The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP052855	Xylella fastidiosa subsp. multiplex strain Fillmore chromosome, complete genome	2526544	205495	288718	2526544	plate,integrase,tRNA,holin,portal,terminase,tail	Xylella_phage(30.23%)	81	199240:199255	283699:283714
199240:199255	attL	ATCGGTGCTTGCATAG	NA	NA	NA	NA
WP_004085031.1|205495_206515_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	97.3	2.1e-189
WP_038231117.1|206514_206760_-	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	83.1	8.2e-31
WP_169710250.1|208260_208773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004086077.1|208774_209053_-	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	95.6	5.6e-44
WP_169710252.1|209049_211230_-	DNA polymerase	NA	C8CLG0	Xylella_phage	94.2	0.0e+00
WP_169710406.1|211231_212398_-	hypothetical protein	NA	C8CLG1	Xylella_phage	77.3	6.9e-160
WP_169710134.1|212484_213051_-	DUF2815 family protein	NA	C8CLG2	Xylella_phage	95.2	3.9e-100
WP_169710254.1|213047_214328_-	DUF2800 domain-containing protein	NA	C8CLG3	Xylella_phage	92.7	2.9e-228
WP_004086070.1|214324_214813_-	hypothetical protein	NA	C8CLG4	Xylella_phage	95.1	2.6e-60
WP_004086187.1|214812_215007_-	hypothetical protein	NA	C8CLG5	Xylella_phage	98.4	1.6e-26
WP_004086185.1|215038_215230_-	hypothetical protein	NA	C8CLG6	Xylella_phage	75.0	6.8e-17
WP_004086069.1|215253_215445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154437007.1|215441_215849_-	hypothetical protein	NA	C8CLG7	Xylella_phage	80.0	2.8e-52
WP_027700621.1|215845_216316_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_038231390.1|216312_216750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004086362.1|216860_217316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169710256.1|217601_218339_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_169710258.1|218377_218593_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_154128206.1|218851_219043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010894933.1|219070_219259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169710260.1|219255_219504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169710407.1|219782_220352_+	hypothetical protein	NA	C8CLH5	Xylella_phage	69.3	7.9e-69
WP_169710262.1|220487_223019_+	DNA primase	NA	C8CLH6	Xylella_phage	74.4	0.0e+00
WP_021358648.1|223483_223681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169710263.1|223714_224332_+	hypothetical protein	NA	A0A1W6JT18	Escherichia_phage	47.9	3.4e-25
WP_169710265.1|224298_224793_+	lysozyme	NA	A0A2H5BQB7	Pseudomonas_phage	56.7	5.0e-27
WP_169710267.1|224785_225115_+|holin	phage holin family protein	holin	A0A172PZR6	Pseudomonas_phage	44.0	7.4e-19
WP_169710268.1|225104_225566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169710270.1|225567_225792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004086888.1|225922_226498_+|terminase	terminase small subunit	terminase	A0A193GYK5	Enterobacter_phage	58.6	4.3e-46
WP_154128247.1|226490_228443_+|terminase	phage terminase large subunit family protein	terminase	A0A088FQV3	Escherichia_phage	66.6	1.2e-249
WP_004085156.1|228993_230580_+|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	50.9	1.6e-130
WP_004085160.1|232467_232728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154128257.1|232727_233051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169710272.1|233047_233569_+	hypothetical protein	NA	D5LGZ7	Escherichia_phage	34.5	1.3e-12
WP_169710274.1|233544_234087_+	hypothetical protein	NA	A0A1W6JT55	Escherichia_phage	43.2	4.8e-39
WP_169710276.1|234083_234671_+|plate	phage baseplate assembly protein V	plate	R4JMH2	Burkholderia_phage	36.1	2.0e-22
WP_004086966.1|234707_234989_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_004086967.1|234975_235239_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_004085176.1|235388_235727_+	GPW/gp25 family protein	NA	A0A088FV58	Escherichia_phage	60.4	9.3e-33
WP_154128227.1|235726_236620_+|plate	baseplate J/gp47 family protein	plate	V9IQV9	Stenotrophomonas_phage	46.4	3.9e-70
WP_004086970.1|236612_237170_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.4	6.6e-52
WP_169710278.1|237177_238770_+|tail	tail fiber domain-containing protein	tail	V9IQX0	Stenotrophomonas_phage	35.7	1.0e-81
WP_169710148.1|238834_240013_+|tail	phage tail sheath family protein	tail	A0A088FVH5	Escherichia_phage	55.2	1.7e-134
WP_004085181.1|240012_240522_+|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	53.3	1.8e-48
WP_169710280.1|240524_240812_+|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	43.4	4.0e-13
WP_169710282.1|243147_243630_+|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	46.8	2.0e-28
