329017		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|3267425_3268094_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425463.1|3268351_3269188_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489277.1|3269219_3271211_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.6e-13
>prophage 240
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3275279	3276137	5329017		Catovirus(100.0%)	1	NA	NA
WP_001538989.1|3275279_3276137_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	6.9e-24
>prophage 241
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3289525	3293826	5329017		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001538996.1|3289525_3290992_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	2.3e-43
WP_000198798.1|3291109_3292096_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001296239.1|3292134_3292848_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|3293259_3293826_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 242
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3299580	3307229	5329017		Vibrio_phage(50.0%)	7	NA	NA
WP_000194894.1|3299580_3301170_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	1.9e-19
WP_000188242.1|3301173_3301518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213379.1|3301850_3303041_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
WP_001234850.1|3303068_3303764_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_001539001.1|3303913_3305674_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	2.2e-101
WP_000494186.1|3305798_3306083_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|3306221_3307229_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 243
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3317132	3317750	5329017		Bacillus_virus(100.0%)	1	NA	NA
WP_000888559.1|3317132_3317750_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 244
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3326508	3332310	5329017		Bacillus_phage(25.0%)	5	NA	NA
WP_000422211.1|3326508_3328152_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.2	7.2e-14
WP_001539014.1|3328227_3328878_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	8.3e-06
WP_001539016.1|3328877_3329942_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_115766315.1|3330015_3331071_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_001539019.1|3331182_3332310_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.9	3.2e-114
>prophage 245
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3336587	3341430	5329017		Hokovirus(50.0%)	2	NA	NA
WP_000876057.1|3336587_3339437_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.9e-41
WP_001296244.1|3339603_3341430_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	2.9e-19
>prophage 246
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3356353	3370272	5329017		Pseudomonas_phage(33.33%)	8	NA	NA
WP_001281253.1|3356353_3358981_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
WP_000990769.1|3359127_3359850_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_024187242.1|3359989_3363748_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	28.2	4.4e-22
WP_001539150.1|3364429_3366715_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
WP_000332036.1|3366904_3368035_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|3368034_3368289_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301034.1|3368342_3368993_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779092.1|3369195_3370272_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 247
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3376164	3380723	5329017	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_001539153.1|3376164_3377076_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.0	2.2e-68
WP_000150331.1|3377088_3377310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992976.1|3377350_3378154_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001297939.1|3378171_3379461_-	MFS transporter	NA	NA	NA	NA	NA
WP_001297916.1|3379517_3380723_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.5	2.5e-27
>prophage 248
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3384326	3389330	5329017		Tupanvirus(50.0%)	4	NA	NA
WP_000879110.1|3384326_3384929_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	7.5e-09
WP_011076488.1|3385236_3386376_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.5	7.2e-29
WP_000461633.1|3386379_3387348_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.2e-35
WP_001539159.1|3387347_3389330_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	3.1e-19
>prophage 249
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3422645	3425873	5329017		Salmonella_phage(50.0%)	3	NA	NA
WP_000813854.1|3422645_3423245_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|3423303_3425136_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203415.1|3425222_3425873_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	3.6e-09
>prophage 250
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3436432	3438292	5329017		Sodalis_phage(50.0%)	2	NA	NA
WP_000156131.1|3436432_3437323_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	53.1	4.0e-67
WP_001293612.1|3437518_3438292_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 251
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3442503	3444021	5329017		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|3442503_3444021_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 252
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3450770	3451907	5329017		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699143.1|3450770_3451907_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	1.3e-22
>prophage 253
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3460443	3461529	5329017		Pandoravirus(100.0%)	1	NA	NA
WP_001374741.1|3460443_3461529_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.5	7.7e-89
>prophage 254
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3477984	3478917	5329017		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001539260.1|3477984_3478917_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	98.7	3.9e-166
>prophage 255
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3481955	3483389	5329017		Bacillus_phage(100.0%)	1	NA	NA
WP_000194520.1|3481955_3483389_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	24.4	1.5e-28
>prophage 256
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3490029	3497606	5329017		Bacillus_phage(50.0%)	4	NA	NA
WP_001305203.1|3490029_3493623_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
WP_001296273.1|3493678_3494824_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|3494897_3495842_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283506.1|3495911_3497606_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	8.0e-24
>prophage 257
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3501295	3502216	5329017		Morganella_phage(100.0%)	1	NA	NA
WP_000484022.1|3501295_3502216_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	2.2e-76
>prophage 258
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3506033	3506768	5329017		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|3506033_3506768_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 259
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3532305	3554033	5329017		Streptococcus_phage(25.0%)	22	NA	NA
WP_001539287.1|3532305_3534321_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.0e-150
WP_001539289.1|3534391_3535390_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|3535619_3536381_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|3536565_3537537_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|3537920_3538178_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|3538222_3539950_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|3539990_3540500_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096640.1|3540542_3541394_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719965.1|3541498_3541867_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001539293.1|3541869_3542781_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000021034.1|3542915_3544013_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_115766390.1|3544002_3544878_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458408.1|3544877_3545711_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290263.1|3545710_3546727_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517443.1|3546884_3547676_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_001539296.1|3547955_3548852_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_001040459.1|3548855_3550280_+	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000084590.1|3550457_3551357_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838948.1|3551452_3552028_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001539298.1|3552088_3552538_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|3552524_3552950_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102910.1|3553163_3554033_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
>prophage 260
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3572948	3573899	5329017		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|3572948_3573899_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 261
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3588079	3656285	5329017	protease,tail,tRNA,terminase,integrase,holin	Escherichia_phage(57.38%)	77	3630219:3630236	3661678:3661695
WP_001539318.1|3588079_3590095_-|tRNA	tRNA cytosine(34) acetyltransferase TmcA	tRNA	NA	NA	NA	NA
WP_001267498.1|3590109_3590973_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_001295467.1|3591140_3591854_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
