The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP052849	Bordetella holmesii strain J790 chromosome, complete genome	3698886	1095516	1202303	3698886	tRNA,protease,transposase	Ralstonia_virus(16.67%)	93	NA	NA
WP_005011985.1|1095516_1096737_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012606.1|1097765_1098755_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098875_1099757_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099930_1100785_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100816_1101665_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101792_1103013_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1103031_1103598_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103795_1104947_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1105085_1106090_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106246_1107218_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107296_1108085_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1108156_1108393_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108401_1109313_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109356_1111228_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111388_1112186_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112417_1112792_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112868_1113192_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113275_1113548_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113562_1114018_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1114139_1114976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114972_1116346_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116422_1117379_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117466_1118444_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118568_1120224_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120272_1120737_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120733_1121195_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121420_1122608_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122604_1123909_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123905_1125315_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125508_1126628_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126763_1127783_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127791_1130497_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130636_1131290_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131352_1131715_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132281_1133742_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1134004_1135078_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1135162_1136383_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1138140_1139261_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1139234_1140734_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140747_1141851_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141855_1143106_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1143102_1144548_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144544_1144859_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144860_1145979_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1146161_1147382_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147481_1148348_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148408_1149389_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149535_1150456_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150464_1151577_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151658_1152480_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152555_1153164_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153301_1154678_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154739_1155183_+	cytochrome c	NA	NA	NA	NA	NA
WP_076879520.1|1155249_1155921_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1155948_1157068_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1157237_1157519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1158229_1159018_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1159014_1160121_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160795_1162154_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162268_1162466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162483_1163604_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163697_1164252_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164839_1166156_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1166168_1167182_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012745.1|1168756_1169056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170416_1172075_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1172223_1173444_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173561_1174845_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174848_1175790_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175899_1176358_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176738_1177359_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177766_1180187_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180294_1181032_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1181078_1182323_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182645_1182918_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_025341373.1|1183444_1184230_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184251_1185169_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1185168_1185678_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185794_1186466_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_100225809.1|1186521_1187643_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.9e-14
WP_005012781.1|1187662_1189507_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189643_1190831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1191131_1191917_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191940_1193060_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1193164_1194502_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194611_1195553_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195608_1196790_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196948_1197239_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197285_1197954_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197950_1198238_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198614_1199400_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199432_1200167_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1201082_1202303_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP052849	Bordetella holmesii strain J790 chromosome, complete genome	3698886	1207090	1274805	3698886	tRNA,protease,transposase,holin	Ralstonia_virus(17.65%)	55	NA	NA
WP_005012808.1|1207090_1208041_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1208122_1208602_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_005012811.1|1209813_1211013_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1211158_1211536_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211559_1213341_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213349_1214087_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214371_1215931_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215990_1216749_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216845_1217502_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217655_1218420_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218434_1218614_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218639_1219674_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219670_1220084_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_025341375.1|1220080_1220677_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1221017_1222376_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222469_1223048_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1223172_1224293_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224365_1225622_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225725_1226931_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226994_1227444_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227576_1227822_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1228046_1228361_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_101558028.1|1233524_1235720_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235773_1238083_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239436_1241104_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1241106_1241772_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241904_1245711_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245936_1247082_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1247200_1248130_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1248126_1249203_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1249199_1250006_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1250002_1250734_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1251110_1252349_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252396_1252735_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252982_1253933_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014079.1|1254499_1255720_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	2.7e-183