WP_040123123.1|243626_243845_+|tail	tail protein	tail	A0A1W6JT40	Escherichia_phage	48.6	2.0e-12
WP_169710284.1|243835_244918_+	phage late control D family protein	NA	A0A088FRU7	Escherichia_phage	45.3	6.3e-91
WP_004086320.1|245344_246274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143704329.1|246483_246705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004086316.1|247031_247631_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004086315.1|247695_248148_+	CopD family protein	NA	NA	NA	NA	NA
WP_012337572.1|248313_249273_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_128723644.1|249367_252949_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.4	5.3e-187
WP_012337574.1|253237_254164_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	33.7	7.4e-48
WP_004086308.1|254701_255031_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_004086307.1|255075_255747_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_027700348.1|256649_258125_+	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	29.8	3.5e-36
WP_012337576.1|258278_258863_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.7	2.9e-66
WP_004086298.1|258931_259966_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.9	8.7e-74
WP_004086297.1|260050_260845_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	54.6	8.8e-66
WP_004086296.1|260841_261564_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_004086295.1|262548_263055_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004086294.1|264789_265992_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_169710286.1|266179_268006_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_004086289.1|270285_271440_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	6.1e-84
WP_027700344.1|271562_271913_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_004086285.1|271979_273824_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004086283.1|273843_274809_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.8	9.4e-30
WP_004086282.1|275144_276410_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.7	2.7e-24
WP_012337581.1|276409_276928_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004086274.1|276960_277779_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.9	2.2e-35
WP_004086273.1|277775_278621_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_004086272.1|278703_279084_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_004086271.1|279087_280596_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_021358323.1|282349_282949_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004086267.1|282945_284457_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
283699:283714	attR	ATCGGTGCTTGCATAG	NA	NA	NA	NA
WP_004086265.1|284552_287231_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	21.9	7.6e-21
WP_004086263.1|287341_287719_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_004086261.1|287815_288718_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP052855	Xylella fastidiosa subsp. multiplex strain Fillmore chromosome, complete genome	2526544	423750	548565	2526544	plate,integrase,tRNA,protease,holin,capsid,portal,terminase,tail	Escherichia_phage(20.93%)	107	468828:468848	558949:558969
WP_011097581.1|423750_424248_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYZ2	Pandoravirus	36.0	3.7e-06
WP_050765460.1|424255_424738_-	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_004085230.1|424938_426315_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_004085229.1|426845_427610_-	arginyltransferase	NA	NA	NA	NA	NA
WP_004085228.1|428033_428525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049756303.1|428528_429380_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_004085334.1|430294_430624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169709920.1|431749_434626_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_004085225.1|435925_437908_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_004085224.1|438562_441154_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_154128333.1|443054_446081_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004085222.1|446186_447629_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	31.1	2.0e-47
WP_021358468.1|448778_450086_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_004085220.1|450950_451655_-	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	38.3	1.0e-25
