The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP052877	Escherichia coli strain C21 chromosome, complete genome	4757725	688504	696056	4757725	transposase	Escherichia_phage(100.0%)	7	NA	NA
WP_169711480.1|688504_689485_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.2	9.2e-182
WP_061424402.1|689838_692274_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	100.0	0.0e+00
WP_000816147.1|692287_692914_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	100.0	2.9e-128
WP_000544912.1|692906_693683_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	100.0	5.8e-131
WP_001139856.1|693737_694334_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	100.0	1.7e-114
WP_001327048.1|694330_694861_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SLP0	Escherichia_phage	100.0	8.6e-102
WP_066019098.1|695075_696056_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
>prophage 2
NZ_CP052877	Escherichia coli strain C21 chromosome, complete genome	4757725	1095496	1211874	4757725	integrase,capsid,head,terminase,tail,lysis,plate,transposase,tRNA,portal	Salmonella_phage(63.33%)	119	1136979:1137023	1173379:1173423
WP_000047176.1|1095496_1098127_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|1098361_1098547_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273309.1|1100139_1100706_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287454.1|1100702_1101131_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611804.1|1101203_1102760_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130210.1|1102909_1103425_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|1103488_1105027_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001295175.1|1105043_1106216_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_073461731.1|1106342_1106873_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_048265082.1|1106843_1106945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119763.1|1106963_1107299_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|1107288_1108026_-	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_000165699.1|1108149_1109334_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216527.1|1109625_1110618_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774996.1|1110674_1111739_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985494.1|1111731_1112934_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777969.1|1113288_1114248_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_073461730.1|1114257_1116402_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	3.5e-194
WP_000080947.1|1116374_1116785_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|1116781_1117027_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_073461729.1|1117274_1117604_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|1117755_1118100_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|1118136_1118586_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|1119253_1119658_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229467.1|1119704_1120229_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137280.1|1120238_1120538_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|1120720_1120879_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522424.1|1120962_1121412_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|1121412_1122075_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|1122095_1123496_-	GABA permease	NA	NA	NA	NA	NA
WP_000097662.1|1123733_1125014_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.4e-33
WP_000772876.1|1125027_1126476_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271948.1|1126498_1127767_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_001330895.1|1127786_1128764_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_087530468.1|1130272_1131434_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.4e-51
WP_000577254.1|1131586_1133305_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
WP_000448925.1|1135128_1135545_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|1135583_1136813_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
1136979:1137023	attL	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001083625.1|1137108_1137777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000155494.1|1137787_1138804_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	94.1	8.0e-189
WP_000052557.1|1138807_1139440_-	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	57.1	5.0e-64
WP_000102105.1|1139556_1139799_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000460856.1|1139831_1140341_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	95.3	1.3e-83
WP_000956192.1|1140348_1140645_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_073461711.1|1140762_1141104_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	5.1e-55
WP_001244216.1|1141171_1141405_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_000752613.1|1141404_1141632_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_052935163.1|1141628_1142486_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.9	1.4e-162
WP_073461710.1|1142482_1144897_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.4	0.0e+00
WP_001154434.1|1145049_1145238_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217583.1|1145248_1145482_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	6.1e-36
WP_073461709.1|1145740_1146400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124842052.1|1146404_1146878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073461745.1|1147339_1148335_+	hypothetical protein	NA	A0A1S6KZY1	Salmonella_phage	90.9	6.0e-181
WP_077625619.1|1148391_1148904_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	86.5	2.0e-79
WP_139289628.1|1149065_1149365_-	hypothetical protein	NA	A0A1S6KZY3	Salmonella_phage	86.0	1.8e-35
WP_077625620.1|1149422_1150451_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	91.3	4.9e-178
WP_073461747.1|1150450_1152217_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216247.1|1152359_1153193_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.1e-122
WP_000742511.1|1153209_1154268_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059191.1|1154271_1154922_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_077625621.1|1155017_1155482_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	9.3e-76
WP_000868175.1|1155481_1155685_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|1155688_1155904_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_073461749.1|1155884_1156400_+	lysozyme	NA	E5G6N1	Salmonella_phage	90.6	6.9e-88
WP_073461750.1|1156396_1156825_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	88.7	2.1e-58
WP_114142375.1|1156920_1157352_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_073461752.1|1157344_1157791_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	79.1	1.1e-54
WP_073461753.1|1157866_1159642_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_049091890.1|1159920_1160499_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	8.0e-93
WP_049091891.1|1160495_1160855_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_049091892.1|1160841_1161750_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.9e-141