WP_001539320.1|3592066_3593101_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_001295469.1|3593117_3593996_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000176187.1|3594141_3594714_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_001068682.1|3594713_3595184_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_000892033.1|3595282_3596344_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000489658.1|3596556_3598020_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_001539322.1|3598040_3598400_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_000247065.1|3598537_3599284_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_000198327.1|3599333_3600623_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
WP_001295473.1|3600708_3601335_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001296287.1|3601659_3602697_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.8e-71
WP_001028626.1|3602696_3603335_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001467886.1|3603506_3605573_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_001121350.1|3605577_3607119_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_000772715.1|3607157_3609401_-	cyclic-guanylate-specific phosphodiesterase PdeF	NA	NA	NA	NA	NA
WP_000017558.1|3609582_3609735_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	92.0	1.9e-17
WP_000076001.1|3609752_3609944_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001311989.1|3610254_3610773_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000755178.1|3610788_3611328_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000637727.1|3611522_3612020_-	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	66.5	1.0e-48
WP_032153852.1|3612016_3612646_-	glycoside hydrolase family 19 protein	NA	A0A0F6R8M1	Escherichia_coli_O157_typing_phage	97.6	1.7e-112
WP_016245479.1|3612635_3612944_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	94.1	4.6e-47
WP_000009883.1|3612930_3613335_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	95.5	3.9e-62
WP_032153853.1|3613407_3615870_-|tail	tail fiber domain-containing protein	tail	O09496	Escherichia_virus	48.8	3.3e-164
WP_016245482.1|3616066_3616324_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	97.6	6.3e-42
WP_000993735.1|3616641_3617298_+	phage antirepressor Ant	NA	A0A1U9AJ93	Stx1_converting_phage	52.2	4.3e-50
WP_000708858.1|3617369_3617531_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_001260052.1|3617629_3618262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097717300.1|3618408_3619359_-	phage antirepressor N-terminal domain-containing protein	NA	G9L6D8	Escherichia_phage	78.2	5.1e-137
WP_001167931.1|3619430_3619598_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	100.0	2.3e-24
WP_097717299.1|3619718_3620150_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	99.1	2.1e-58
WP_169062287.1|3620244_3620808_+	hypothetical protein	NA	G9L6D5	Escherichia_phage	95.7	1.9e-94
WP_160371709.1|3620819_3623834_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	98.1	0.0e+00
WP_169062288.1|3623833_3626551_-	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	98.9	0.0e+00
WP_001555169.1|3626550_3627117_-	hypothetical protein	NA	A0A193GYJ4	Enterobacter_phage	81.5	1.5e-59
WP_000568023.1|3627116_3627581_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
WP_022645084.1|3627580_3630052_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.3	0.0e+00
WP_000179264.1|3630051_3630657_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	6.2e-112
3630219:3630236	attL	GCCAGGCCAACGCCTCCA	NA	NA	NA	NA
WP_000424495.1|3630656_3630980_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_032153857.1|3631030_3631366_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	5.0e-55
WP_032153858.1|3631376_3631814_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	95.2	5.0e-71
WP_169062289.1|3631865_3632852_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.7	2.5e-187
WP_001048082.1|3632866_3633562_-	peptidase	NA	G9L6C4	Escherichia_phage	98.7	4.3e-93
WP_000133160.1|3633564_3633861_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_000852415.1|3633857_3635537_-|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.1	3.1e-302
WP_000335900.1|3635551_3635758_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	80.9	1.0e-10
WP_000999689.1|3636460_3636817_+	hypothetical protein	NA	Q716B1	Shigella_phage	75.4	2.7e-43
WP_000132533.1|3636907_3638383_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	99.8	1.2e-297
WP_169062290.1|3638379_3639054_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	3.4e-119
WP_001129693.1|3639094_3639433_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	99.1	8.3e-58
WP_000969524.1|3639705_3639966_-	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	98.8	1.9e-41
WP_169062291.1|3639962_3641150_-	DUF551 domain-containing protein	NA	Q1MVF7	Enterobacteria_phage	72.1	4.3e-93
WP_032313438.1|3641146_3641356_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	95.7	4.7e-35
WP_001289986.1|3641356_3641716_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	73.5	1.7e-37
WP_000753053.1|3641712_3641889_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_169062292.1|3641881_3642064_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	93.3	5.0e-25
WP_169062293.1|3642159_3642870_-	ead/Ea22-like family protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	63.5	2.0e-61
WP_001231251.1|3642931_3643276_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	4.1e-60
WP_000843279.1|3643393_3644170_-	hypothetical protein	NA	G9L6A9	Escherichia_phage	100.0	4.6e-152
WP_000168729.1|3644141_3644972_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	97.1	1.1e-154
WP_001282459.1|3645313_3645544_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836290.1|3645698_3646283_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001198620.1|3646436_3646589_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	100.0	5.4e-25
WP_001102251.1|3646591_3646891_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	97.0	4.9e-46
WP_032153871.1|3646887_3647709_+	exodeoxyribonuclease VIII	NA	A0A2R9YJH7	Escherichia_phage	98.5	5.2e-162
WP_001617197.1|3647705_3648647_+	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	99.7	1.0e-177
WP_000675390.1|3648696_3648945_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_021519080.1|3649054_3649354_+	PerC family transcriptional regulator	NA	A0A2R9YJK3	Escherichia_phage	96.0	8.1e-49
WP_001617199.1|3649346_3649997_+	hypothetical protein	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	97.2	3.4e-124
WP_001617200.1|3649993_3650188_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	95.3	1.4e-25
WP_001617201.1|3650191_3651442_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	8.0e-239
WP_000138282.1|3651634_3653212_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001296289.1|3653280_3654747_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_001539338.1|3654908_3656285_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.0e-41
3661678:3661695	attR	TGGAGGCGTTGGCCTGGC	NA	NA	NA	NA
>prophage 262
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3678203	3678635	5329017		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963841.1|3678203_3678635_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 263
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3688521	3694859	5329017		Mycoplasma_phage(20.0%)	8	NA	NA
WP_001539348.1|3688521_3689805_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	4.9e-34
WP_000523612.1|3689863_3690064_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124471.1|3690075_3690411_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196608.1|3690412_3692263_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|3692279_3692795_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|3692890_3693214_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|3693230_3693617_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|3693644_3694859_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 264
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3704977	3706489	5329017		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493464.1|3704977_3706489_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 265
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3712247	3723556	5329017		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|3712247_3713501_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883120.1|3713829_3715020_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|3715064_3715403_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001539367.1|3715463_3716798_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215879.1|3716787_3717501_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001297612.1|3717665_3719093_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_096972715.1|3719668_3723556_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	2.2e-130
>prophage 266
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3727675	3727936	5329017		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196285.1|3727675_3727936_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 267
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3731395	3735137	5329017		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|3731395_3732076_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|3732347_3733322_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790169.1|3733337_3735137_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 268