WP_004085219.1|451711_452869_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011097591.1|452945_453737_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_004085217.1|453758_454241_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_004085216.1|454237_455254_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_004085215.1|455441_457796_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_004085214.1|457894_459229_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_169710112.1|459255_460446_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_004085212.1|460442_461297_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004085211.1|461293_462061_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	34.8	1.6e-16
WP_004089320.1|462063_462621_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_004085207.1|464994_465675_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004085206.1|465786_466107_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_004085205.1|467317_468049_-	UMP kinase	NA	NA	NA	NA	NA
WP_004085344.1|468493_468742_+	hypothetical protein	NA	NA	NA	NA	NA
468828:468848	attL	TGCGTCTACCAATTCCGCCAC	NA	NA	NA	NA
WP_004085204.1|469442_470102_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_004085203.1|470198_472115_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_004085202.1|472213_472933_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_004085201.1|472929_473943_-	glucokinase	NA	NA	NA	NA	NA
WP_021358465.1|473939_475373_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.2	5.8e-68
WP_012337631.1|475701_476796_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.0	2.1e-25
WP_004085198.1|476940_477744_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_004085343.1|478056_478275_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_021358463.1|478332_478755_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004085197.1|478751_479135_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_004085196.1|479142_480933_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_004085195.1|480953_481739_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004085194.1|481859_482108_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_012337633.1|482130_482511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004085192.1|482536_483778_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004085191.1|483770_484493_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	37.2	1.6e-34
WP_012337634.1|484840_487318_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	34.3	1.4e-05
WP_004085189.1|487302_487965_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_004089267.1|487969_488407_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_004085187.1|488424_490173_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.8	5.7e-49
WP_004085186.1|490169_491189_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_169710284.1|491563_492646_-	phage late control D family protein	NA	A0A088FRU7	Escherichia_phage	45.3	6.3e-91
WP_040123123.1|492636_492855_-|tail	tail protein	tail	A0A1W6JT40	Escherichia_phage	48.6	2.0e-12
WP_169710282.1|492851_493334_-|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	46.8	2.0e-28
WP_169710408.1|493330_495544_-|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	46.0	4.7e-101
WP_169710280.1|495670_495958_-|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	43.4	4.0e-13
WP_004085181.1|495960_496470_-|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	53.3	1.8e-48
WP_169710278.1|497711_499304_-|tail	tail fiber domain-containing protein	tail	V9IQX0	Stenotrophomonas_phage	35.7	1.0e-81
WP_004086970.1|499311_499869_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.4	6.6e-52
WP_154128227.1|499861_500755_-|plate	baseplate J/gp47 family protein	plate	V9IQV9	Stenotrophomonas_phage	46.4	3.9e-70
WP_004085176.1|500754_501093_-	GPW/gp25 family protein	NA	A0A088FV58	Escherichia_phage	60.4	9.3e-33
WP_004087029.1|501226_501541_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	O64357	Escherichia_phage	30.4	1.6e-07
WP_004087027.1|501542_501824_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_004087025.1|501835_502135_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	49.4	1.2e-15
WP_169710296.1|502139_502727_-|plate	phage baseplate assembly protein V	plate	R4JMH2	Burkholderia_phage	36.5	1.2e-22
WP_154128253.1|502723_503266_-	hypothetical protein	NA	A0A1W6JT55	Escherichia_phage	42.1	1.2e-37
WP_169710298.1|503241_503763_-	hypothetical protein	NA	D5LGZ7	Escherichia_phage	35.4	7.4e-13
WP_154436962.1|503759_504083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169710299.1|504082_504343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085158.1|504360_506235_-|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	48.4	4.8e-163
WP_004085156.1|506231_507818_-|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	50.9	1.6e-130
WP_038230179.1|507814_508366_-	hypothetical protein	NA	V5YTG8	Pseudomonas_phage	51.7	2.6e-40