WP_073461754.1|1161742_1162348_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	1.5e-110
WP_000064420.1|1164082_1164349_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_001236016.1|1164317_1164515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001439518.1|1164501_1164882_-	hypothetical protein	NA	I3PGW0	Xanthomonas_phage	30.6	5.8e-07
WP_000905039.1|1164912_1165479_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
WP_069916669.1|1165621_1166794_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.8	1.6e-204
WP_001207656.1|1166803_1167319_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001281009.1|1167373_1167676_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|1167690_1167810_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_073461704.1|1167802_1170880_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	67.7	0.0e+00
WP_001710138.1|1170876_1171362_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	1.1e-66
WP_073461703.1|1171358_1172459_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.8	1.5e-177
WP_000980501.1|1172527_1172746_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_000391794.1|1172772_1173255_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	1.6e-17
WP_000162574.1|1173955_1174438_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1173379:1173423	attR	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000600190.1|1174569_1175046_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1175035_1175326_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1175387_1175729_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|1175877_1177539_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1177624_1178503_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1178625_1179219_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|1179273_1180560_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|1180580_1181372_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1181538_1182900_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1183148_1183397_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1183415_1183964_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1183994_1184762_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1184803_1185151_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|1185227_1185710_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969042.1|1185725_1186952_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1186941_1187460_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168054.1|1188212_1189283_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000225221.1|1189293_1190415_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_072661174.1|1190457_1191618_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|1191716_1191764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|1191867_1192209_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1192479_1193217_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079107.1|1193351_1194332_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040115.1|1194328_1195060_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1195189_1197763_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000230376.1|1203618_1204917_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|1204913_1205237_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1205282_1206638_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082949.1|1206751_1209412_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001307345.1|1209443_1210142_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_073461602.1|1210210_1210630_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.5	1.8e-14
WP_000997403.1|1210836_1211874_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP052877	Escherichia coli strain C21 chromosome, complete genome	4757725	1692624	1702066	4757725		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|1692624_1693551_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1693555_1694287_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1694267_1694375_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1694434_1695166_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|1695387_1697073_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1697069_1697789_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1697835_1698306_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1698346_1698808_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001331478.1|1698932_1700933_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292767.1|1700929_1702066_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
>prophage 4
NZ_CP052877	Escherichia coli strain C21 chromosome, complete genome	4757725	1804363	1811886	4757725		Enterobacteria_phage(42.86%)	7	NA	NA
WP_001115981.1|1804363_1805758_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
WP_053882441.1|1805915_1806911_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	4.2e-09
WP_000183060.1|1807153_1808047_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_033870517.1|1808418_1809504_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	3.3e-100
WP_044863830.1|1809503_1810403_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	3.3e-29
WP_033870519.1|1810460_1811339_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	3.0e-107
WP_033870520.1|1811343_1811886_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.9	1.7e-44
>prophage 5
NZ_CP052877	Escherichia coli strain C21 chromosome, complete genome	4757725	2479139	2540418	4757725	terminase,tail,lysis,holin,tRNA	Escherichia_phage(44.0%)	66	NA	NA
WP_000837924.1|2479139_2480273_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|2480413_2480848_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_001157926.1|2481112_2481286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795384.1|2481625_2481739_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2481807_2482041_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|2482357_2482948_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|2483045_2483621_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_073461631.1|2483620_2486983_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001230375.1|2487047_2487647_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_061355519.1|2487716_2491130_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	98.0	0.0e+00
WP_000741591.1|2491190_2491838_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	1.4e-109
WP_001379783.1|2491735_2492479_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	8.0e-146
WP_001152422.1|2492484_2493183_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.1	9.6e-125
WP_000024051.1|2493182_2493521_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_072686787.1|2493513_2496747_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.9	6.4e-115
