The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050385	Acinetobacter baumannii strain VB82 chromosome, complete genome	4210906	49069	89494	4210906	plate,tail,protease,transposase,head,integrase	Pseudomonas_phage(19.35%)	53	44643:44658	67563:67578
44643:44658	attL	AATCCGTGCTCATCCA	NA	NA	NA	NA
WP_000671218.1|49069_49507_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	34.8	8.1e-13
WP_000540293.1|49493_49706_-	hypothetical protein	NA	K4IBU9	Acinetobacter_phage	55.3	1.0e-05
WP_001004231.1|49707_49932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063064.1|49928_50642_-	DUF2786 domain-containing protein	NA	A0A2H4JCP9	uncultured_Caudovirales_phage	39.2	5.0e-28
WP_000201618.1|50781_50961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000370225.1|50973_51300_-	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	66.7	1.6e-29
WP_001043035.1|51292_51568_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	66.3	4.6e-22
WP_000288872.1|51572_51740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000101704.1|51762_52266_-	host-nuclease inhibitor Gam family protein	NA	A0A2K9VGT9	Faecalibacterium_phage	33.5	7.6e-15
WP_000857167.1|52265_52937_-	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	47.2	2.1e-28
WP_001022460.1|52937_53174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000752924.1|53170_53389_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000810199.1|53483_54761_-	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	47.3	3.6e-93
WP_000184213.1|54770_56522_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q5ZR04	Pseudomonas_phage	36.3	5.4e-100
WP_000064356.1|56524_57412_-	hypothetical protein	NA	Q6QID9	Burkholderia_phage	30.4	8.7e-22
WP_001985437.1|57424_57721_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001249250.1|57704_57872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000550335.1|57915_58122_-	DNA-binding protein	NA	A0A0S4L0D0	Pseudomonas_phage	54.5	3.0e-10
WP_000151899.1|58222_58870_+	hypothetical protein	NA	A0A2I7S9A5	Vibrio_phage	35.5	6.1e-25
WP_002004670.1|58869_59421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000028720.1|59504_60005_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	65.8	1.5e-55
WP_001037051.1|60001_60385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000155183.1|60381_60726_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	40.4	2.6e-14
WP_000006949.1|60722_61034_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	52.0	3.8e-25
WP_000090431.1|61042_61591_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	49.4	8.5e-44
WP_038350326.1|61587_63150_+	hypothetical protein	NA	A0A2H4JF57	uncultured_Caudovirales_phage	56.2	5.4e-160
WP_001074447.1|64320_65898_+	DUF935 domain-containing protein	NA	A0A0A1IVG5	Pseudomonas_phage	42.0	1.6e-103
WP_001138608.1|65897_67148_+	hypothetical protein	NA	I6PBD2	Pseudomonas_phage	37.3	9.2e-70
WP_000008346.1|67144_67648_+	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	32.5	5.6e-10
67563:67578	attR	TGGATGAGCACGGATT	NA	NA	NA	NA
WP_001126668.1|67736_68822_+	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	32.6	3.2e-34
WP_000143543.1|68818_69238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000237123.1|69241_70174_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A2P9JZJ2	Alteromonadaceae_phage	55.4	7.8e-90
WP_000271340.1|70185_70617_+	DUF1320 family protein	NA	A0A0M3LP98	Mannheimia_phage	37.3	7.4e-19
WP_000609245.1|70613_71225_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_002004678.1|71224_71572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057895.1|71582_73928_+	CotH kinase family protein	NA	H7BUR7	unidentified_phage	21.6	1.4e-07
WP_001278043.1|73946_75296_+	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_000382697.1|75295_75511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002004681.1|75507_76317_+	hypothetical protein	NA	A0A2H4JFT7	uncultured_Caudovirales_phage	28.7	2.2e-16
WP_001287672.1|76442_76820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000439581.1|76822_77134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000974238.1|77163_77397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016903.1|77400_79497_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_000539634.1|79584_80760_+	DNA circularization N-terminal domain-containing protein	NA	F6MIL2	Haemophilus_phage	21.6	3.2e-16
WP_001153724.1|80749_81805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973841.1|81801_82284_+|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	39.3	9.8e-12
WP_001273710.1|82291_82654_+	phage GP46 family protein	NA	NA	NA	NA	NA
WP_000331142.1|82657_83704_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	27.1	1.1e-26
WP_000142500.1|83700_84237_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_000821011.1|84233_85505_+	hypothetical protein	NA	E5EYU2	Acinetobacter_phage	40.0	4.8e-05
WP_001198432.1|85946_87281_+	trigger factor	NA	NA	NA	NA	NA
WP_000289452.1|87473_88079_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	60.6	1.2e-62
WP_001289250.1|88180_89494_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	3.0e-127
>prophage 2
NZ_CP050385	Acinetobacter baumannii strain VB82 chromosome, complete genome	4210906	885190	905795	4210906	capsid,terminase	Acinetobacter_phage(63.16%)	32	NA	NA
WP_001207483.1|885190_886309_-	ATP-binding protein	NA	A0A0P0HSM9	Acinetobacter_phage	92.9	2.6e-196
WP_000993665.1|886320_886650_-	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	66.0	7.1e-30
WP_000812654.1|886652_886841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023060505.1|887004_887889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000204265.1|887890_888940_-	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_000863485.1|888942_889800_-	site-specific DNA-methyltransferase	NA	C5IHN3	Burkholderia_virus	48.5	1.5e-74
WP_025464659.1|889883_890549_-	peptidase S24	NA	A0A0R6PJ00	Moraxella_phage	39.7	1.5e-26
WP_000104069.1|890705_890963_+	hypothetical protein	NA	A0A0P0IY81	Acinetobacter_phage	40.6	2.7e-08
WP_001258348.1|890993_891278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081411.1|891331_891607_+	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	86.8	6.1e-35
WP_000102848.1|891603_891897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000050658.1|891893_892856_+	helix-turn-helix domain-containing protein	NA	A0A0P0HSN8	Acinetobacter_phage	54.4	4.4e-19