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3740908	3746991	5329017	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219206.1|3740908_3742243_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001298616.1|3742275_3743157_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189208.1|3743259_3743847_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3743902_3744286_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001539375.1|3744590_3745280_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.3	9.3e-56
WP_000997418.1|3745327_3746365_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3746571_3746991_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 269
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3762066	3764640	5329017		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001539382.1|3762066_3764640_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	3.4e-127
>prophage 270
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3771984	3773055	5329017		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|3771984_3773055_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 271
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3786688	3787171	5329017		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|3786688_3787171_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 272
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3792179	3796230	5329017		Klosneuvirus(50.0%)	4	NA	NA
WP_001539400.1|3792179_3793460_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	8.4e-34
WP_001298180.1|3793696_3795097_+	GABA permease	NA	NA	NA	NA	NA
WP_001357560.1|3795117_3795780_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_169062294.1|3795780_3796230_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	38.2	2.6e-06
>prophage 273
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3802224	3807522	5329017		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|3802224_3802470_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|3802466_3802877_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001539410.1|3802849_3804994_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	1.6e-194
WP_000777941.1|3805003_3805963_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	9.1e-134
WP_000985490.1|3806319_3807522_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 274
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3815844	3816303	5329017	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_000526115.1|3815844_3816303_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
>prophage 275
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3820914	3826301	5329017	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|3820914_3821100_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047170.1|3821334_3823965_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|3824093_3824594_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|3824662_3825724_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132236.1|3825803_3826301_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	2.6e-31
>prophage 276
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3831769	3832735	5329017		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287404.1|3831769_3832735_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	2.3e-36
>prophage 277
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3840306	3841317	5329017		Enterobacteria_phage(100.0%)	1	NA	NA
WP_024186854.1|3840306_3841317_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.0	5.1e-26
>prophage 278
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3860837	3867977	5329017		Escherichia_phage(83.33%)	6	NA	NA
WP_001539446.1|3860837_3863399_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	6.0e-31
WP_001141302.1|3863504_3864161_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001298167.1|3864211_3864979_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_000847997.1|3865174_3866083_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001539448.1|3866079_3867342_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279001.1|3867338_3867977_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
>prophage 279
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3872350	3876066	5329017		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|3872350_3873343_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3873405_3874545_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254701.1|3874684_3875311_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3875304_3876066_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 280
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3879177	3881210	5329017		Tupanvirus(50.0%)	2	NA	NA
WP_001173653.1|3879177_3879783_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
WP_001090361.1|3879782_3881210_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 281
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3895859	3896645	5329017		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021342.1|3895859_3896645_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.5e-21
>prophage 282
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3903945	3907144	5329017		Bacillus_phage(50.0%)	3	NA	NA
WP_001334220.1|3903945_3905355_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	22.7	7.3e-15
WP_001232702.1|3905380_3906388_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001199974.1|3906472_3907144_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
>prophage 283
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3910941	3913965	5329017		Streptococcus_phage(50.0%)	2	NA	NA
WP_000036723.1|3910941_3912240_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|3912327_3913965_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 284
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3917998	3922113	5329017		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_169062297.1|3917998_3919300_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.2	2.6e-38
WP_000186448.1|3919356_3922113_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 285
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3929645	3930494	5329017		Vibrio_phage(100.0%)	1	NA	NA
WP_000100429.1|3929645_3930494_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.7e-41
>prophage 286
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3935352	3936108	5329017		Bacillus_phage(100.0%)	1	NA	NA
WP_001296330.1|3935352_3936108_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
>prophage 287
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3947683	3950189	5329017	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_001490456.1|3947683_3948889_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	2.7e-74
WP_000184273.1|3948888_3949332_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117711.1|3949382_3950189_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	1.4e-15
>prophage 288
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3959019	3968531	5329017		uncultured_Caudovirales_phage(66.67%)	5	NA	NA
WP_001539489.1|3959019_3961653_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.4	6.4e-97
WP_001556813.1|3961664_3964175_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.8	6.7e-19
WP_001539493.1|3964167_3964908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001539494.1|3964951_3965758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016238851.1|3966014_3968531_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.3	5.1e-19
>prophage 289
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	3984606	4001221	5329017		Bacillus_phage(28.57%)	10	NA	NA
WP_001350145.1|3984606_3985554_-	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.6	1.5e-16
WP_001066226.1|3985625_3986222_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.5	1.8e-23
WP_000382417.1|3986224_3987400_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_000810554.1|3987399_3988980_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	2.0e-05
WP_000582830.1|3989011_3989836_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000016907.1|3990093_3991347_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|3991578_3992910_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_001539515.1|3992971_3994798_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.3	7.8e-25
WP_001539517.1|3994797_3998340_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	2.6e-08
WP_001138105.1|3998332_4001221_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	1.5e-67
>prophage 290
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4006698	4013471	5329017		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|4006698_4007493_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|4007499_4008375_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957911.1|4008525_4010772_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|4010784_4011315_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082183.1|4011999_4012689_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_001539524.1|4012757_4013471_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.7	1.5e-45
>prophage 291
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4023102	4025597	5329017		Aichi_virus(50.0%)	2	NA	NA
WP_001539529.1|4023102_4024521_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	3.0e-24
WP_000603518.1|4024835_4025597_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 292
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4029882	4030638	5329017		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|4029882_4030638_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 293
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4054917	4070309	5329017	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|4054917_4056318_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001539542.1|4056335_4057652_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012167.1|4057687_4059055_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	9.5e-161
