The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP052852	Bordetella holmesii strain J862 chromosome, complete genome	3699764	1095249	1203195	3699764	transposase,tRNA,protease	Leptospira_phage(19.35%)	94	NA	NA
WP_005011985.1|1095249_1096470_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012606.1|1097498_1098488_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098608_1099490_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099663_1100518_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100549_1101398_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101525_1102746_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102764_1103331_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103528_1104680_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104818_1105823_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1105979_1106951_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107029_1107818_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107889_1108126_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108134_1109046_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109089_1110961_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111121_1111919_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112150_1112525_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112601_1112925_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113008_1113281_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113295_1113751_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113872_1114709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114705_1116079_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116155_1117112_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117199_1118177_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118301_1119957_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120005_1120470_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120466_1120928_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121153_1122341_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122337_1123642_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_169510515.1|1123638_1125048_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125241_1126361_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126496_1127516_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127524_1130230_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130369_1131023_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131085_1131448_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132014_1133475_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133737_1134811_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134895_1136116_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137873_1138994_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138967_1140467_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140480_1141584_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141588_1142839_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142835_1144281_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144277_1144592_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144593_1145712_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145894_1147115_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147214_1148081_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148141_1149122_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149268_1150189_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150197_1151310_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151391_1152213_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152288_1152897_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153034_1154411_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154472_1154916_+	cytochrome c	NA	NA	NA	NA	NA
WP_076879520.1|1154982_1155654_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1155681_1156801_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156926_1157208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157918_1158707_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158703_1159810_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160484_1161843_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1161957_1162155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162172_1163293_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163386_1163941_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164528_1165845_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165857_1166871_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167417_1168368_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168447_1168747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170107_1171766_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171914_1173135_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173252_1174536_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174539_1175481_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175590_1176049_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176429_1177050_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177457_1179878_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1179985_1180723_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180769_1182014_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182336_1182609_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_025341373.1|1183135_1183921_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1183942_1184860_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184859_1185369_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185485_1186157_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_100225809.1|1186212_1187334_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.9e-14
WP_005012781.1|1187353_1189198_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189334_1190522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557744.1|1191288_1192409_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_101557770.1|1192832_1193952_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1194056_1195394_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1195503_1196445_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1196500_1197682_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1197840_1198131_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1198177_1198846_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1198842_1199130_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1199506_1200292_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1200324_1201059_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1201974_1203195_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP052852	Bordetella holmesii strain J862 chromosome, complete genome	3699764	1207982	1275696	3699764	transposase,tRNA,protease,holin	Ralstonia_virus(17.65%)	53	NA	NA
WP_005012808.1|1207982_1208933_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1209014_1209494_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_005012811.1|1210705_1211905_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1212050_1212428_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1212451_1214233_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1214241_1214979_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1215263_1216823_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1216882_1217641_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1217737_1218394_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1218547_1219312_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1219326_1219506_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1219531_1220566_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1220562_1220976_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_025341375.1|1220972_1221569_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1221909_1223268_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1223361_1223940_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1224064_1225185_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1225257_1226514_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1226617_1227823_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1227886_1228336_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1228468_1228714_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1228938_1229253_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_101558028.1|1234416_1236612_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1236665_1238975_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1240328_1241996_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1241998_1242664_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1242796_1246603_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1246828_1247974_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1248092_1249022_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1249018_1250095_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1250091_1250898_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1250894_1251626_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1252002_1253241_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1253288_1253627_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005011985.1|1255390_1256611_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1256704_1257925_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1257984_1258248_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1258369_1259869_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012868.1|1260289_1260487_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1260502_1260862_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1260934_1261957_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1261969_1264387_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005012872.1|1264404_1264746_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	43.3	1.3e-13