WP_001031747.1|892852_892981_+	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	92.9	9.5e-15
WP_000030900.1|892973_893180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000378364.1|893169_893493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000100188.1|893492_893894_+	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	95.5	2.0e-66
WP_000959660.1|893904_894657_+	hypothetical protein	NA	A0A0P0J081	Acinetobacter_phage	95.6	4.6e-133
WP_001017703.1|894800_895019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046882649.1|895285_895630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000152667.1|895838_896075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119878067.1|896743_897199_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	94.7	5.2e-79
WP_000378505.1|897259_897694_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	96.5	3.5e-77
WP_000435242.1|897662_898304_+	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	91.5	2.0e-116
WP_000729394.1|898363_898840_+	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	53.6	4.5e-33
WP_001088669.1|898817_900344_+|terminase	phage terminase large subunit	terminase	A0A291LBL3	Klebsiella_phage	41.0	1.0e-91
WP_000852312.1|900352_901687_+	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	38.9	2.9e-85
WP_000207479.1|901631_902444_+|capsid	minor capsid protein	capsid	M4T3R2	Psychrobacter_phage	41.8	1.3e-51
WP_004736136.1|902432_902735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000823405.1|902778_903078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000849768.1|903131_904331_+	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	35.5	7.4e-24
WP_000240727.1|904344_904815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000039808.1|904820_905795_+	DUF2184 domain-containing protein	NA	M4SQD1	Psychrobacter_phage	37.5	2.0e-51
>prophage 3
NZ_CP050385	Acinetobacter baumannii strain VB82 chromosome, complete genome	4210906	917762	930139	4210906	integrase,tRNA	Acinetobacter_phage(50.0%)	15	908828:908842	934168:934182
908828:908842	attL	ACCGGTACAGGTAAA	NA	NA	NA	NA
WP_001171474.1|917762_918191_+	C40 family peptidase	NA	A0A0B5A615	Paracoccus_phage	34.6	4.5e-08
WP_000508789.1|918190_920680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023060509.1|920743_921133_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	94.6	6.8e-64
WP_001021568.1|921244_921787_+	hypothetical protein	NA	A0A0D4DBW7	Acinetobacter_phage	100.0	5.7e-101
WP_001100986.1|921812_921992_+	hypothetical protein	NA	A0A0D4DCA7	Acinetobacter_phage	100.0	9.2e-24
WP_001017972.1|922053_922596_+	N-acetylmuramidase	NA	A0A0B5L5G0	Acinetobacter_phage	93.9	1.2e-95
WP_000566933.1|922876_923467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000200052.1|923529_923724_+	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	85.5	1.7e-23
WP_001171605.1|923752_924766_-|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	40.3	3.8e-66
WP_001182278.1|925119_926541_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.8	1.5e-55
WP_001133560.1|926754_927732_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.1	1.1e-38
WP_000179337.1|927735_928275_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_000381220.1|928312_928861_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000554244.1|928844_929393_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_001183458.1|929392_930139_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.1e-20
934168:934182	attR	ACCGGTACAGGTAAA	NA	NA	NA	NA
>prophage 4
NZ_CP050385	Acinetobacter baumannii strain VB82 chromosome, complete genome	4210906	1348025	1390673	4210906	portal,tail,protease,head,terminase,tRNA,integrase,capsid	uncultured_Caudovirales_phage(34.48%)	57	1358118:1358139	1395146:1395167
WP_000033177.1|1348025_1348529_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	A0A0B5J096	Pandoravirus	31.3	2.9e-06
WP_001246675.1|1348598_1349042_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_000218018.1|1349049_1349736_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140309.1|1349840_1351514_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000205997.1|1351670_1351973_+	integration host factor subunit beta	NA	B5TA87	Burkholderia_phage	42.9	5.6e-13
WP_001269278.1|1351997_1352363_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_000392927.1|1352528_1353227_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_001190743.1|1353223_1354135_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_137987706.1|1354184_1355732_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_085940568.1|1355895_1356873_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000933387.1|1356956_1358099_+	cell division protein ZapE	NA	NA	NA	NA	NA
1358118:1358139	attL	CGCTCTAAATTGAGCGCTTTTT	NA	NA	NA	NA
WP_000190202.1|1358275_1359235_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	35.4	4.5e-48
WP_000141159.1|1359200_1359452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162216694.1|1359448_1359736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162216693.1|1359738_1360500_-	phage antirepressor protein	NA	A0A0P0IDX3	Acinetobacter_phage	57.3	7.8e-72
WP_162216692.1|1360499_1360883_-	hypothetical protein	NA	E2GLX5	Acinetobacter_phage	78.0	1.4e-32
WP_162216691.1|1360894_1361443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031996712.1|1361439_1361874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162216690.1|1361876_1362113_-	hypothetical protein	NA	A0A2H4J515	uncultured_Caudovirales_phage	41.9	1.9e-08
WP_162216689.1|1362096_1362513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162216688.1|1362505_1363249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162216687.1|1363491_1364157_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	42.0	1.5e-23
WP_038350389.1|1364286_1364514_+	transcriptional regulator	NA	A0A125RNS7	Pseudomonas_phage	54.0	1.0e-11
WP_162216686.1|1364564_1364861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162216685.1|1364860_1365898_+	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	52.3	4.0e-34
WP_162216684.1|1365897_1367229_+	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	55.9	1.6e-128
WP_000846971.1|1367225_1367504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002000320.1|1367530_1368004_+	hypothetical protein	NA	A0A0P0I4C3	Acinetobacter_phage	35.1	1.2e-17