WP_001539543.1|4059090_4059579_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_169062298.1|4059578_4061498_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001539546.1|4061933_4063382_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	27.0	1.9e-26
WP_001539548.1|4063383_4063509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|4063505_4063577_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192796.1|4063631_4064180_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|4064222_4065740_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|4065749_4066848_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813189.1|4066938_4068672_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	8.3e-61
WP_000715230.1|4068677_4069388_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|4069412_4070309_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 294
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4074114	4078587	5329017		Pandoravirus(50.0%)	2	NA	NA
WP_001339296.1|4074114_4075548_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	2.0e-31
WP_000195072.1|4075713_4078587_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	8.2e-263
>prophage 295
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4086723	4087956	5329017		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|4086723_4087956_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 296
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4101450	4102128	5329017		Bacillus_virus(100.0%)	1	NA	NA
WP_000956878.1|4101450_4102128_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	9.9e-10
>prophage 297
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4107179	4160652	5329017	protease,integrase,tRNA,transposase	Staphylococcus_phage(33.33%)	45	4111446:4111463	4160049:4160066
WP_000646942.1|4107179_4108088_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	4.4e-53
WP_000098601.1|4108307_4110299_-	transketolase	NA	NA	NA	NA	NA
WP_001298254.1|4110576_4111335_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|4111425_4112346_-	agmatinase	NA	NA	NA	NA	NA
4111446:4111463	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758891.1|4112481_4113213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|4113358_4115335_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|4115343_4115475_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|4115610_4115826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|4116129_4117284_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001305311.1|4117720_4119115_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|4119191_4119689_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001305312.1|4119783_4120491_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|4120570_4121302_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593255.1|4121314_4122265_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|4122373_4122937_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017107.1|4122936_4123353_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001305314.1|4123526_4124507_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997805.1|4124524_4125229_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094838.1|4125246_4125813_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|4125809_4126100_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174738.1|4126107_4126701_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239983.1|4126693_4127830_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745234.1|4127894_4128902_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394107.1|4129018_4130065_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|4130240_4130960_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107567.1|4131143_4131470_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786915.1|4131469_4132189_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001305316.1|4132349_4133402_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|4133429_4133705_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|4133769_4134849_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001296363.1|4135050_4136307_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_001305317.1|4136355_4138491_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|4138883_4139591_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|4139969_4141235_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_122996797.1|4141490_4142534_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_103103190.1|4143431_4144659_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.2e-170
WP_000074472.1|4144772_4145966_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|4146101_4147826_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|4147826_4148774_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|4148773_4150516_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|4150512_4151790_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_096972777.1|4151871_4154073_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_011076574.1|4154623_4154767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034083.1|4155016_4158904_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_001254932.1|4159500_4160652_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
4160049:4160066	attR	CCTGAATATACAGCATCT	NA	NA	NA	NA
>prophage 298
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4167414	4221767	5329017	capsid,tail,integrase,plate,transposase	Burkholderia_virus(40.91%)	67	4185918:4185934	4229448:4229464
WP_001223344.1|4167414_4169505_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_106378881.1|4170004_4171233_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.7	1.9e-168
WP_000274668.1|4171384_4172371_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_001282578.1|4172470_4173205_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_001030790.1|4173240_4174164_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000865295.1|4174225_4175335_-	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001296386.1|4175347_4176058_-	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_096972781.1|4176103_4176934_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000376547.1|4176937_4178410_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_096972782.1|4178458_4179334_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_001149834.1|4179367_4180285_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_085949591.1|4180436_4180574_+|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_000435655.1|4180945_4181371_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_000624646.1|4181367_4181718_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_016245515.1|4182845_4184384_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.3	2.9e-283
WP_000271011.1|4184604_4184988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000904922.1|4185227_4185800_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_001529038.1|4185871_4186345_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	52.4	8.1e-35
4185918:4185934	attL	CCACCGCCACACCGCCA	NA	NA	NA	NA
WP_000072166.1|4186351_4186966_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_077817324.1|4186965_4188597_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.4	1.0e-39
WP_000138756.1|4188599_4189178_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001529034.1|4189170_4190274_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	55.0	1.4e-106
WP_000859111.1|4190264_4190612_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001404342.1|4190666_4191263_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.7	3.2e-36
WP_000808006.1|4191259_4192414_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	3.2e-85
WP_012602373.1|4192401_4192617_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_001555962.1|4192613_4193498_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	45.7	4.9e-49
WP_001555963.1|4193497_4196383_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.1	1.7e-79
WP_001202894.1|4196458_4196617_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|4196540_4196876_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001513983.1|4196973_4197255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162828734.1|4197257_4197782_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.2	4.7e-68
WP_001555964.1|4197778_4199206_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	76.1	1.0e-213
WP_032143024.1|4199195_4199450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001555966.1|4199446_4199911_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	3.1e-39
WP_001555967.1|4199910_4200357_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	51.7	5.0e-34
WP_000537457.1|4200358_4200697_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|4200706_4201660_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|4201674_4202790_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001555969.1|4203004_4203463_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.2	9.9e-30
WP_001555971.1|4203465_4204287_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.2	1.5e-97
WP_000090676.1|4204267_4205761_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.9	3.9e-168
WP_032143027.1|4205760_4207293_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	63.2	7.3e-186
WP_000124060.1|4207352_4207898_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000227701.1|4207897_4208209_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175097.1|4208208_4208535_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000264662.1|4208531_4209182_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.2	1.1e-08