WP_005012873.1|1264803_1265202_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017685459.1|1265424_1265991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685460.1|1266021_1266750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012882.1|1267131_1267386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012883.1|1267672_1268416_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012885.1|1268443_1269433_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012887.1|1269463_1270468_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012888.1|1272348_1272558_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	57.1	8.6e-13
WP_005012891.1|1272953_1273700_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	31.2	7.3e-22
WP_005012893.1|1273734_1275696_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	29.9	2.3e-27
>prophage 3
NZ_CP052852	Bordetella holmesii strain J862 chromosome, complete genome	3699764	1587925	1694155	3699764	integrase,transposase,tRNA	Leptospira_phage(14.29%)	99	1645200:1645216	1690866:1690882
WP_005011985.1|1587925_1589146_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1589500_1589977_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1590235_1590844_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1590862_1591534_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1591707_1593594_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1593621_1594464_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1594460_1595804_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1595988_1596804_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1596869_1598351_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1598549_1600622_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1600841_1601879_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1603065_1603923_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1603950_1604727_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1605554_1606064_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1607141_1607912_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1607908_1608919_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1608977_1610058_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1610226_1611346_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1611347_1612091_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1612095_1612467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1612527_1612773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1612879_1614379_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1615000_1615336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1615594_1615726_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_025341425.1|1615824_1616253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1616262_1616637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1616727_1618020_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1618136_1619036_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1619187_1619406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026087879.1|1619879_1621556_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1621740_1623264_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1623235_1623931_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1624271_1625333_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1625378_1625930_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1625936_1626857_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1626996_1629294_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1629349_1630570_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1630828_1631434_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1631444_1632605_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1632626_1633508_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1633804_1634503_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1634644_1635367_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1635485_1636424_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1636454_1637234_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_025341426.1|1637271_1638444_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_005013579.1|1638448_1639996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1640031_1640565_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1640808_1641504_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1641518_1641650_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1641697_1642822_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1642827_1645167_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1645163_1645571_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1645200:1645216	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1645832_1646093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1646315_1647266_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1647364_1648315_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1648364_1649573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1649794_1650334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1650558_1650963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1651027_1651783_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1651782_1653144_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1653140_1653764_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1653807_1654927_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1655579_1656335_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013596.1|1656511_1657306_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1657302_1657740_+	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_153566127.1|1657851_1658004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1658424_1659393_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1659549_1660557_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1660614_1661073_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1661146_1662493_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1662510_1662882_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1662881_1664351_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_025341430.1|1664497_1665232_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1665245_1667960_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1668211_1669576_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1669615_1670674_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1670701_1671520_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1671557_1671836_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1673099_1673399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1673968_1675372_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1675384_1676035_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1676176_1677397_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1677427_1678504_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1678650_1679781_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1679967_1681593_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1681599_1682415_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1682429_1683500_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1683551_1684211_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1684850_1686013_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1686054_1686369_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1686352_1686739_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1686777_1687044_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1687436_1688126_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1688225_1688387_-	RcnB family protein	NA	NA	NA	NA	NA
WP_017685992.1|1688537_1688702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1689254_1689503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1689616_1690987_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1690866:1690882	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1690987_1691728_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1692202_1694155_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP052852	Bordetella holmesii strain J862 chromosome, complete genome	3699764	1712449	1757425	3699764	integrase,transposase,tRNA,holin	Leptospira_phage(36.36%)	37	1755993:1756007	1762469:1762483