WP_162216683.1|1368069_1368966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049594698.1|1369517_1369820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162216669.1|1369940_1370087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162216682.1|1370382_1370568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856318.1|1370640_1371039_+	hypothetical protein	NA	T1S9H7	Salmonella_phage	38.0	4.8e-12
WP_041172104.1|1371054_1371585_+	hypothetical protein	NA	A0A2H4JB76	uncultured_Caudovirales_phage	44.6	1.1e-37
WP_162216681.1|1371574_1371799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038405850.1|1371819_1372377_+	hypothetical protein	NA	A0A0A0RVZ2	Escherichia_phage	57.1	2.7e-05
WP_038350354.1|1372354_1372645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162216680.1|1372574_1372874_+	HNH endonuclease	NA	A0A0R6PHK1	Moraxella_phage	52.1	1.2e-20
WP_162216679.1|1372870_1373050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033502812.1|1373172_1373655_+|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	48.4	3.5e-25
WP_162216678.1|1373840_1375532_+|terminase	terminase large subunit	terminase	A0A2H4J559	uncultured_Caudovirales_phage	82.2	1.3e-271
WP_114249656.1|1375528_1376752_+|portal	phage portal protein	portal	A0A2H4J6S3	uncultured_Caudovirales_phage	75.8	3.9e-182
WP_096877375.1|1376754_1377417_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	61.8	3.6e-73
WP_086249770.1|1377409_1378582_+|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	47.5	7.1e-88
WP_169059644.1|1378629_1378806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000631203.1|1378802_1379090_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	47.5	1.1e-18
WP_162216677.1|1379091_1379448_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	49.1	6.1e-19
WP_000211398.1|1379451_1379937_+	HK97 gp10 family phage protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	44.7	2.2e-27
WP_162216676.1|1379936_1380308_+	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	46.2	4.4e-20
WP_031978727.1|1380379_1380853_+	hypothetical protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	64.1	5.4e-55
WP_162216675.1|1380852_1381368_+|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_000725048.1|1381695_1382631_+	hypothetical protein	NA	A0A0N7IRE6	Acinetobacter_phage	67.7	4.9e-116
WP_162216674.1|1382837_1386530_+	transglycosylase SLT domain-containing protein	NA	A0A0U4JEA4	Pseudomonas_phage	40.1	1.4e-44
WP_031978681.1|1386532_1387015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162216673.1|1387015_1387522_+	DUF1833 family protein	NA	NA	NA	NA	NA
WP_162216672.1|1387518_1387839_+	hypothetical protein	NA	A0A1B1P9H4	Acinetobacter_phage	42.4	3.7e-07
WP_162216671.1|1387835_1390673_+	hypothetical protein	NA	A0A1B1P9G8	Acinetobacter_phage	32.2	3.0e-124
1395146:1395167	attR	CGCTCTAAATTGAGCGCTTTTT	NA	NA	NA	NA
>prophage 5
NZ_CP050385	Acinetobacter baumannii strain VB82 chromosome, complete genome	4210906	1955536	1981523	4210906	plate,capsid	Acinetobacter_phage(93.1%)	34	NA	NA
WP_001019702.1|1955536_1956082_-	N-acetylmuramidase	NA	A0A0N7IRF5	Acinetobacter_phage	93.4	1.3e-97
WP_001076397.1|1956180_1956363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433923.1|1956724_1957114_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	99.2	4.3e-66
WP_000873384.1|1957180_1957567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257533.1|1957563_1959813_-	hypothetical protein	NA	I3WVZ0	Acinetobacter_phage	25.7	6.7e-10
WP_000342174.1|1959815_1960409_-	DUF2612 domain-containing protein	NA	A0A0P0IKZ0	Acinetobacter_phage	45.4	4.4e-38
WP_001229526.1|1960401_1961583_-|plate	baseplate J/gp47 family protein	plate	A0A0P0I499	Acinetobacter_phage	52.7	2.6e-114
WP_001270578.1|1961582_1961939_-	hypothetical protein	NA	A0A0P0IVU6	Acinetobacter_phage	53.9	6.3e-32
WP_001218511.1|1961981_1962692_-	hypothetical protein	NA	A0A0N7IRF4	Acinetobacter_phage	50.8	2.2e-60
WP_000175157.1|1962681_1963677_-	hypothetical protein	NA	A0A0P0HSL6	Acinetobacter_phage	53.1	7.3e-94
WP_001240307.1|1963673_1963973_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	44.2	6.7e-11
WP_001018458.1|1963974_1964604_-	hypothetical protein	NA	A0A0P0IKS1	Acinetobacter_phage	59.3	4.8e-51
WP_000733629.1|1964782_1965121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000046201.1|1965117_1967730_-	hypothetical protein	NA	A0A0P0IE11	Acinetobacter_phage	35.7	1.2e-111
WP_001247957.1|1967822_1967975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002533.1|1968010_1968496_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	59.6	2.0e-41
WP_000109245.1|1968517_1968961_-	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	75.5	8.4e-58
WP_000174800.1|1968971_1970093_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	52.3	6.0e-129
WP_000502799.1|1970101_1970638_-	hypothetical protein	NA	A0A0P0IVT9	Acinetobacter_phage	89.3	2.4e-83
WP_000057777.1|1970641_1971010_-	hypothetical protein	NA	A0A0P0HSK8	Acinetobacter_phage	95.1	1.5e-60
WP_000094497.1|1970996_1971557_-	hypothetical protein	NA	A0A0P0J0D1	Acinetobacter_phage	96.2	1.0e-92
WP_000622626.1|1971553_1971940_-	DUF4054 domain-containing protein	NA	A0A0P0IKR4	Acinetobacter_phage	96.9	1.2e-65
WP_000041172.1|1971943_1972375_-	hypothetical protein	NA	A0A0P0IYA6	Acinetobacter_phage	89.5	1.2e-48
WP_001228778.1|1972384_1973410_-	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	99.4	1.4e-193
WP_000525988.1|1973474_1973951_-	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	98.7	4.3e-84
WP_000473610.1|1973954_1975268_-	DUF2213 domain-containing protein	NA	A0A0P0IRE1	Acinetobacter_phage	97.7	1.0e-207
WP_001178762.1|1975329_1975587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562064.1|1975633_1976215_-|capsid	minor capsid protein	capsid	A0A0P0IKX5	Acinetobacter_phage	96.4	2.1e-101
WP_137987715.1|1976285_1977698_-	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	97.7	3.8e-253
WP_000220357.1|1977708_1979367_-	hypothetical protein	NA	A0A0P0IVT4	Acinetobacter_phage	98.6	0.0e+00
WP_001096341.1|1979363_1979870_-	DUF2280 domain-containing protein	NA	A0A2H4JI35	uncultured_Caudovirales_phage	66.7	8.4e-54
WP_025464671.1|1979929_1980571_-	hypothetical protein	NA	A0A0P0I8J9	Acinetobacter_phage	88.7	1.0e-112
WP_000378514.1|1980539_1981007_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	79.4	2.0e-65
WP_001136768.1|1981067_1981523_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	94.0	1.5e-78