WP_060682029.1|4209165_4209894_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.4	9.2e-62
WP_000838563.1|4209896_4210247_-	membrane protein	NA	A4JWP3	Burkholderia_virus	52.2	9.9e-22
WP_001297461.1|4210612_4211188_-	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_000522931.1|4211597_4212209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031885.1|4212229_4213216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001259267.1|4213212_4213674_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000200154.1|4213724_4213913_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	7.9e-18
WP_000049026.1|4213965_4214274_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	54.9	2.1e-23
WP_001405162.1|4214284_4215196_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	54.0	1.6e-71
WP_000990528.1|4215199_4216969_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.5	4.0e-228
WP_000960676.1|4216979_4218146_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.9	3.3e-122
WP_001555976.1|4218148_4218418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001405163.1|4218445_4218976_+	bacteriophage Mu Gam like family protein	NA	L7P7T1	Pseudomonas_phage	67.9	8.2e-60
WP_000632572.1|4219264_4219537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000197789.1|4219546_4219852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001555977.1|4219848_4220532_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
WP_001555979.1|4220528_4220756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001555981.1|4220748_4220964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972907.1|4220953_4221406_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	4.7e-24
WP_001281694.1|4221377_4221767_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	5.8e-31
4229448:4229464	attR	TGGCGGTGTGGCGGTGG	NA	NA	NA	NA
>prophage 299
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4234637	4237435	5329017		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001234620.1|4234637_4235456_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_000849565.1|4235510_4235996_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001186726.1|4236011_4236488_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692329.1|4236550_4236772_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_000094916.1|4236790_4237435_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.6	1.2e-25
>prophage 300
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4242735	4243719	5329017		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001296394.1|4242735_4243719_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	6.2e-37
>prophage 301
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4250955	4252134	5329017		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_001305084.1|4250955_4252134_-	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.6	2.1e-108
>prophage 302
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4292147	4293320	5329017		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524942.1|4292147_4293320_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 303
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4315495	4316380	5329017		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|4315495_4316380_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 304
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4322223	4329542	5329017		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000013152.1|4322223_4323051_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.6e-62
WP_001539712.1|4323250_4324177_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|4324227_4324485_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_001539714.1|4324526_4326746_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.0	3.0e-103
WP_000438650.1|4326997_4327747_+	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_001539716.1|4328069_4329542_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	33.0	2.6e-47
>prophage 305
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4337777	4342817	5329017		Bacillus_virus(50.0%)	4	NA	NA
WP_001539719.1|4337777_4340036_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	1.1e-84
WP_001296417.1|4340173_4341781_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000183491.1|4341889_4342372_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_000712658.1|4342424_4342817_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 306
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4350660	4352450	5329017		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000986428.1|4350660_4351644_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	1.4e-09
WP_000940874.1|4351640_4352450_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	2.7e-14
>prophage 307
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4363358	4371436	5329017		Bacillus_virus(25.0%)	8	NA	NA
WP_000195274.1|4363358_4365251_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.2	2.6e-92
WP_000105733.1|4365279_4365861_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444751.1|4365860_4366688_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|4366712_4367135_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|4367135_4367765_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735289.1|4367969_4369451_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|4369598_4370270_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_001539737.1|4370275_4371436_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	4.5e-87
>prophage 308
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4377328	4377982	5329017		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076989.1|4377328_4377982_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 309
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4381895	4383329	5329017		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869177.1|4381895_4383329_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 310
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4388466	4389705	5329017	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708511.1|4388466_4389705_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 311
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4396113	4412260	5329017	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001539750.1|4396113_4397127_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|4397364_4397580_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918828.1|4397689_4399435_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437380.1|4399629_4401471_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|4401548_4402055_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001539754.1|4402308_4403073_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018005.1|4403360_4403984_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_001539756.1|4404090_4405611_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	4.0e-35
WP_001297164.1|4406028_4407408_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_000450588.1|4407449_4407782_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212447.1|4408000_4408984_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001539761.1|4409167_4412260_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	1.0e-157
>prophage 312
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4424714	4425680	5329017		Escherichia_phage(100.0%)	1	NA	NA
WP_001098826.1|4424714_4425680_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 313
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4450860	4453155	5329017		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861710.1|4450860_4453155_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	3.9e-159
>prophage 314
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4459300	4460446	5329017		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296434.1|4459300_4460446_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.7e-50
>prophage 315
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4478066	4485862	5329017		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809263.1|4478066_4478930_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_001533640.1|4478994_4481031_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246829.1|4480988_4481384_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|4481403_4481994_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|4482003_4482579_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001539812.1|4482691_4483732_-	permease	NA	NA	NA	NA	NA
WP_000084526.1|4483804_4484440_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_001346703.1|4484567_4485086_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449450.1|4485065_4485509_-	YhbP family protein	NA	NA	NA	NA	NA
WP_001539814.1|4485559_4485862_+	DNA damage response exodeoxyribonuclease YhbQ	NA	A0A068LKN9	Peridroma_alphabaculovirus	55.4	2.3e-14
>prophage 316
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4491564	4493454	5329017		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|4491564_4493454_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 317
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4498935	4505574	5329017		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133040.1|4498935_4501608_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
WP_001031057.1|4501632_4503120_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|4503147_4503600_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|4504230_4505574_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 318
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4509654	4512527	5329017	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|4509654_4510503_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|4510592_4512527_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 319