WP_005019367.1|1712449_1715311_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1715300_1716266_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1717022_1718498_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1718502_1718778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1719114_1720234_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013660.1|1720535_1721744_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1721740_1724023_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1724033_1726415_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|1726780_1727731_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_025341436.1|1727727_1729653_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1729649_1730540_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1730546_1731680_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1731679_1732501_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1732525_1733716_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1734017_1734299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1734824_1735911_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1736107_1736368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1736860_1737631_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1737627_1738638_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1738672_1739515_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1739977_1740763_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1741622_1742742_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1743808_1744813_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1744888_1745701_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_017685973.1|1745722_1745899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013676.1|1745928_1748100_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1748153_1749473_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1749561_1750782_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1751000_1751861_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1751857_1753081_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1753379_1753877_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1753915_1754698_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1754723_1754942_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1755016_1755286_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1755505_1755970_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1755993:1756007	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1756043_1756325_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1756441_1757425_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1762469:1762483	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP052852	Bordetella holmesii strain J862 chromosome, complete genome	3699764	1782700	1845428	3699764	transposase	Ralstonia_virus(33.33%)	54	NA	NA
WP_005012067.1|1782700_1783651_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1783647_1784163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100225817.1|1784568_1785141_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1785240_1785492_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_169510517.1|1785579_1787046_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1787054_1790225_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1790237_1791434_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_025341441.1|1791643_1792555_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1792623_1793355_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1793420_1794056_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1794041_1795220_-	arabinose transporter	NA	NA	NA	NA	NA
WP_005013721.1|1795380_1795929_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1796009_1796369_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1796416_1797637_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1797712_1798834_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1798871_1799585_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1799595_1800816_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013727.1|1801598_1802549_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1802508_1802670_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1802710_1803637_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1803650_1804523_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1804685_1805633_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1805971_1806553_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1807130_1808081_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1808060_1808813_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1808825_1809557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1809713_1811879_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1811968_1812238_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005013740.1|1812531_1813050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1813068_1813848_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1814015_1815032_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1815104_1815596_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1815606_1817322_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1818485_1819436_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1821087_1822329_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1822340_1823114_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1823140_1824091_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814011.1|1824189_1824972_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003814013.1|1827013_1828399_+	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_005013750.1|1828417_1829023_+	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_005013751.1|1829019_1830876_+	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_005013752.1|1830872_1831673_+	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_005013753.1|1831687_1832881_+	alcaligin siderophore biosynthesis protein AlcE	NA	NA	NA	NA	NA
WP_005013754.1|1832948_1833923_+	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_005013755.1|1834045_1835269_+	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
WP_005013756.1|1835379_1837584_+	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_005013757.1|1837878_1838508_+	MarC family protein	NA	NA	NA	NA	NA
WP_025341443.1|1838515_1838722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080601046.1|1840007_1840703_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005013759.1|1840686_1841667_+	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.2	5.6e-14
WP_005013761.1|1841809_1842304_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005013762.1|1842305_1843223_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_005013763.1|1843302_1844487_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005013764.1|1844477_1845428_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP052852	Bordetella holmesii strain J862 chromosome, complete genome	3699764	2289994	2429067	3699764	integrase,transposase,tRNA,protease	Leptospira_phage(14.29%)	118	2283553:2283612	2370345:2370867
2283553:2283612	attL	ACATGGATCCTCCGATAGCCGTAGCGTCGTTTCGCCACTGCCATCTCTTTCATGCGCTCG	NA	NA	NA	NA
WP_005011985.1|2289994_2291215_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014428.1|2291263_2291929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005019657.1|2291976_2292972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014433.1|2296149_2297064_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014435.1|2297213_2298179_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005014437.1|2298186_2298603_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014438.1|2298599_2299517_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014440.1|2299528_2299948_+	EthD family reductase	NA	NA	NA	NA	NA
WP_005014441.1|2299856_2301245_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019661.1|2301241_2301493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014444.1|2301663_2302620_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014448.1|2302864_2303638_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005019667.1|2303634_2304768_+	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_005014461.1|2304777_2305728_+	D-3-phosphoglycerate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	28.4	4.8e-18
WP_005014462.1|2305759_2306560_+	aldolase	NA	NA	NA	NA	NA
WP_101557807.1|2307556_2308719_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2308831_2309800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2309796_2310717_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_005019672.1|2315670_2320005_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2320643_2321207_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2321218_2321464_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2321619_2322129_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2322174_2323155_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2323366_2325718_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_025341471.1|2325764_2326571_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2326591_2327281_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2327273_2328554_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2328651_2329590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2329571_2331278_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2331355_2332459_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2332511_2333261_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_169510521.1|2333267_2334782_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.6	3.4e-82
WP_005019680.1|2334794_2335082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2335102_2335990_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2336140_2336647_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2336643_2337600_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2337787_2339134_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_025341181.1|2339101_2339332_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2339361_2339925_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2340079_2340850_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2340846_2341857_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2342171_2342618_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2342673_2342868_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2342869_2343211_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2343220_2345083_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2345122_2345629_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2345632_2345956_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2345957_2346362_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2346398_2347610_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2347631_2348180_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2348404_2348896_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2349110_2351141_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2351215_2352418_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2352960_2353896_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2354929_2355211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2355297_2355471_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2355582_2355927_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2355998_2356667_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_005014572.1|2358082_2359126_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2359122_2359224_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2359315_2360435_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2360685_2361339_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