>prophage 6
NZ_CP050385	Acinetobacter baumannii strain VB82 chromosome, complete genome	4210906	1984690	1996331	4210906	integrase	Acinetobacter_phage(94.12%)	21	1991324:1991340	2005129:2005145
WP_001277128.1|1984690_1985167_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
WP_000097329.1|1985163_1985565_-	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	90.1	5.1e-62
WP_000994670.1|1985564_1986029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000544512.1|1986025_1986775_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	98.0	2.6e-136
WP_000280080.1|1986767_1987697_-	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	99.4	6.2e-172
WP_046882998.1|1987696_1988050_-	hypothetical protein	NA	A0A0P0IVS7	Acinetobacter_phage	96.6	4.5e-54
WP_001084132.1|1988046_1988343_-	hypothetical protein	NA	J7HXM0	Acinetobacter_phage	100.0	1.6e-49
WP_001072908.1|1988339_1988624_-	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	85.7	5.4e-34
WP_000041061.1|1988673_1989030_-	hypothetical protein	NA	J7I452	Acinetobacter_phage	97.5	2.5e-57
WP_001077691.1|1989038_1989239_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IKT3	Acinetobacter_phage	68.2	3.1e-20
WP_000212394.1|1989351_1990008_+	helix-turn-helix domain-containing protein	NA	A0A0P0IYD9	Acinetobacter_phage	63.8	3.1e-69
WP_000862384.1|1990054_1990336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001101459.1|1990555_1990996_+	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	97.3	7.5e-75
WP_000181042.1|1990998_1991322_+	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	83.2	1.2e-45
1991324:1991340	attL	GATAAGAAAAATGACAA	NA	NA	NA	NA
WP_002010120.1|1991333_1992101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000183243.1|1992115_1993063_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	87.8	7.3e-152
WP_000043827.1|1993062_1993359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000048741.1|1994247_1994532_+	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	93.6	3.1e-42
WP_000015932.1|1994535_1994793_+	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	94.1	4.7e-45
WP_000910238.1|1994793_1995063_+	hypothetical protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
WP_000773618.1|1995068_1996331_-|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	98.8	1.0e-246
2005129:2005145	attR	GATAAGAAAAATGACAA	NA	NA	NA	NA
>prophage 7
NZ_CP050385	Acinetobacter baumannii strain VB82 chromosome, complete genome	4210906	2249776	2317250	4210906	transposase,tRNA,protease	Moraxella_phage(37.5%)	52	NA	NA
WP_085944009.1|2249776_2250995_+|transposase	IS3-like element ISAba34 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.1e-75
WP_001000108.1|2251216_2251837_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_001206290.1|2252813_2254022_-|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	3.1e-171
WP_001149936.1|2255595_2255715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940413.1|2255838_2256928_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_002016113.1|2256961_2257981_-	Csu fimbrial tip adhesin CsuE	NA	NA	NA	NA	NA
WP_000603306.1|2257977_2260476_-	Csu fimbrial usher CsuD	NA	NA	NA	NA	NA
WP_004712917.1|2260472_2261306_-	Csu fimbrial biogenesis chaperone CsuC	NA	NA	NA	NA	NA
WP_000876479.1|2261299_2261818_-	Csu fimbrial biogenesis protein CsuB	NA	NA	NA	NA	NA
WP_171057416.1|2261823_2262279_-	Csu fimbrial biogenesis protein CsuA	NA	NA	NA	NA	NA
WP_000790104.1|2262446_2262983_-	Csu fimbrial major subunit CsuAB	NA	NA	NA	NA	NA
WP_000590088.1|2263566_2264205_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000637306.1|2264273_2264465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000572515.1|2264492_2265191_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000423651.1|2265287_2266190_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000397471.1|2266242_2267478_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000054920.1|2267838_2268987_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000097865.1|2269145_2269982_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000429462.1|2270032_2270638_+	LysE family translocator	NA	NA	NA	NA	NA
WP_000469224.1|2271205_2271532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000383195.1|2271528_2271999_-	BLUF domain-containing protein	NA	NA	NA	NA	NA
WP_000721829.1|2272162_2272525_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_000690471.1|2272811_2273456_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000581928.1|2273452_2274052_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000536980.1|2274026_2274821_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_000931128.1|2274808_2275783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094391.1|2276081_2276315_+	DUF2171 domain-containing protein	NA	NA	NA	NA	NA
WP_001058177.1|2276462_2277860_-	amino acid permease	NA	NA	NA	NA	NA
WP_000181279.1|2277963_2279532_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_085944093.1|2279642_2281025_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000802861.1|2281122_2282040_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004736712.1|2282157_2283279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083042102.1|2283334_2283910_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085940413.1|2283911_2285002_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000154821.1|2285915_2286197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001262214.1|2286524_2286800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000573640.1|2287324_2287534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000873035.1|2287530_2287680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000896070.1|2287836_2288307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002016208.1|2288308_2302951_-	hemagglutinin	NA	A0A0R6PJK4	Moraxella_phage	38.4	6.4e-53
WP_000935949.1|2303014_2304772_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.0	4.1e-39
WP_000912081.1|2305554_2306358_-	protein kinase	NA	B6VC32	Iragoides_fasciata_nucleopolyhedrovirus	33.9	1.8e-05
WP_000461855.1|2306344_2307853_-	DUF3336 domain-containing protein	NA	NA	NA	NA	NA
WP_000190821.1|2308031_2308913_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000744460.1|2309016_2310120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000636263.1|2310122_2311133_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	66.3	2.1e-125