WP_005012861.1|1255813_1257034_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1257093_1257357_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257478_1258978_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1259025_1259301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1259398_1259596_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259611_1259971_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1260043_1261066_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1261078_1263496_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005012872.1|1263513_1263855_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	43.3	1.3e-13
WP_005012873.1|1263912_1264311_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017685459.1|1264533_1265100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685460.1|1265130_1265859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012882.1|1266240_1266495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012883.1|1266781_1267525_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012885.1|1267552_1268542_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012887.1|1268572_1269577_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012888.1|1271457_1271667_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	57.1	8.6e-13
WP_005012891.1|1272062_1272809_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	31.2	7.3e-22
WP_005012893.1|1272843_1274805_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	29.9	2.3e-27
>prophage 4
NZ_CP052849	Bordetella holmesii strain J790 chromosome, complete genome	3698886	1651867	1692268	3698886	integrase,tRNA,transposase	Leptospira_phage(28.57%)	38	1644309:1644325	1688926:1688942
1644309:1644325	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_101557770.1|1651867_1652987_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1653639_1654395_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013596.1|1654571_1655366_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1655362_1655800_+	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_153566127.1|1655911_1656064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1656484_1657453_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1657609_1658617_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1658674_1659133_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1659206_1660553_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1660570_1660942_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1660941_1662411_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_025341430.1|1662557_1663292_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1663305_1666020_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1666271_1667636_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1667675_1668734_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1668761_1669580_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1669617_1669896_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671159_1671459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672028_1673432_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1673444_1674095_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1674236_1675457_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1675487_1676564_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1676710_1677841_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678027_1679653_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1679659_1680475_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1680489_1681560_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1681611_1682271_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1682910_1684073_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684114_1684429_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1684412_1684799_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1684837_1685104_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1685496_1686186_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1686285_1686447_-	RcnB family protein	NA	NA	NA	NA	NA
WP_017685992.1|1686597_1686762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1687314_1687563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1687676_1689047_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1688926:1688942	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689047_1689788_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1690315_1692268_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 5
NZ_CP052849	Bordetella holmesii strain J790 chromosome, complete genome	3698886	1710561	1754488	3698886	integrase,holin,transposase,tRNA	Leptospira_phage(36.36%)	36	1753056:1753070	1759532:1759546
WP_005019367.1|1710561_1713423_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1713412_1714378_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715134_1716610_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1716614_1716890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1717226_1718346_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013660.1|1718647_1719856_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1719852_1722135_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722145_1724527_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_025341436.1|1724790_1726716_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1726712_1727603_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1727609_1728743_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1728742_1729564_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1729588_1730779_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731080_1731362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1731887_1732974_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733170_1733431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1733923_1734694_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1734690_1735701_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1735735_1736578_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1737040_1737826_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1738685_1739805_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1740871_1741876_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1741951_1742764_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_017685973.1|1742785_1742962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013676.1|1742991_1745163_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1745216_1746536_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1746624_1747845_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748063_1748924_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1748920_1750144_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1750442_1750940_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1750978_1751761_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1751786_1752005_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752079_1752349_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1752568_1753033_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753056:1753070	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753106_1753388_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1753504_1754488_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1759532:1759546	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP052849	Bordetella holmesii strain J790 chromosome, complete genome	3698886	1779764	1842492	3698886	transposase	Ralstonia_virus(33.33%)	54	NA	NA
WP_005012067.1|1779764_1780715_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1780711_1781227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100225817.1|1781632_1782205_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1782304_1782556_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_169510517.1|1782643_1784110_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784118_1787289_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1787301_1788498_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_025341441.1|1788707_1789619_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1789687_1790419_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1790484_1791120_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791105_1792284_-	arabinose transporter	NA	NA	NA	NA	NA