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4519156	4520639	5329017		Indivirus(50.0%)	2	NA	NA
WP_001047338.1|4519156_4520128_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|4520360_4520639_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 320
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4524707	4539502	5329017		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001539830.1|4524707_4525517_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.8e-19
WP_000922880.1|4525726_4526704_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|4526717_4527704_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030015.1|4527724_4528291_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.0	4.2e-54
WP_001539833.1|4528287_4528863_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|4528831_4529389_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|4529395_4530121_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|4530168_4531602_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|4531624_4531912_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183674.1|4532029_4532521_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|4532566_4533421_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|4533417_4533690_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_001539838.1|4533903_4534536_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047069.1|4534532_4535261_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000719791.1|4535257_4535911_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809780.1|4536140_4538477_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001296449.1|4538572_4539502_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 321
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4548205	4552216	5329017	protease	Burkholderia_virus(50.0%)	4	NA	NA
WP_000108474.1|4548205_4549696_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
WP_000224714.1|4549804_4550698_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000074795.1|4550819_4551611_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000366127.1|4551718_4552216_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 322
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4556182	4557550	5329017	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_021528329.1|4556182_4557550_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.7e-21
>prophage 323
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4575201	4576245	5329017		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|4575201_4576245_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 324
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4585532	4590045	5329017		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001539864.1|4585532_4587032_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	5.8e-18
WP_001298583.1|4587092_4587983_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000275540.1|4588018_4588873_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_000843962.1|4589214_4590045_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
>prophage 325
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4595382	4596267	5329017		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001539870.1|4595382_4596267_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	9.2e-24
>prophage 326
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4602771	4606925	5329017		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738579.1|4602771_4603797_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_001539874.1|4603864_4605046_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001539875.1|4605055_4606159_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078342.1|4606166_4606925_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 327
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4617261	4618733	5329017	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|4617261_4617771_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004421.1|4617785_4618733_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 328
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4639957	4641910	5329017		Vibrio_phage(100.0%)	1	NA	NA
WP_001525807.1|4639957_4641910_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	1.2e-31
>prophage 329
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4650718	4659285	5329017		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_000773146.1|4650718_4653421_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	35.7	2.0e-40
WP_103488328.1|4653712_4654897_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|4654967_4657082_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|4657178_4657649_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|4657745_4658120_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903382.1|4658245_4658533_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820731.1|4658539_4658899_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209693.1|4658898_4659285_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	2.5e-18
>prophage 330
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4664855	4674407	5329017		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|4664855_4666769_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057389.1|4666768_4667791_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|4667784_4668003_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274684.1|4668056_4668926_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|4668980_4669385_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|4669686_4670319_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001298205.1|4670369_4672460_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
WP_000963803.1|4672537_4673758_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601853.1|4673843_4674407_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.1e-62
>prophage 331
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4693314	4694151	5329017		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|4693314_4694151_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 332
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4711056	4714824	5329017		Bacillus_phage(66.67%)	3	NA	NA
WP_001309803.1|4711056_4712679_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.5e-141
WP_001253707.1|4712755_4714108_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	4.7e-11
WP_001157751.1|4714104_4714824_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 333
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4721405	4722299	5329017		Sodalis_phage(100.0%)	1	NA	NA
WP_000039098.1|4721405_4722299_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	2.5e-69
>prophage 334
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4728528	4730922	5329017		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081882.1|4728528_4730922_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 335
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4735312	4736539	5329017		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105471.1|4735312_4736539_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	2.0e-133
>prophage 336
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4751943	4754391	5329017		Dickeya_phage(100.0%)	1	NA	NA
WP_001539973.1|4751943_4754391_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 337
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4764720	4766817	5329017		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_001539976.1|4764720_4766817_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	33.8	1.0e-41
>prophage 338
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4777692	4779503	5329017		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073603.1|4777692_4778436_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	4.4e-11
WP_000907827.1|4778432_4779503_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 339
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4783044	4784527	5329017		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|4783044_4783758_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|4783759_4784527_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 340
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4790250	4793069	5329017		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|4790250_4791105_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|4791349_4792408_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_001539990.1|4792400_4793069_-	cell division ATP-binding protein FtsE	NA	G3M9Y6	Bacillus_virus	27.0	1.2e-18
>prophage 341
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4796075	4800374	5329017		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|4796075_4796702_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106596.1|4796775_4798974_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	1.3e-119
WP_000130621.1|4799242_4799488_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100463.1|4799708_4800374_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	7.4e-58
>prophage 342
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4808267	4813349	5329017		Bacillus_virus(50.0%)	4	NA	NA
WP_000173679.1|4808267_4809074_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	3.4e-17
WP_001190062.1|4809079_4809481_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_001314210.1|4809489_4810614_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000149094.1|4810613_4813349_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 343
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4823035	4828444	5329017		Indivirus(50.0%)	5	NA	NA