WP_154128247.1|508369_510322_-|terminase	phage terminase large subunit family protein	terminase	A0A088FQV3	Escherichia_phage	66.6	1.2e-249
WP_004086888.1|510314_510890_-|terminase	terminase small subunit	terminase	A0A193GYK5	Enterobacter_phage	58.6	4.3e-46
WP_169710301.1|511020_511245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169709972.1|511246_511708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085022.1|511697_512027_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_169710303.1|512019_512520_-	lysozyme	NA	I2GUG4	Acinetobacter_phage	52.1	2.5e-26
WP_004085024.1|512619_513351_-	site-specific DNA-methyltransferase	NA	A0A097EWK8	Mycobacterium_phage	53.2	2.9e-63
WP_004085025.1|513540_513876_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_004089517.1|513872_514127_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_004085026.1|514179_514902_-	hypothetical protein	NA	C8CLH7	Xylella_phage	82.1	1.8e-105
WP_162010044.1|514844_515192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169710305.1|516644_516923_+	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	95.6	3.3e-44
WP_004085029.1|516924_517329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169710307.1|517413_518832_+	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	96.6	2.9e-269
WP_004086189.1|518828_518993_+	hypothetical protein	NA	C8CLF6	Xylella_phage	96.3	6.7e-21
WP_004086191.1|518985_519234_+	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	89.0	2.2e-36
WP_169710308.1|519233_520253_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	90.3	1.2e-171
WP_004085684.1|521029_521671_+	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	40.7	3.4e-12
WP_004085683.1|521698_522175_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_004085682.1|522179_522752_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_038231298.1|522748_524707_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_071869548.1|525691_526084_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004085680.1|527370_527856_-	asparaginase	NA	NA	NA	NA	NA
WP_004085679.1|528098_528698_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004085726.1|529099_529243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004085678.1|529272_530457_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	34.3	1.4e-51
WP_004085677.1|530645_531221_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027700073.1|532574_532868_-	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_004085676.1|532952_535724_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	29.3	3.7e-63
WP_004085675.1|536380_537094_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_031345756.1|537291_538416_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	A0A0P0IKJ1	Acinetobacter_phage	25.1	1.8e-08
WP_004085673.1|538614_541857_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_027700071.1|541865_542330_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_004085671.1|542337_543258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161632202.1|543260_545069_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_100206163.1|545736_546861_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	44.8	1.2e-07
WP_169710310.1|547044_548565_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.1	2.9e-86
558949:558969	attR	TGCGTCTACCAATTCCGCCAC	NA	NA	NA	NA
>prophage 3
NZ_CP052855	Xylella fastidiosa subsp. multiplex strain Fillmore chromosome, complete genome	2526544	674040	717320	2526544	plate,integrase,holin,capsid,terminase,tail	Xylella_phage(18.42%)	64	670478:670523	715691:715736
670478:670523	attL	CTGGTGGGCCGTGCTGGAATCGAACCAGCGACCAGCGGATTAAAAG	NA	NA	NA	NA
WP_169710316.1|674040_674268_+	hypothetical protein	NA	C8CLJ6	Xylella_phage	64.5	2.6e-15
WP_169710168.1|674268_675432_-|tail	tail fiber protein	tail	A4PE46	Ralstonia_virus	32.0	1.9e-08
WP_004084996.1|675435_675996_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	26.8	8.5e-07
WP_169710318.1|675992_677138_-|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	48.7	4.8e-97
WP_004085590.1|677240_677537_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	54.7	9.0e-24
WP_004085592.1|677539_677833_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	37.9	6.2e-09
WP_169710320.1|677888_678242_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	51.3	5.7e-25
WP_012382583.1|678238_678880_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	36.8	7.4e-31
WP_004085594.1|678876_679707_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	51.5	6.8e-77
WP_169710077.1|679703_680021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169710321.1|680020_680791_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	35.9	1.7e-29