WP_005013721.1|1792444_1792993_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793073_1793433_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1793480_1794701_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1794776_1795898_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1795935_1796649_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1796659_1797880_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013727.1|1798662_1799613_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1799572_1799734_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1799774_1800701_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1800714_1801587_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1801749_1802697_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803035_1803617_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804194_1805145_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805124_1805877_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1805889_1806621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1806777_1808943_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809032_1809302_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005013740.1|1809595_1810114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810132_1810912_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811079_1812096_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812168_1812660_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1812670_1814386_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1815549_1816500_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818151_1819393_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1819404_1820178_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1820204_1821155_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814011.1|1821253_1822036_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003814013.1|1824077_1825463_+	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_005013750.1|1825481_1826087_+	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_005013751.1|1826083_1827940_+	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_005013752.1|1827936_1828737_+	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_005013753.1|1828751_1829945_+	alcaligin siderophore biosynthesis protein AlcE	NA	NA	NA	NA	NA
WP_005013754.1|1830012_1830987_+	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_005013755.1|1831109_1832333_+	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
WP_005013756.1|1832443_1834648_+	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_005013757.1|1834942_1835572_+	MarC family protein	NA	NA	NA	NA	NA
WP_025341443.1|1835579_1835786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080601046.1|1837071_1837767_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005013759.1|1837750_1838731_+	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.2	5.6e-14
WP_005013761.1|1838873_1839368_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005013762.1|1839369_1840287_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_005013763.1|1840366_1841551_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_062826501.1|1841541_1842492_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP052849	Bordetella holmesii strain J790 chromosome, complete genome	3698886	2287051	2427167	3698886	integrase,tRNA,protease,transposase	Ralstonia_virus(11.76%)	117	2280616:2280675	2368449:2368971
2280616:2280675	attL	ACATGGATCCTCCGATAGCCGTAGCGTCGTTTCGCCACTGCCATCTCTTTCATGCGCTCG	NA	NA	NA	NA
WP_005011985.1|2287051_2288272_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014428.1|2288320_2288986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005019657.1|2289033_2290029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014435.1|2295317_2296283_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005014437.1|2296290_2296707_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014438.1|2296703_2297621_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014440.1|2297632_2298052_+	EthD family reductase	NA	NA	NA	NA	NA
WP_005014441.1|2297960_2299349_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019661.1|2299345_2299597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014444.1|2299767_2300724_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014448.1|2300968_2301742_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005019667.1|2301738_2302872_+	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_005014461.1|2302881_2303832_+	D-3-phosphoglycerate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	28.4	4.8e-18
WP_005014462.1|2303863_2304664_+	aldolase	NA	NA	NA	NA	NA
WP_101557807.1|2305660_2306823_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306935_2307904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307900_2308821_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308917_2313396_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313774_2318109_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318747_2319311_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319322_2319568_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_169512607.1|2319723_2320233_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320278_2321259_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321470_2323822_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_025341471.1|2323868_2324675_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324695_2325385_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325377_2326658_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326755_2327694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327675_2329382_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329459_2330563_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330615_2331365_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331371_2332886_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332898_2333186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2333206_2334094_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2334244_2334751_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334747_2335704_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335891_2337238_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_080698364.1|2337205_2337367_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_101558036.1|2337465_2338029_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2338183_2338954_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338950_2339961_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2340275_2340722_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340777_2340972_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340973_2341315_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341324_2343187_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2343226_2343733_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343736_2344060_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2344061_2344466_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344502_2345714_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345735_2346284_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346508_2347000_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2347214_2349245_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349319_2350522_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2351064_2352000_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2353033_2353315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353401_2353575_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353686_2354031_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2354102_2354771_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_005014572.1|2356186_2357230_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2357226_2357328_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357419_2358539_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358789_2359443_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
WP_032974133.1|2359558_2360779_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360829_2363259_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363424_2364723_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364827_2365481_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365483_2366794_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2367021_2367561_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2368039_2368306_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368344_2368710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368591_2369602_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
2368449:2368971	attR	CGAGCGCATGAAAGAGATGGCAGTGGCGAAACGACGCTACGGCTATCGGAGGATCCATGTCAGCGCCGATGTAATACTGACCCACCGCGTCGGAGTAAATCTGACCCACCTGGGCGATGATGGCGGCCTTTTGGCCGCCGACAATGTTGACTCAGGAGCAAGCAGTGGAGATCAAGGTAATGGCGCGTCGCGGCGTCAGCATTCGGGAGATGGCCAAGCAGCTGGGCTGCTCACGCAACACGATCAGGCGGTATCTGCGTGAGGCTGGTGCCCAGCAGTACAAGCCCCGCGAGGCACGGACCACCAAGCTGGATCCGTACAAGGACTATCTGCACGGGCGCATCGAGGCGGCCCGGCCGCACTGGATTCCAGCAGCCGTGCTGCTGCGGGAGATTCAAGAACTGGGCTACCCCGGTGGTGTAACGCAGCTCAAGGAGTTTCTTAGCGGCTACAAGCACCAGGAGCCTGAACCGGTCGTTCGTTTTGAGACGCCGCCTGGCAAGCAGATGCAGGCCGACTTCAC	NA	NA	NA	NA