WP_001312164.1|4823035_4825078_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	4.0e-46
WP_000954225.1|4825280_4826123_+	23S rRNA (adenine(2030)-N(6))-methyltransferase	NA	NA	NA	NA	NA
WP_000160795.1|4826194_4827547_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_001295215.1|4827600_4827684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539997.1|4828018_4828444_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	4.7e-50
>prophage 344
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4839092	4840562	5329017		Pithovirus(50.0%)	2	NA	NA
WP_000622316.1|4839092_4839863_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	2.3e-18
WP_000123131.1|4839914_4840562_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
>prophage 345
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4886501	4888486	5329017		Bacillus_virus(50.0%)	2	NA	NA
WP_000103577.1|4886501_4887506_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.5e-17
WP_001540025.1|4887502_4888486_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
>prophage 346
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4904272	4906606	5329017		Escherichia_phage(100.0%)	1	NA	NA
WP_001540040.1|4904272_4906606_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	2.4e-71
>prophage 347
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4910260	4910473	5329017		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|4910260_4910473_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 348
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4914694	4915690	5329017		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182634.1|4914694_4915690_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	2.0e-11
>prophage 349
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4921007	4922549	5329017		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146502.1|4921007_4922549_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 350
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4942123	4952659	5329017	tRNA	Clostridioides_phage(33.33%)	5	NA	NA
WP_000985736.1|4942123_4943419_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.8e-21
WP_000741493.1|4943548_4944700_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_001540055.1|4944890_4946735_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
WP_000206248.1|4946731_4948123_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_001540057.1|4948978_4952659_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	46.0	4.3e-309
>prophage 351
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4979263	4988769	5329017		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|4979263_4979515_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|4979655_4980087_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|4980331_4981876_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214152.1|4981885_4983169_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483831.1|4983172_4984132_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_096972653.1|4984118_4985153_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|4985391_4986417_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213845.1|4986426_4987623_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.3	4.9e-36
WP_000587750.1|4987836_4988769_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 352
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	4992177	4994271	5329017		Catovirus(50.0%)	2	NA	NA
WP_001540080.1|4992177_4993161_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	1.8e-12
WP_000364803.1|4993242_4994271_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	5.5e-12
>prophage 353
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5001709	5006272	5329017		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171873.1|5001709_5002189_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114542.1|5002227_5003037_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.2	5.9e-25
WP_001051798.1|5003134_5003302_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|5003322_5003559_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001540088.1|5003775_5004444_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000050148.1|5004615_5005836_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.7	3.2e-43
WP_000976070.1|5005813_5006272_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
>prophage 354
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5009646	5016397	5329017		Morganella_phage(33.33%)	5	NA	NA
WP_001297973.1|5009646_5010471_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.5	1.3e-91
WP_000924289.1|5010762_5011380_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001295237.1|5013316_5013940_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|5013994_5014270_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280473.1|5014288_5016397_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 355
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5020698	5022090	5329017		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|5020698_5022090_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 356
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5035351	5036389	5329017		Wolbachia_phage(100.0%)	1	NA	NA
WP_001280585.1|5035351_5036389_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	5.7e-73
>prophage 357
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5041829	5043164	5329017		Moraxella_phage(100.0%)	1	NA	NA
WP_001557145.1|5041829_5043164_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 358
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5050468	5062346	5329017		Micromonas_sp._RCC1109_virus(16.67%)	12	NA	NA
WP_000168476.1|5050468_5052157_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
WP_001312198.1|5052262_5052361_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_001332269.1|5052761_5053946_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	1.2e-13
WP_000148045.1|5053953_5054451_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|5054447_5054810_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|5054799_5055147_-	YidH family protein	NA	NA	NA	NA	NA
WP_096972651.1|5055206_5056649_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	27.7	2.3e-27
WP_169062306.1|5056696_5058412_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.2	2.1e-40
WP_001540119.1|5058578_5059445_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001279773.1|5059534_5061196_-	putative transporter	NA	NA	NA	NA	NA
WP_001243431.1|5061392_5061821_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|5061932_5062346_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 359
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5066773	5067922	5329017		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705012.1|5066773_5067922_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 360
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5072627	5079996	5329017		Bacillus_virus(33.33%)	8	NA	NA
WP_000072072.1|5072627_5075042_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|5075070_5076144_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|5076143_5077244_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|5077248_5078652_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122134670.1|5078948_5079029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|5079258_5079399_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|5079415_5079775_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|5079738_5079996_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 361
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5090194	5091532	5329017		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|5090194_5091532_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 362
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5101904	5109419	5329017		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|5101904_5102678_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001540141.1|5102768_5103659_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|5103658_5104618_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|5104704_5105745_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334086.1|5106058_5107888_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000933736.1|5108048_5109419_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 363
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5121373	5122366	5329017		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_001540168.1|5121373_5122366_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 364
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5125534	5131387	5329017		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102331.1|5125534_5127403_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	1.0e-64
WP_001346607.1|5127569_5127989_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387770.1|5127996_5129502_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|5129506_5130472_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|5130496_5131387_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 365
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5144777	5146424	5329017		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001540188.1|5144777_5146424_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	3.7e-66
>prophage 366
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5154020	5159434	5329017		Bacillus_phage(33.33%)	4	NA	NA
WP_001238868.1|5154020_5156042_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
WP_001314257.1|5156088_5157573_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|5157708_5158974_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|5159104_5159434_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 367