WP_012565075.1|2497220_2497580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|2497730_2498693_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_073461629.1|2498719_2499112_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_001029815.1|2499108_2499489_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000524260.1|2499489_2499873_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634214.1|2499872_2500268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908084.1|2500271_2500448_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000918487.1|2500490_2501630_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_073461628.1|2501728_2502493_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	9.0e-84
WP_001351715.1|2502597_2503710_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_000763704.1|2503693_2505100_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_000625348.1|2505102_2506404_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000089447.1|2506384_2507479_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000613571.1|2507482_2507734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204037.1|2507669_2508602_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_001291094.1|2508594_2509386_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001097895.1|2509523_2510981_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228688.1|2511177_2511363_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001135310.1|2511579_2512077_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_000839565.1|2512076_2512292_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|2512543_2512918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|2513089_2513518_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000640161.1|2514562_2515105_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000247763.1|2515101_2515392_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000940319.1|2515391_2515991_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000149055.1|2516804_2517143_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_001117227.1|2517866_2519066_+	MFS transporter	NA	NA	NA	NA	NA
WP_000957774.1|2519077_2519770_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000019009.1|2519766_2520648_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000625667.1|2520778_2522056_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001676522.1|2522119_2524117_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_001151151.1|2524457_2524880_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001262393.1|2524920_2525991_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_000693853.1|2526062_2526488_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|2526484_2526739_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|2526818_2527238_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001169151.1|2527669_2527825_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2527821_2528310_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|2528751_2528973_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|2528972_2529143_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2529217_2529493_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001532611.1|2529594_2532195_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
WP_000166319.1|2532187_2532997_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2533053_2533248_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2533240_2533450_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2533528_2533744_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2533745_2534981_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001153728.1|2535032_2535968_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.0e-145
WP_000123738.1|2536096_2537470_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2537947_2538931_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|2539185_2540418_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 6
NZ_CP052877	Escherichia coli strain C21 chromosome, complete genome	4757725	2986309	3035163	4757725	tRNA,transposase	Bacillus_phage(11.11%)	38	NA	NA
WP_000886683.1|2986309_2987602_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|2987692_2989036_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|2989046_2989658_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077012.1|2989812_2993880_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_073461694.1|2994014_2994509_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|2995053_2996019_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043618.1|2996141_2997908_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202188.1|2997908_2999630_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|2999671_3000376_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3000660_3000879_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001274547.1|3001369_3002212_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839253.1|3002296_3002494_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001054233.1|3002510_3002999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854686.1|3002995_3003379_-	toxin	NA	NA	NA	NA	NA
WP_001360163.1|3003455_3003836_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086769.1|3003846_3004530_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	35.6	3.1e-27
WP_000692298.1|3004548_3004770_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186726.1|3004832_3005309_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214307.1|3005324_3005810_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001234732.1|3005901_3006720_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	1.0e-45
WP_000820472.1|3007046_3009893_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_072649097.1|3010264_3011137_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000200811.1|3011400_3012972_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_000019443.1|3013829_3014822_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	3.2e-182
WP_000183578.1|3015935_3016745_-	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_000721956.1|3016842_3019065_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000019443.1|3019263_3020256_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	3.2e-182
WP_162842843.1|3020703_3021917_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.6	3.9e-166
WP_089578733.1|3021909_3023039_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.5e-47
WP_000654812.1|3023035_3024004_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.7	2.1e-186
WP_160379547.1|3025287_3026433_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000683047.1|3026433_3027324_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000828112.1|3027320_3028475_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.6	7.7e-79
WP_001084506.1|3028493_3030386_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_000433876.1|3030400_3031141_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.2	3.5e-08
WP_000876712.1|3031140_3031908_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012311662.1|3033365_3033518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012311606.1|3033543_3035163_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP052877	Escherichia coli strain C21 chromosome, complete genome	4757725	3758931	3821197	4757725	plate,tRNA,protease,transposase	Enterobacteria_phage(12.5%)	51	NA	NA