WP_001136722.1|2311278_2311494_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000209410.1|2311520_2311967_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	40.8	1.9e-17
WP_085944101.1|2312058_2313486_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000758325.1|2313632_2314598_-	D-glycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	28.3	3.8e-15
WP_000580191.1|2314609_2315260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000665946.1|2315360_2317250_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 8
NZ_CP050385	Acinetobacter baumannii strain VB82 chromosome, complete genome	4210906	2328914	2371915	4210906	tail,capsid,terminase,integrase	Acinetobacter_phage(74.51%)	68	2352191:2352205	2375741:2375755
WP_083042106.1|2328914_2329580_-|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	49.1	1.0e-43
WP_083042107.1|2329563_2330319_-	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	57.8	7.3e-86
WP_004736727.1|2330325_2331132_-|tail	phage minor tail protein L	tail	A0A0R6PGU8	Moraxella_phage	64.6	2.7e-94
WP_083042108.1|2331118_2332294_-	hypothetical protein	NA	E5KJQ6	Acinetobacter_phage	58.9	1.4e-43
WP_004736731.1|2332347_2332689_-|tail	phage tail protein	tail	A0A0R6PHH7	Moraxella_phage	42.2	2.2e-13
WP_004736733.1|2332685_2332829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004736735.1|2332923_2333460_+	hypothetical protein	NA	A0A2H4J720	uncultured_Caudovirales_phage	31.5	4.8e-15
WP_004736738.1|2333494_2337553_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	47.4	2.0e-206
WP_004736741.1|2337611_2338553_-	hypothetical protein	NA	A0A0N7IRE6	Acinetobacter_phage	85.6	5.0e-153
WP_004736743.1|2338623_2339073_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004736745.1|2339069_2339786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004736746.1|2340147_2340672_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	60.5	3.9e-46
WP_004736748.1|2340717_2341659_-	hypothetical protein	NA	A0A1B1P9E0	Acinetobacter_phage	97.1	5.5e-168
WP_004700304.1|2341765_2341978_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	84.1	8.4e-24
WP_114226277.1|2341979_2342423_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	78.2	2.1e-64
WP_025465131.1|2342379_2342748_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.0	3.9e-53
WP_171265750.1|2342713_2343127_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	91.8	7.8e-66
WP_002004038.1|2343135_2343504_-	hypothetical protein	NA	J7I467	Acinetobacter_phage	86.1	3.8e-56
WP_000008491.1|2343507_2343897_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	99.2	4.3e-66
WP_083042110.1|2343901_2344567_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	79.2	1.9e-90
WP_064479964.1|2344631_2345585_-	Ig domain-containing protein	NA	A0A0D4DBM4	Acinetobacter_phage	93.7	2.8e-167
WP_000770056.1|2345612_2346380_-	hypothetical protein	NA	A0A0D4DCP5	Acinetobacter_phage	92.5	5.2e-116
WP_083042111.1|2346497_2346809_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	47.6	1.5e-13
WP_000004360.1|2347029_2347272_-	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	90.0	7.1e-35
WP_083042112.1|2347268_2348372_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	96.2	8.4e-200
WP_001286350.1|2348373_2349825_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	91.5	1.0e-261
WP_083042113.1|2349821_2351249_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	88.4	4.7e-251
WP_004736766.1|2351238_2351709_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	98.7	6.7e-82
WP_000372126.1|2351767_2352409_-	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	89.2	2.4e-114
2352191:2352205	attL	ATAAGCAGAAGAAGC	NA	NA	NA	NA
WP_002004043.1|2352540_2352846_-	hypothetical protein	NA	A0A2I7QMV1	Vibrio_phage	38.9	7.9e-07
WP_000433688.1|2352871_2353357_-	hypothetical protein	NA	A0A0D4DC11	Acinetobacter_phage	57.9	8.9e-45
WP_004736768.1|2353803_2353974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587870.1|2353976_2354285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080484.1|2354287_2354533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004736769.1|2354581_2354902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000990560.1|2355312_2355846_-	hypothetical protein	NA	A0A0P0I4C3	Acinetobacter_phage	36.4	9.2e-19
WP_004736770.1|2355936_2356389_-	hypothetical protein	NA	A0A0P0HSP6	Acinetobacter_phage	94.7	1.0e-74
WP_025464961.1|2356385_2356697_-	hypothetical protein	NA	A0A0D4DCM1	Acinetobacter_phage	95.1	1.8e-59
WP_083042114.1|2356687_2357227_-	hypothetical protein	NA	I2GUD3	Acinetobacter_phage	90.5	2.6e-29
WP_083042115.1|2357219_2357591_-	hypothetical protein	NA	A0A0P0IKT4	Acinetobacter_phage	82.0	1.0e-16
WP_002009796.1|2357583_2357844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033856152.1|2357840_2358212_-	hypothetical protein	NA	I2GUC9	Acinetobacter_phage	62.2	4.0e-37
WP_083042116.1|2358208_2358742_-	hypothetical protein	NA	M4SN77	Psychrobacter_phage	42.7	2.6e-29
WP_164545311.1|2358738_2358915_-	hypothetical protein	NA	A0A0P0IRH7	Acinetobacter_phage	89.7	1.1e-18
WP_001068420.1|2358911_2359163_-	hypothetical protein	NA	A0A0P0IE39	Acinetobacter_phage	90.4	1.1e-35
WP_000755975.1|2359171_2360038_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2I7RGS4	Vibrio_phage	46.2	4.9e-70
WP_004736774.1|2360034_2361360_-	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	98.9	1.5e-248
WP_000050653.1|2361359_2362118_-	helix-turn-helix domain-containing protein	NA	A0A0P0HSN8	Acinetobacter_phage	92.2	4.0e-108
WP_023060457.1|2362114_2362288_-	hypothetical protein	NA	A0A0P0J0G1	Acinetobacter_phage	94.7	1.5e-23
WP_005136293.1|2362484_2362751_-	hypothetical protein	NA	A0A1B1P9I3	Acinetobacter_phage	80.7	9.5e-33
WP_001068245.1|2362761_2362992_-	hypothetical protein	NA	A0A1B1P9I7	Acinetobacter_phage	100.0	1.6e-36
WP_023060455.1|2363116_2363863_+	helix-turn-helix domain-containing protein	NA	A0A1B1P9J5	Acinetobacter_phage	99.6	1.5e-139
WP_025469409.1|2363878_2364094_+	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	94.4	3.0e-29
WP_004736777.1|2364158_2364638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023060453.1|2364637_2365357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083042117.1|2365568_2366267_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000615653.1|2366253_2366439_+	hypothetical protein	NA	A0A1B1P9G9	Acinetobacter_phage	58.1	3.9e-09