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5163476	5169620	5329017		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866670.1|5163476_5164607_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
WP_000006615.1|5164603_5165866_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.2	1.0e-23
WP_001540196.1|5165865_5166933_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.0e-101
WP_000676056.1|5166951_5167833_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001540197.1|5167810_5168485_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612054.1|5168489_5169620_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 368
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5177627	5179283	5329017		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395835.1|5177627_5179283_-	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.8e-44
>prophage 369
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5187400	5196007	5329017		Salmonella_phage(50.0%)	8	NA	NA
WP_001014271.1|5187400_5188729_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	47.4	8.8e-10
WP_001540206.1|5188725_5190195_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	55.4	1.3e-43
WP_000799889.1|5190383_5190587_+	lipoprotein	NA	NA	NA	NA	NA
WP_001160645.1|5190623_5191448_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000812795.1|5191444_5192152_+	DUF484 domain-containing protein	NA	NA	NA	NA	NA
WP_000130676.1|5192148_5193045_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|5193044_5193761_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_115766355.1|5193844_5196007_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	2.1e-117
>prophage 370
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5203366	5205196	5329017		Catovirus(100.0%)	1	NA	NA
WP_001442069.1|5203366_5205196_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	1.3e-83
>prophage 371
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5215656	5217165	5329017		Vibrio_phage(100.0%)	1	NA	NA
WP_000037970.1|5215656_5217165_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	6.2e-12
>prophage 372
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5239160	5242447	5329017		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187545.1|5239160_5240801_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|5240879_5241149_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459600.1|5241152_5241668_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109949.1|5241670_5242447_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 373
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5251317	5251932	5329017		Streptococcus_phage(100.0%)	1	NA	NA
WP_001335246.1|5251317_5251932_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.8	1.3e-19
>prophage 374
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5265622	5268409	5329017		uncultured_virus(100.0%)	1	NA	NA
WP_000249991.1|5265622_5268409_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	6.4e-71
>prophage 375
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5272530	5275001	5329017		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001315107.1|5272530_5273940_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_001540261.1|5273951_5275001_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	9.3e-07
>prophage 376
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5294414	5297194	5329017		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718898.1|5294414_5295311_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621622.1|5295478_5296375_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|5296408_5297194_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 377
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5305920	5308971	5329017		Escherichia_phage(100.0%)	1	NA	NA
WP_012602895.1|5305920_5308971_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 378
NZ_CP051688	Escherichia coli strain SCU-387 chromosome, complete genome	5329017	5319757	5328756	5329017	integrase	Yersinia_virus(30.0%)	13	5311985:5311997	5328748:5328760
5311985:5311997	attL	ATGGCATGAGTAT	NA	NA	NA	NA
WP_001298417.1|5319757_5320378_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	8.4e-64
WP_032146477.1|5320675_5321620_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001540294.1|5321768_5322443_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|5322614_5323988_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033719.1|5323984_5324683_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|5324832_5325333_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_000985242.1|5325519_5326500_-|integrase	site-specific integrase	integrase	Q858U3	Yersinia_virus	100.0	4.7e-186
WP_000777029.1|5326569_5326863_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001540298.1|5326999_5327272_+	hypothetical protein	NA	Q1JS42	Enterobacteria_phage	100.0	3.1e-47
WP_000217670.1|5327441_5327942_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001540300.1|5328005_5328230_+	DUF2732 family protein	NA	Q858T8	Yersinia_virus	100.0	6.1e-33
WP_001277891.1|5328229_5328529_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	100.0	8.4e-46
WP_001113261.1|5328531_5328756_+	TraR/DksA family transcriptional regulator	NA	Q858T6	Yersinia_virus	98.6	1.7e-35
5328748:5328760	attR	ATGGCATGAGTAT	NA	NA	NA	NA
>prophage 1
NZ_CP051689	Escherichia coli strain SCU-387 plasmid pSCU-387-1, complete sequence	139635	0	1961	139635	integrase	Macacine_betaherpesvirus(100.0%)	1	1106:1119	2201:2214
1106:1119	attL	ATCTGCCTGTTCCT	NA	NA	NA	NA
WP_021515439.1|1220_1961_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_021515439.1|1220_1961_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
2201:2214	attR	AGGAACAGGCAGAT	NA	NA	NA	NA
>prophage 2
NZ_CP051689	Escherichia coli strain SCU-387 plasmid pSCU-387-1, complete sequence	139635	5437	6666	139635	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_106378881.1|5437_6666_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.7	1.9e-168
>prophage 3
NZ_CP051689	Escherichia coli strain SCU-387 plasmid pSCU-387-1, complete sequence	139635	10626	11196	139635		Enterobacteria_phage(100.0%)	1	NA	NA
WP_028985823.1|10626_11196_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	33.3	1.1e-14
>prophage 4
NZ_CP051689	Escherichia coli strain SCU-387 plasmid pSCU-387-1, complete sequence	139635	26626	28774	139635		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_001620877.1|26626_28774_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	27.7	2.7e-24
>prophage 5
NZ_CP051689	Escherichia coli strain SCU-387 plasmid pSCU-387-1, complete sequence	139635	34175	44235	139635		Bacillus_phage(33.33%)	5	NA	NA
WP_021552516.1|34175_37835_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.8	4.7e-45
WP_097403177.1|37938_39168_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_001620854.1|39252_40209_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_115766400.1|40253_42431_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_097403179.1|43200_44235_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	44.0	5.7e-73
>prophage 6
NZ_CP051689	Escherichia coli strain SCU-387 plasmid pSCU-387-1, complete sequence	139635	67790	70103	139635	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_001171554.1|67790_68171_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_021548229.1|68167_68515_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	2.4e-60
WP_016245515.1|68564_70103_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.3	2.9e-283
>prophage 7
NZ_CP051689	Escherichia coli strain SCU-387 plasmid pSCU-387-1, complete sequence	139635	75244	78943	139635		Escherichia_phage(33.33%)	7	NA	NA
WP_001620832.1|75244_75553_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	41.0	8.8e-14
WP_001620830.1|75549_76236_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_097424846.1|76273_76483_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_052983101.1|76528_76990_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	36.4	5.5e-20
WP_097424844.1|77234_77447_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001620825.1|77581_78142_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205725.1|78196_78943_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	2.4e-09
>prophage 8
NZ_CP051689	Escherichia coli strain SCU-387 plasmid pSCU-387-1, complete sequence	139635	105429	105651	139635		Vibrio_virus(100.0%)	1	NA	NA
WP_001278695.1|105429_105651_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	4.4e-07
>prophage 9
NZ_CP051689	Escherichia coli strain SCU-387 plasmid pSCU-387-1, complete sequence	139635	113468	114290	139635		Yersinia_phage(100.0%)	1	NA	NA
WP_162825039.1|113468_114290_-	DUF932 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	7.5e-44
>prophage 10
NZ_CP051689	Escherichia coli strain SCU-387 plasmid pSCU-387-1, complete sequence	139635	127176	134975	139635	integrase	Escherichia_phage(40.0%)	9	120914:120927	137704:137717
120914:120927	attL	GGTCTTTTTCCCGG	NA	NA	NA	NA
WP_024249881.1|127176_127860_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.0	1.4e-27
WP_162497511.1|127935_128247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097403258.1|128243_129146_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000619112.1|129563_129812_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.2e-13
WP_000340835.1|131517_131910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103694.1|131914_132886_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000633911.1|133114_133759_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_000239529.1|133752_134028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032305265.1|134165_134975_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	7.8e-54
137704:137717	attR	CCGGGAAAAAGACC	NA	NA	NA	NA