WP_032974133.1|2361454_2362675_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2362725_2365155_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2365320_2366619_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2366723_2367377_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2367379_2368690_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2368917_2369457_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2369935_2370202_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2370240_2370606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2370487_2371498_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
2370345:2370867	attR	CGAGCGCATGAAAGAGATGGCAGTGGCGAAACGACGCTACGGCTATCGGAGGATCCATGTCAGCGCCGATGTAATACTGACCCACCGCGTCGGAGTAAATCTGACCCACCTGGGCGATGATGGCGGCCTTTTGGCCGCCGACAATGTTGACTCAGGAGCAAGCAGTGGAGATCAAGGTAATGGCGCGTCGCGGCGTCAGCATTCGGGAGATGGCCAAGCAGCTGGGCTGCTCACGCAACACGATCAGGCGGTATCTGCGTGAGGCTGGTGCCCAGCAGTACAAGCCCCGCGAGGCACGGACCACCAAGCTGGATCCGTACAAGGACTATCTGCACGGGCGCATCGAGGCGGCCCGGCCGCACTGGATTCCAGCAGCCGTGCTGCTGCGGGAGATTCAAGAACTGGGCTACCCCGGTGGTGTAACGCAGCTCAAGGAGTTTCTTAGCGGCTACAAGCACCAGGAGCCTGAACCGGTCGTTCGTTTTGAGACGCCGCCTGGCAAGCAGATGCAGGCCGACTTCAC	NA	NA	NA	NA
WP_005013542.1|2371494_2372265_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2372350_2373010_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2372977_2373469_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2373578_2373782_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2374099_2374420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2375081_2375420_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_017685558.1|2375407_2375752_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2375814_2377386_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2378179_2378491_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2378683_2379804_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_101557807.1|2386208_2387370_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2387755_2389219_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2389351_2390902_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2390898_2391048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2391213_2392334_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2393447_2394305_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2394357_2394855_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2394975_2396391_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2396400_2397585_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2397581_2399180_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2400362_2400608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2401018_2401204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2401359_2402271_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2402392_2403235_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2403437_2404811_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_153566136.1|2404801_2404957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014726.1|2405120_2406632_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2406784_2407516_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2407622_2408924_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2408931_2409840_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2409836_2410430_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2410473_2410887_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2410883_2411354_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2411360_2411966_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2413767_2415552_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2415548_2416934_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2416919_2417882_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2417951_2418581_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005014759.1|2418618_2419827_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2419948_2420518_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2420649_2422203_+	methyltransferase regulatory domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2422506_2423727_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_169510538.1|2424158_2425037_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2425033_2425903_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_169510539.1|2425902_2426751_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2426747_2427572_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2427846_2429067_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 7
NZ_CP052852	Bordetella holmesii strain J862 chromosome, complete genome	3699764	2939571	3016630	3699764	integrase,transposase,tRNA	Ralstonia_virus(21.43%)	57	2942426:2942485	2991012:2991582
WP_005019978.1|2939571_2940351_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2940373_2941321_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2941322_2941523_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2941857_2942977_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2942426:2942485	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2943298_2944015_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2944011_2944905_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2945068_2946289_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2946441_2947524_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2949203_2950187_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2950249_2951662_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2951779_2952622_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_025341212.1|2952627_2952876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341213.1|2952930_2953509_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	9.7e-06
WP_005015738.1|2953524_2954145_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2954210_2954918_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2954922_2955645_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2955631_2955922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2955997_2957218_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2957942_2958794_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2958845_2960099_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2960275_2961064_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2961183_2962098_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2962230_2964123_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2964308_2965688_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2966132_2966429_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2970229_2970832_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2970965_2971424_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2971425_2972025_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_005015783.1|2972033_2972843_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2972877_2973732_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2973851_2974439_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2974435_2975815_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2976319_2976466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2984136_2985477_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2985490_2986342_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2986353_2987619_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2987680_2989585_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2991560_2992415_-	hypothetical protein	NA	NA	NA	NA	NA
2991012:2991582	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2992407_2993202_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2993417_2994368_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2994970_2995768_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2995807_2996461_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2996441_2997506_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2997669_2999895_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|3000140_3001985_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|3002101_3002974_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|3003020_3004721_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3004783_3005983_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3005993_3006872_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3006978_3008016_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3008096_3008501_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3008512_3009970_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3010612_3011209_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_005015844.1|3011369_3011828_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_169510542.1|3012605_3013559_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3013698_3014118_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3015409_3016630_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