WP_000611738.1|3758931_3759345_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393845.1|3759348_3761199_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348806.1|3761162_3762245_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|3762269_3763550_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3763546_3764071_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246437.1|3764073_3765405_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343302.1|3765409_3766171_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_072649719.1|3766179_3769017_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	27.7	5.9e-80
WP_000088859.1|3769013_3769757_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240530.1|3769761_3771174_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122985538.1|3771282_3774717_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087745.1|3774727_3776080_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001284199.1|3776103_3776586_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908052.1|3776629_3777544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|3777553_3778033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|3778169_3778955_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|3779494_3780226_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|3780290_3780758_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|3780754_3781477_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052710.1|3781510_3782266_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3782337_3783696_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211690.1|3783743_3784514_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|3784591_3785392_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648606.1|3785632_3786547_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|3786543_3787347_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_073461787.1|3793104_3793677_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|3793864_3794896_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|3794888_3795542_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|3795581_3796397_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3796514_3796919_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|3796915_3797623_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|3797734_3799453_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000399647.1|3800533_3801514_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|3801763_3802474_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635316.1|3802487_3802910_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|3802906_3803452_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3803617_3803818_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|3803804_3804065_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176578.1|3804113_3805412_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|3805476_3805866_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|3805922_3808064_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|3808162_3809122_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|3809134_3812617_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|3812653_3813250_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139667.1|3813246_3814395_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|3814394_3815183_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3815186_3815642_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|3815746_3816772_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3816775_3817261_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|3817382_3819815_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|3819844_3821197_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 1
NZ_CP052879	Escherichia coli strain C21 plasmid pC21-2, complete sequence	62933	171	52981	62933	transposase,integrase	Escherichia_phage(31.25%)	52	10211:10270	52213:53033
WP_000948429.1|171_1371_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|1380_1569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000572405.1|3147_3942_+	aminoglycoside O-phosphotransferase APH(3')-IIa	NA	Q75ZG1	Hepacivirus	100.0	9.5e-153
WP_001067858.1|4248_4953_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000888203.1|5054_5534_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000347934.1|5603_8756_-	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_002914189.1|8779_9955_-	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
10211:10270	attL	TGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067858.1|10274_10979_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_096098411.1|10988_11447_+	replication initiation protein	NA	NA	NA	NA	NA
WP_001067858.1|14403_15108_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000274934.1|15786_16071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545925.1|16203_16500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000932975.1|17384_17624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881513.1|17633_18038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000447669.1|18095_18521_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000861760.1|18932_19373_+	translesion error-prone DNA polymerase V autoproteolytic subunit MucA	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
WP_013188477.1|19360_20626_+	translesion error-prone DNA polymerase V subunit MucB	NA	F1C5A5	Cronobacter_phage	54.0	2.0e-120
WP_001452808.1|20776_21568_+	SprT-like domain-containing protein	NA	NA	NA	NA	NA
WP_000057569.1|21582_21924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000359511.1|22483_23203_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.0	1.1e-19
WP_000583523.1|24479_25076_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.7	5.4e-36
WP_000845039.1|25467_26481_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|26625_27123_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|27234_27525_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|27530_28322_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_073461727.1|28485_28833_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_000259031.1|28826_29666_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|30070_31612_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012372818.1|32204_32960_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_000027057.1|33129_33990_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_014342213.1|34544_34670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000971921.1|34811_36182_-|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_000080861.1|36296_37433_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000248278.1|37483_37711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|37734_37926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|38407_38950_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|38962_39823_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067855.1|40055_40760_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|40765_40906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|41391_42129_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|42125_42350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|42560_44054_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_021598067.1|44084_44969_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_023300759.1|45185_46400_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|46427_46733_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032153701.1|46999_48199_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001493764.1|48304_48955_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|48986_49229_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000480972.1|49534_50371_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082320.1|50370_51174_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|51234_52050_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001067858.1|52276_52981_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