WP_083042118.1|2366438_2366630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083042119.1|2366622_2366859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083042120.1|2366855_2367233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083042121.1|2367232_2367829_+	hypothetical protein	NA	A0A2C9CXX4	Yersinia_phage	34.3	1.6e-24
WP_083042122.1|2367838_2368777_+	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	81.7	3.2e-139
WP_083042123.1|2368773_2369433_+	hypothetical protein	NA	A0A2H4JDC0	uncultured_Caudovirales_phage	59.8	9.8e-79
WP_083042124.1|2369429_2369711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083042125.1|2369707_2370199_+	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	64.8	2.8e-46
WP_025464967.1|2370195_2370573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033856313.1|2370608_2370899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033856312.1|2370895_2371915_-|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	42.8	7.1e-68
2375741:2375755	attR	GCTTCTTCTGCTTAT	NA	NA	NA	NA
>prophage 9
NZ_CP050385	Acinetobacter baumannii strain VB82 chromosome, complete genome	4210906	2429190	2442673	4210906	holin,terminase	Acinetobacter_phage(50.0%)	13	NA	NA
WP_000457893.1|2429190_2430444_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.3	2.3e-97
WP_002010476.1|2430504_2430660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000782588.1|2430689_2431919_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_001147934.1|2432168_2432855_+	DUF3820 family protein	NA	A0A059VJT9	Pseudomonas_phage	41.6	1.8e-35
WP_161795015.1|2432999_2433635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084539.1|2433885_2434083_-	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	96.9	5.6e-30
WP_033856064.1|2434207_2434657_-	lysozyme	NA	A0A1B1P9G1	Acinetobacter_phage	96.6	8.1e-77
WP_000397631.1|2434649_2434937_-|holin	phage holin family protein	holin	A0A1B1P9F5	Acinetobacter_phage	100.0	6.0e-49
WP_083042126.1|2435012_2437832_-	hypothetical protein	NA	A0A0A0RLM4	Acinetobacter_phage	57.9	7.3e-232
WP_083042127.1|2437841_2439515_-|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	45.7	4.5e-136
WP_001204064.1|2439514_2439823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000853947.1|2439968_2440112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083042128.1|2440147_2442673_-	hypothetical protein	NA	A0A193GZ61	Enterobacter_phage	32.2	1.4e-109
>prophage 10
NZ_CP050385	Acinetobacter baumannii strain VB82 chromosome, complete genome	4210906	2449268	2472227	4210906	tail,head,integrase	Acinetobacter_phage(45.0%)	39	2441237:2441250	2472444:2472457
2441237:2441250	attL	AGCTAGTTTTTCGG	NA	NA	NA	NA
WP_001250303.1|2449268_2451347_-	hypothetical protein	NA	A0A1B1IW99	uncultured_Mediterranean_phage	27.0	8.8e-33
WP_083042129.1|2451346_2451907_-	hypothetical protein	NA	A0A1B1IRI7	uncultured_Mediterranean_phage	35.6	7.2e-22
WP_000072947.1|2451972_2452143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001262754.1|2452217_2453117_-	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	34.6	5.5e-32
WP_000931279.1|2453128_2453752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611267.1|2453744_2454230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033856157.1|2454226_2455870_-|head,tail	head-tail connector protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	44.6	4.7e-122
WP_000333834.1|2455871_2456102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033856156.1|2456101_2456425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002009684.1|2456491_2456671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025464961.1|2456765_2457077_-	hypothetical protein	NA	A0A0D4DCM1	Acinetobacter_phage	95.1	1.8e-59
WP_083042114.1|2457067_2457607_-	hypothetical protein	NA	I2GUD3	Acinetobacter_phage	90.5	2.6e-29
WP_083042115.1|2457599_2457971_-	hypothetical protein	NA	A0A0P0IKT4	Acinetobacter_phage	82.0	1.0e-16
WP_002009796.1|2457963_2458224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002010151.1|2458220_2458604_-	hypothetical protein	NA	A0A0A0RTI7	Acinetobacter_phage	45.0	3.2e-13
WP_001261846.1|2458600_2459005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009499908.1|2459022_2459442_-	hypothetical protein	NA	H2DE79	Erwinia_phage	50.8	1.2e-26
WP_083042130.1|2459428_2459794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083042131.1|2459790_2460525_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	52.0	1.5e-64
WP_083042132.1|2460521_2461400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001046534.1|2461396_2461864_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_083042133.1|2461880_2462204_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_001197739.1|2462212_2462395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000096816.1|2462507_2463191_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	37.6	6.9e-27
WP_083042134.1|2463187_2463829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000508120.1|2464060_2464408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025464833.1|2464427_2464694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537259.1|2464693_2465290_+	hypothetical protein	NA	A0A2C9CXX4	Yersinia_phage	31.5	1.1e-20
WP_033856359.1|2465299_2466157_+	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	56.7	1.5e-58
WP_083042135.1|2466137_2466746_+	YqaJ viral recombinase family protein	NA	A0A2H4J882	uncultured_Caudovirales_phage	76.3	1.1e-84
WP_025464966.1|2466742_2467000_+	hypothetical protein	NA	K4HYN5	Acinetobacter_phage	78.8	1.2e-29
WP_002010280.1|2466996_2467260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002010053.1|2467271_2467751_+	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	66.7	1.5e-49
WP_025464967.1|2467747_2468125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123991.1|2468161_2468431_+	hypothetical protein	NA	A0A1B1P9G0	Acinetobacter_phage	100.0	4.7e-48
WP_002010468.1|2468427_2469414_-|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	98.8	1.5e-184
WP_000128669.1|2469712_2470648_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	8.3e-23
WP_001010536.1|2470644_2471418_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000110170.1|2471414_2472227_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HHM5	Vibrio_phage	36.0	8.5e-40
2472444:2472457	attR	CCGAAAAACTAGCT	NA	NA	NA	NA
>prophage 11