WP_004091377.1|680901_681129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004087087.1|681112_681379_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	41.9	2.3e-15
WP_169710323.1|681389_683279_-	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	28.0	1.8e-24
WP_004085005.1|683426_683849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085006.1|683845_684283_-	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	61.0	2.0e-43
WP_004085008.1|685788_686322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337896.1|686245_686626_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	40.4	6.5e-19
WP_012337897.1|686600_687080_-	hypothetical protein	NA	M4SN98	Psychrobacter_phage	29.3	7.8e-09
WP_004085010.1|687076_687448_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	38.3	5.2e-13
WP_169710324.1|687450_687822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038231112.1|687884_688868_-	DUF2184 domain-containing protein	NA	A0A2R3UA82	Siphoviridae_environmental_samples	39.0	1.1e-49
WP_004085013.1|688877_689360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337902.1|689369_690578_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	42.2	3.3e-40
WP_169710326.1|690577_691423_-|capsid	minor capsid protein	capsid	Q7Y5U5	Haemophilus_phage	34.2	8.3e-30
WP_169710409.1|691334_692684_-	DUF1073 domain-containing protein	NA	L0MZ02	Edwardsiella_phage	36.8	3.1e-63
WP_004085019.1|692764_694315_-|terminase	phage terminase large subunit	terminase	H9C0C7	Vibrio_phage	44.4	3.0e-110
WP_004085020.1|694265_694664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085111.1|694754_694967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169710268.1|694968_695430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085022.1|695419_695749_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_169710328.1|695741_696242_-	lysozyme	NA	A0A2H5BQB7	Pseudomonas_phage	53.9	3.3e-26
WP_169710330.1|696408_697107_-	hypothetical protein	NA	C8CLH7	Xylella_phage	83.0	7.4e-101
WP_004085693.1|697235_697646_-	hypothetical protein	NA	A0A088F6Y8	Sulfitobacter_phage	43.0	2.4e-11
WP_169710331.1|697651_699112_-	replicative DNA helicase	NA	O80281	Escherichia_phage	39.3	1.3e-70
WP_004086913.1|699108_699957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004086925.1|699958_700237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004086911.1|700215_701328_-	hypothetical protein	NA	C8CLG1	Xylella_phage	58.6	2.1e-110
WP_169710410.1|701357_702146_-	hypothetical protein	NA	C8CLH5	Xylella_phage	55.0	3.6e-27
WP_169710333.1|702403_702769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038231490.1|702765_703014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020851634.1|703010_703199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154128206.1|703226_703418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038211690.1|703676_703922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004087040.1|704750_705362_-	Fic family protein	NA	NA	NA	NA	NA
WP_004087046.1|705358_705547_-	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_004086362.1|705927_706383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038231390.1|706493_706931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027700621.1|706927_707398_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_154437007.1|707394_707802_+	hypothetical protein	NA	C8CLG7	Xylella_phage	80.0	2.8e-52
WP_004086069.1|707798_707990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169710335.1|708033_708561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154128433.1|708679_708871_+	hypothetical protein	NA	C8CLG6	Xylella_phage	73.4	1.7e-15
WP_004086369.1|708891_709254_+	hypothetical protein	NA	U5P4J6	Shigella_phage	43.8	1.7e-16
WP_154128435.1|709275_710097_+	DUF2303 family protein	NA	K7ZMK3	Xanthomonas_citri_phage	43.3	8.0e-54
WP_154128436.1|710112_711033_+	phage recombination protein Bet	NA	U6C6J0	Ralstonia_phage	49.8	3.2e-59
WP_154128438.1|711029_712673_+	YqaJ viral recombinase family protein	NA	U6C712	Ralstonia_phage	37.3	2.4e-94
WP_038231394.1|713044_713680_+	phage antirepressor protein	NA	A4PE61	Ralstonia_virus	48.0	1.7e-19
WP_154128441.1|713746_714193_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	52.9	1.4e-33
WP_128723906.1|714211_714487_+	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	51.7	2.2e-08
WP_169709952.1|714486_715671_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	47.3	6.7e-94
WP_120279367.1|716406_716562_+	hypothetical protein	NA	NA	NA	NA	NA
715691:715736	attR	CTGGTGGGCCGTGCTGGAATCGAACCAGCGACCAGCGGATTAAAAG	NA	NA	NA	NA
WP_004084058.1|716558_716867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004084284.1|717182_717320_+	hypothetical protein	NA	C8CLI3	Xylella_phage	62.8	2.3e-06