WP_005013542.1|2369598_2370369_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370454_2371114_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2371081_2371573_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371682_2371886_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2372203_2372524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2373185_2373524_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2373520_2373856_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373918_2375490_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376283_2376595_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376787_2377908_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_101557807.1|2384308_2385470_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385855_2387319_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387451_2389002_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388998_2389148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389313_2390434_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391547_2392405_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392457_2392955_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2393075_2394491_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394500_2395685_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395681_2397280_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014716.1|2399118_2399304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399459_2400371_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400492_2401335_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401537_2402911_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_153566136.1|2402901_2403057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014726.1|2403220_2404732_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404884_2405616_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405722_2407024_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2407031_2407940_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407936_2408530_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408573_2408987_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408983_2409454_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409460_2410066_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411867_2413652_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413648_2415034_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2415019_2415982_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2416051_2416681_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005014759.1|2416718_2417927_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2418048_2418618_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418749_2420303_+	methyltransferase regulatory domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420606_2421827_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_169510538.1|2422258_2423137_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2423133_2424003_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_169510539.1|2424002_2424851_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_169512608.1|2424847_2425672_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425946_2427167_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP052849	Bordetella holmesii strain J790 chromosome, complete genome	3698886	2936621	3046412	3698886	integrase,transposase,protease,tRNA	Ralstonia_virus(22.22%)	89	2939476:2939535	2988062:2988632
WP_005019978.1|2936621_2937401_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937423_2938371_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938372_2938573_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938907_2940027_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939476:2939535	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940348_2941065_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2941061_2941955_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2942118_2943339_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943491_2944574_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2946253_2947237_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947299_2948712_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948829_2949672_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_025341212.1|2949677_2949926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341213.1|2949980_2950559_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	9.7e-06
WP_005015738.1|2950574_2951195_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951260_2951968_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951972_2952695_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952681_2952972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2953047_2954268_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954992_2955844_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955895_2957149_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957325_2958114_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2958233_2959148_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959280_2961173_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961358_2962738_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2963182_2963479_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967279_2967882_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2968015_2968474_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968475_2969075_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_005015783.1|2969083_2969893_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969927_2970782_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970901_2971489_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971485_2972865_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973369_2973516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2981186_2982527_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982540_2983392_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983403_2984669_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984730_2986635_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988610_2989465_-	hypothetical protein	NA	NA	NA	NA	NA
2988062:2988632	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989457_2990252_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990467_2991418_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2992020_2992818_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992857_2993511_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993491_2994556_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994719_2996945_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_169512612.1|2997190_2999035_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2999151_3000024_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|3000070_3001771_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001833_3003033_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3003043_3003922_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3004028_3005066_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3005146_3005551_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005562_3007020_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007662_3008259_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_005015844.1|3008419_3008878_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_169510542.1|3009655_3010609_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010748_3011168_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012458_3013679_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
WP_005020040.1|3013740_3014628_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_005020041.1|3014645_3015950_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_005015862.1|3015915_3017022_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003810707.1|3017109_3017346_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_005015866.1|3017529_3018603_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_005015867.1|3018599_3019955_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_005015868.1|3019979_3021137_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_005015870.1|3021142_3021781_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017685512.1|3021784_3023071_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005015875.1|3023112_3024399_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_005015878.1|3024411_3024900_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005015881.1|3024896_3026045_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_005015883.1|3026074_3026500_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.9	2.4e-22
WP_005015887.1|3026819_3029699_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	1.1e-137
WP_005015889.1|3029752_3030973_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
WP_005015892.1|3031021_3031885_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_005015895.1|3031884_3032478_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_005015897.1|3032769_3033030_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_005015899.1|3033529_3033781_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_005020050.1|3033767_3036389_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.5	2.8e-84
WP_005015902.1|3036472_3037498_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_005015904.1|3037494_3038079_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_005015906.1|3038102_3039203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015908.1|3039195_3039450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015912.1|3039546_3040422_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_005015914.1|3040414_3040864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015916.1|3040841_3041966_-	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_005015920.1|3041958_3043545_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_076879506.1|3043541_3044300_-	TcpQ domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|3044814_3045765_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_101557849.1|3045744_3046107_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|3046145_3046412_-|transposase	transposase	transposase	NA	NA	NA	NA