NZ_CP050385	Acinetobacter baumannii strain VB82 chromosome, complete genome	4210906	2513201	2529861	4210906	integrase	Acinetobacter_phage(57.14%)	17	2505343:2505358	2537176:2537191
2505343:2505358	attL	ATTGATGCAGCAATTG	NA	NA	NA	NA
WP_085944095.1|2513201_2514761_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	88.1	4.6e-260
WP_000115130.1|2514757_2516560_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	91.0	0.0e+00
WP_002010361.1|2517044_2518241_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0IRB7	Acinetobacter_phage	99.5	8.2e-225
WP_005068171.1|2518251_2518887_+	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	57.4	6.8e-69
WP_074042511.1|2519034_2519529_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	59.6	6.9e-45
WP_074042512.1|2519532_2520831_+	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	62.1	7.7e-160
WP_074042513.1|2520913_2521135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074042514.1|2521134_2521974_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_074042515.1|2522071_2522389_-	anaerobic dehydrogenase	NA	E5KY21	Escherichia_phage	59.6	3.9e-25
WP_074042516.1|2522389_2522935_-	N-acetylmuramidase	NA	A0A0P0IW03	Acinetobacter_phage	92.7	1.1e-94
WP_001100986.1|2522996_2523176_-	hypothetical protein	NA	A0A0D4DCA7	Acinetobacter_phage	100.0	9.2e-24
WP_001021568.1|2523201_2523744_-	hypothetical protein	NA	A0A0D4DBW7	Acinetobacter_phage	100.0	5.7e-101
WP_000433918.1|2523855_2524245_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	100.0	2.5e-66
WP_074042517.1|2524311_2526801_-	hypothetical protein	NA	A0A1I9L2F3	Xanthomonas_phage	22.8	1.0e-06
WP_000792725.1|2526801_2527224_-	C40 family peptidase	NA	A0A0B5A615	Paracoccus_phage	31.9	5.8e-08
WP_169059648.1|2527264_2528041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074042519.1|2528043_2529861_-	hypothetical protein	NA	A0A0S1S0B7	Acinetobacter_phage	55.2	1.4e-138
2537176:2537191	attR	CAATTGCTGCATCAAT	NA	NA	NA	NA
>prophage 12
NZ_CP050385	Acinetobacter baumannii strain VB82 chromosome, complete genome	4210906	2538633	2575152	4210906	capsid,terminase	Acinetobacter_phage(86.36%)	49	NA	NA
WP_000039808.1|2538633_2539608_-	DUF2184 domain-containing protein	NA	M4SQD1	Psychrobacter_phage	37.5	2.0e-51
WP_000240727.1|2539613_2540084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000849768.1|2540097_2541297_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	35.5	7.4e-24
WP_000823405.1|2541350_2541650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004736136.1|2541693_2541996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169059649.1|2541984_2542797_-|capsid	minor capsid protein	capsid	M4T3R2	Psychrobacter_phage	41.4	2.8e-51
WP_000852312.1|2542741_2544076_-	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	38.9	2.9e-85
WP_001088669.1|2544084_2545611_-|terminase	phage terminase large subunit	terminase	A0A291LBL3	Klebsiella_phage	41.0	1.0e-91
WP_000729394.1|2545588_2546065_-	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	53.6	4.5e-33
WP_002056383.1|2546124_2546766_-	hypothetical protein	NA	A0A0P0I8J9	Acinetobacter_phage	87.8	7.7e-113
WP_074042522.1|2546734_2547202_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	82.9	3.3e-65
WP_000134358.1|2547214_2547406_-	hypothetical protein	NA	J7I0V8	Acinetobacter_phage	85.7	2.6e-24
WP_000527469.1|2547483_2547696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002010243.1|2547868_2548621_-	hypothetical protein	NA	A0A0P0J081	Acinetobacter_phage	92.8	5.3e-129
WP_074042523.1|2548631_2549033_-	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	97.0	8.1e-68
WP_033855588.1|2549032_2549299_-	hypothetical protein	NA	A0A1X9SFG4	Acinetobacter_phage	39.3	7.6e-06
WP_000778990.1|2549291_2549690_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	48.4	1.3e-25
WP_001031745.1|2549686_2549812_-	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	89.5	4.8e-11
WP_045544371.1|2549808_2550558_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	97.2	1.1e-134
WP_000280080.1|2550550_2551480_-	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	99.4	6.2e-172
WP_074042525.1|2551472_2551835_-	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	98.3	1.2e-54
WP_001084140.1|2551831_2552128_-	hypothetical protein	NA	A0A0P0HSJ2	Acinetobacter_phage	98.0	8.9e-48
WP_001194330.1|2552124_2552397_-	hypothetical protein	NA	A0A0D4DCC3	Acinetobacter_phage	98.9	3.7e-40
WP_000166124.1|2552444_2552711_-	hypothetical protein	NA	A0A0D4DBY7	Acinetobacter_phage	100.0	1.6e-43
WP_001068174.1|2552747_2552978_-	hypothetical protein	NA	A0A0D4DBS7	Acinetobacter_phage	100.0	6.1e-36
WP_000605245.1|2553104_2553830_+	LexA family transcriptional regulator	NA	A0A0D4DBI5	Acinetobacter_phage	100.0	1.8e-134
WP_000562174.1|2553869_2554169_+	hypothetical protein	NA	A0A0D4DCL0	Acinetobacter_phage	100.0	1.5e-47
WP_001037047.1|2554208_2554499_+	hypothetical protein	NA	A0A0D4DCB9	Acinetobacter_phage	100.0	7.9e-49
WP_001169164.1|2554556_2554772_+	KTSC domain-containing protein	NA	A0A0D4DBY2	Acinetobacter_phage	100.0	5.0e-32
WP_000276791.1|2554822_2555113_+	hypothetical protein	NA	A0A0D4DBS2	Acinetobacter_phage	100.0	1.5e-44
WP_162216718.1|2555605_2556046_+	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	94.5	4.5e-72
WP_032002963.1|2556048_2556372_+	hypothetical protein	NA	A0A0P0IRC4	Acinetobacter_phage	98.1	7.4e-56
WP_001207471.1|2556383_2557505_+	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	100.0	5.2e-213
WP_162216668.1|2557501_2558578_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	76.3	4.1e-143
WP_000654847.1|2558579_2558825_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.5e-40
WP_038405739.1|2558828_2559236_+	hypothetical protein	NA	A0A0P0I8H3	Acinetobacter_phage	97.0	1.3e-12
WP_000004577.1|2559232_2559628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877062.1|2559624_2559960_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	62.4	3.7e-34
WP_000529848.1|2559960_2560230_+	hypothetical protein	NA	A0A0P0J067	Acinetobacter_phage	100.0	8.7e-42
WP_002118425.1|2560353_2560929_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	98.4	6.1e-109
WP_085944096.1|2561025_2563797_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	97.6	0.0e+00
WP_000281145.1|2563804_2566537_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	97.4	0.0e+00
WP_079261102.1|2566893_2567943_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	99.4	1.1e-188