>prophage 4
NZ_CP052855	Xylella fastidiosa subsp. multiplex strain Fillmore chromosome, complete genome	2526544	789513	797949	2526544	portal,transposase	Pseudomonas_phage(33.33%)	9	NA	NA
WP_004083947.1|789513_790029_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	32.8	7.3e-13
WP_004083945.1|790562_790991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004083943.1|790987_791224_+	hypothetical protein	NA	A0A0A1IV01	Pseudomonas_phage	53.0	6.3e-12
WP_169710337.1|791213_794039_+	hypothetical protein	NA	A0A1L2C8W7	Pseudomonas_phage	28.8	2.4e-57
WP_169709957.1|794031_794544_+	hypothetical protein	NA	G8CLC0	Synechococcus_phage	31.2	1.4e-08
WP_004083636.1|794547_794967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169710338.1|795042_795738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038230952.1|796132_796759_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	62.9	1.4e-63
WP_004083925.1|796752_797949_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	38.9	4.5e-66
>prophage 5
NZ_CP052855	Xylella fastidiosa subsp. multiplex strain Fillmore chromosome, complete genome	2526544	1055410	1079919	2526544	integrase,holin	Xylella_phage(68.18%)	25	1045612:1045625	1060915:1060928
1045612:1045625	attL	TTAGCGGGCAATAC	NA	NA	NA	NA
WP_027700554.1|1055410_1056778_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.6	2.9e-109
WP_004083658.1|1057277_1058687_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_169710343.1|1058827_1059847_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	89.7	7.6e-171
WP_049756312.1|1060154_1060595_+	SocA family protein	NA	K4NZT7	Burkholderia_phage	33.3	9.9e-11
WP_004083655.1|1060691_1061234_-	pilin	NA	NA	NA	NA	NA
1060915:1060928	attR	TTAGCGGGCAATAC	NA	NA	NA	NA
WP_004084093.1|1061473_1061827_-	hypothetical protein	NA	C8CLJ8	Xylella_phage	54.7	3.4e-22
WP_004083654.1|1061823_1062606_-	hypothetical protein	NA	C8CLJ7	Xylella_phage	66.0	4.5e-91
WP_041572637.1|1062639_1063524_-	hypothetical protein	NA	C8CLJ3	Xylella_phage	58.9	1.0e-83
WP_080513455.1|1063513_1063903_-	hypothetical protein	NA	C8CLJ3	Xylella_phage	61.2	1.2e-28
WP_004083651.1|1064286_1065498_-	hypothetical protein	NA	C8CLJ2	Xylella_phage	61.7	1.6e-119
WP_004083650.1|1065501_1066257_-	hypothetical protein	NA	C8CLJ1	Xylella_phage	72.5	3.5e-56
WP_004084211.1|1066306_1066552_-	hypothetical protein	NA	C8CLJ0	Xylella_phage	80.6	1.0e-28
WP_004083649.1|1066521_1068189_-	hypothetical protein	NA	C8CLI9	Xylella_phage	59.6	1.3e-225
WP_004083648.1|1068185_1068593_-	hypothetical protein	NA	C8CLI8	Xylella_phage	60.3	2.5e-32
WP_169710344.1|1068596_1069826_-	hypothetical protein	NA	C8CLI7	Xylella_phage	71.6	1.5e-165
WP_004083646.1|1069863_1070721_-	hypothetical protein	NA	C8CLI6	Xylella_phage	49.3	1.7e-46
WP_004083645.1|1070740_1072762_-	hypothetical protein	NA	C8CLI5	Xylella_phage	77.7	3.2e-298
WP_004083644.1|1072764_1074183_-	DNA packaging protein	NA	C8CLI4	Xylella_phage	80.6	3.0e-234
WP_021358615.1|1074088_1074415_-	hypothetical protein	NA	C8CLI3	Xylella_phage	63.9	3.1e-33
WP_004083643.1|1075165_1075519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004083642.1|1075520_1075835_-|holin	phage holin family protein	holin	A0A172PZR6	Pseudomonas_phage	32.3	6.2e-07
WP_012337789.1|1075827_1076322_-	lysozyme	NA	A0A2I7RLY1	Vibrio_phage	53.8	2.6e-28
WP_004083639.1|1076421_1076943_-	site-specific DNA-methyltransferase	NA	A0A097EWK8	Mycobacterium_phage	53.2	8.6e-38
WP_169710345.1|1076927_1079414_+	hypothetical protein	NA	A0A2D2W222	Stenotrophomonas_phage	30.9	1.5e-58
WP_169709957.1|1079406_1079919_+	hypothetical protein	NA	G8CLC0	Synechococcus_phage	31.2	1.4e-08
>prophage 6
NZ_CP052855	Xylella fastidiosa subsp. multiplex strain Fillmore chromosome, complete genome	2526544	1396739	1444188	2526544	plate,integrase,holin,capsid,terminase,tail	Haemophilus_phage(25.81%)	59	1430502:1430518	1447214:1447230
WP_004084990.1|1396739_1397615_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	4.9e-09
WP_004084992.1|1397611_1398580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004084994.1|1398838_1399285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154128165.1|1399477_1400632_-|tail	tail fiber protein	tail	A4PE46	Ralstonia_virus	32.0	1.9e-08
WP_004084996.1|1400635_1401196_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	26.8	8.5e-07
WP_169710358.1|1401192_1402338_-|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	49.2	9.6e-98
WP_020851652.1|1402430_1402784_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	51.3	3.3e-25
WP_012382583.1|1402780_1403422_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	36.8	7.4e-31