WP_000608316.1|2567952_2568759_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	97.4	1.4e-143
WP_000066135.1|2568768_2569464_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	97.4	4.6e-119
WP_001164223.1|2569474_2570458_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	92.0	4.9e-175
WP_001076804.1|2570464_2572840_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	98.2	0.0e+00
WP_000893699.1|2572841_2574341_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	95.4	2.2e-275
WP_001187844.1|2574603_2575152_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
>prophage 1
NZ_CP050386	Acinetobacter baumannii strain VB82 plasmid pVB82_1, complete sequence	215278	67552	96539	215278	transposase,protease	Escherichia_phage(50.0%)	20	NA	NA
WP_001067788.1|67552_68257_-|transposase	IS6-like element IS1008 family transposase	transposase	A0A077SL39	Escherichia_phage	84.1	1.1e-117
WP_000960976.1|69139_69712_+	aminoglycoside N-acetyltransferase AAC(6')-Ian	NA	A0A0N9SKF6	Staphylococcus_phage	40.1	8.0e-37
WP_000093022.1|70368_71898_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067788.1|72273_72978_-|transposase	IS6-like element IS1008 family transposase	transposase	A0A077SL39	Escherichia_phage	84.1	1.1e-117
WP_000609033.1|73440_74298_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001123161.1|74623_74836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000604996.1|75343_76144_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_000369784.1|76176_76449_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000897311.1|76441_76762_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000743272.1|77440_78373_-|transposase	IS5-like element IS17 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.3	3.4e-61
WP_001255535.1|79121_80354_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000506885.1|80625_80955_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000205587.1|81163_82030_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000892996.1|82040_82652_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_002010699.1|82669_83245_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_001021842.1|83286_86967_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_001097757.1|87013_90481_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	A0A2R2ZGH5	Clostridioides_phage	22.3	5.3e-06
WP_001052669.1|90524_93149_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_000443162.1|93178_95218_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_001067794.1|95834_96539_-|transposase	IS6-like element IS1007 family transposase	transposase	A0A077SL39	Escherichia_phage	84.1	6.9e-115
>prophage 2
NZ_CP050386	Acinetobacter baumannii strain VB82 plasmid pVB82_1, complete sequence	215278	106036	153023	215278	bacteriocin,transposase	Escherichia_phage(42.86%)	42	NA	NA
WP_001067794.1|106036_106741_+|transposase	IS6-like element IS1007 family transposase	transposase	A0A077SL39	Escherichia_phage	84.1	6.9e-115
WP_104472902.1|107047_107566_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_137987737.1|108167_108473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137987736.1|108485_108761_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000438826.1|109408_109696_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_061855757.1|109682_109997_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_137987739.1|110125_112537_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000761346.1|112841_113303_+	DIP1984 family protein	NA	NA	NA	NA	NA
WP_000470633.1|115041_115674_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	30.1	6.6e-08
WP_001052939.1|115756_116332_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_031380699.1|116447_119228_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_085947913.1|119407_120498_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000262332.1|120599_120932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001992510.1|120939_121494_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_001046004.1|122158_122980_-	carbapenem-hydrolyzing class D beta-lactamase OXA-23	NA	NA	NA	NA	NA
WP_085947913.1|123085_124175_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001282484.1|124888_125062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000504218.1|125061_125433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067794.1|127516_128221_+|transposase	IS6-like element IS1007 family transposase	transposase	A0A077SL39	Escherichia_phage	84.1	6.9e-115
WP_000753507.1|129452_129761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133625.1|130579_130855_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_000842132.1|130876_131989_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.3	1.5e-31
WP_001067788.1|132173_132878_-|transposase	IS6-like element IS1008 family transposase	transposase	A0A077SL39	Escherichia_phage	84.1	1.1e-117
WP_000644490.1|133006_133447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001046277.1|133672_133924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024681.1|133946_134294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045544691.1|134308_136159_-	hypothetical protein	NA	A0A193GYG9	Enterobacter_phage	26.1	1.3e-08
WP_000504197.1|136279_136705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085940413.1|137760_138851_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000941930.1|139529_140357_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000420425.1|140337_140667_+	DUF1456 family protein	NA	NA	NA	NA	NA
WP_002015113.1|140710_140926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038505.1|140966_141302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002015149.1|141333_142245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101323.1|142560_143664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131185.1|143837_146099_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	32.5	4.0e-63
WP_000386247.1|146551_146956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144971.1|147165_148953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001082319.1|149335_150139_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|150138_150975_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000743213.1|151094_151319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|151529_153023_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