WP_004085594.1|1403418_1404249_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	51.5	6.8e-77
WP_169710077.1|1404245_1404563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169710359.1|1404562_1405333_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	35.5	6.4e-29
WP_024749166.1|1405423_1405723_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	49.5	3.9e-19
WP_004085003.1|1405726_1406035_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	46.7	1.4e-16
WP_004085594.1|1406709_1407540_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	51.5	6.8e-77
WP_169710077.1|1407536_1407854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169710321.1|1407853_1408624_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	35.9	1.7e-29
WP_004091377.1|1408734_1408962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004087087.1|1408945_1409212_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	41.9	2.3e-15
WP_169710323.1|1409222_1411112_-	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	28.0	1.8e-24
WP_004085005.1|1411258_1411681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085006.1|1411677_1412115_-	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	61.0	2.0e-43
WP_004085007.1|1412124_1413621_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	48.4	6.4e-126
WP_004085008.1|1413621_1414155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337896.1|1414078_1414459_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	40.4	6.5e-19
WP_012337897.1|1414433_1414913_-	hypothetical protein	NA	M4SN98	Psychrobacter_phage	29.3	7.8e-09
WP_004085010.1|1414909_1415281_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	38.3	5.2e-13
WP_169710324.1|1415283_1415655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038231112.1|1415717_1416701_-	DUF2184 domain-containing protein	NA	A0A2R3UA82	Siphoviridae_environmental_samples	39.0	1.1e-49
WP_004085013.1|1416710_1417193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337902.1|1417202_1418411_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	42.2	3.3e-40
WP_169710326.1|1418410_1419256_-|capsid	minor capsid protein	capsid	Q7Y5U5	Haemophilus_phage	34.2	8.3e-30
WP_169710409.1|1419167_1420517_-	DUF1073 domain-containing protein	NA	L0MZ02	Edwardsiella_phage	36.8	3.1e-63
WP_004085019.1|1420597_1422148_-|terminase	phage terminase large subunit	terminase	H9C0C7	Vibrio_phage	44.4	3.0e-110
WP_004085020.1|1422098_1422497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085111.1|1422588_1422801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169710268.1|1422802_1423264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085022.1|1423253_1423583_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_169710328.1|1423575_1424076_-	lysozyme	NA	A0A2H5BQB7	Pseudomonas_phage	53.9	3.3e-26
WP_169710330.1|1424242_1424941_-	hypothetical protein	NA	C8CLH7	Xylella_phage	83.0	7.4e-101
WP_128283795.1|1425069_1425480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038231304.1|1425844_1427710_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_004085711.1|1427706_1428342_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_004085709.1|1429091_1429550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085707.1|1429757_1430255_-	hypothetical protein	NA	NA	NA	NA	NA
1430502:1430518	attL	AACCGCGACATTACGTC	NA	NA	NA	NA
WP_004085705.1|1430878_1431883_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_012337912.1|1432444_1432828_-	VOC family protein	NA	NA	NA	NA	NA
WP_004085734.1|1432981_1433314_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_004085701.1|1434169_1435504_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_027700580.1|1435598_1436453_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_004085698.1|1436944_1437718_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004085697.1|1437714_1438179_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_004085696.1|1438340_1438679_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	54.9	1.0e-07
WP_004085695.1|1438665_1438926_-	BrnT family toxin	NA	K4NX81	Burkholderia_phage	40.7	5.7e-06
WP_004085694.1|1439114_1439813_-	hypothetical protein	NA	C8CLH7	Xylella_phage	81.7	4.8e-100
WP_004085691.1|1440403_1441168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169710360.1|1441782_1442289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085686.1|1442662_1442902_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_038231301.1|1442920_1443169_+	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	86.6	1.9e-35
WP_169710343.1|1443168_1444188_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	89.7	7.6e-171
1447214:1447230	attR	AACCGCGACATTACGTC	NA	NA	NA	NA