52213:53033	attR	TGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCACGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCAACGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 1
NZ_CP052881	Escherichia coli strain C21 plasmid pC21-4, complete sequence	93854	2155	16708	93854		Escherichia_phage(53.33%)	15	NA	NA
WP_001285362.1|2155_3352_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000038866.1|3368_4370_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_000067710.1|4595_6302_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
WP_023156142.1|6362_7952_+	hypothetical protein	NA	A0A077SLN8	Escherichia_phage	99.6	2.8e-305
WP_124842093.1|7961_8777_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.5	1.4e-111
WP_000035301.1|8812_9394_+	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
WP_000509939.1|9405_9915_+	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_001313475.1|10031_10187_-	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_029401368.1|10368_10614_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	46.2	1.2e-13
WP_001379176.1|10664_11510_-	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	100.0	5.9e-153
WP_001187876.1|11539_12340_-	phage antirepressor KilAC domain-containing protein	NA	A0A077SL47	Escherichia_phage	100.0	1.4e-148
WP_000743164.1|12503_13547_-	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	92.5	2.0e-171
WP_169711502.1|13521_13764_-	host cell division inhibitor Icd-like protein	NA	Q38414	Enterobacteria_phage	98.6	3.4e-37
WP_001033469.1|14900_15440_+	DUF5384 family protein	NA	A0A077SL46	Escherichia_phage	100.0	1.8e-46
WP_000523978.1|16096_16708_+	hypothetical protein	NA	A0A077SLH8	Escherichia_phage	100.0	5.8e-110
>prophage 2
NZ_CP052881	Escherichia coli strain C21 plasmid pC21-4, complete sequence	93854	21077	93519	93854	terminase,holin,tail,portal,plate,integrase	Escherichia_phage(71.21%)	69	44965:44981	93493:93509
WP_000002800.1|21077_21434_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_001189838.1|22862_23699_+	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	99.3	5.8e-153
WP_001286326.1|23777_24212_+	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_169711501.1|24223_25630_+|tail	tail fiber protein	tail	Q71TP5	Escherichia_phage	94.2	1.2e-222
WP_072658107.1|26052_27243_+|tail	tail fiber protein	tail	A0A1B0VFW4	Salmonella_phage	58.9	5.9e-42
WP_063117167.1|27242_27821_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.9e-95
WP_124842119.1|27864_28437_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_024235795.1|28925_29459_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.3	3.5e-95
WP_169711504.1|29461_30763_-|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	93.1	7.7e-245
WP_029401675.1|31029_31590_-	recombinase family protein	NA	Q71TD8	Escherichia_phage	99.5	4.7e-98
WP_000332810.1|31717_31999_+	hypothetical protein	NA	Q71TD9	Escherichia_phage	98.9	1.8e-45
WP_000887652.1|32066_32396_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580776.1|32392_32836_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_001369351.1|32822_33425_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	99.0	3.5e-99
WP_047649461.1|33426_35346_+	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	97.0	0.0e+00
WP_029401678.1|35342_35708_+	hypothetical protein	NA	A0A077SK35	Escherichia_phage	99.2	2.3e-45
WP_063117182.1|35720_38708_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.2	0.0e+00
WP_001165932.1|38697_39009_+	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	100.0	1.8e-46
WP_000724558.1|39751_40864_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	96.0	4.6e-198
WP_000068862.1|41097_41586_-	single-stranded DNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	98.8	2.5e-87
WP_001345478.1|41755_42313_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_169711503.1|43617_45357_-|portal	phage portal protein	portal	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
44965:44981	attL	GGTCTTCTTATCGAAAG	NA	NA	NA	NA
WP_169711505.1|46679_52172_+	helicase	NA	Q1MVN7	Enterobacteria_phage	99.0	0.0e+00
WP_000224043.1|52205_52646_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000747846.1|52642_52891_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_016246528.1|52973_53984_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_072104142.1|54081_54834_-	hypothetical protein	NA	Q71TG2	Escherichia_phage	91.1	1.1e-115
WP_012817933.1|55316_55538_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.8	6.2e-30
WP_001260622.1|55534_56650_+	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	93.3	1.3e-192
WP_001224234.1|56888_57200_-	hypothetical protein	NA	A0A077SK03	Escherichia_phage	100.0	1.0e-46
WP_029396411.1|57250_58282_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077SLE7	Escherichia_phage	100.0	1.3e-194
WP_000542332.1|58289_58511_-	hypothetical protein	NA	A0A077SLI9	Escherichia_phage	100.0	3.4e-36
WP_032305379.1|59115_59325_+	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	98.6	1.4e-31
WP_029401409.1|59435_60287_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	2.3e-157
WP_000124150.1|60311_61796_-|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
WP_000219604.1|61795_62989_-|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	100.0	5.7e-210
WP_032305380.1|63075_63528_-	hypothetical protein	NA	Q71T63	Escherichia_phage	98.7	3.3e-78
WP_000648833.1|63616_64660_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	99.7	1.1e-206
WP_000113018.1|64687_64867_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_001216030.1|64871_65252_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	99.2	1.9e-63
WP_001190712.1|65251_65473_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_029401414.1|65655_67212_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.1e-104
WP_029401415.1|67208_68477_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_029401417.1|68598_71715_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.9	8.3e-27
WP_029401419.1|71979_72486_-	hypothetical protein	NA	A0A077SK53	Escherichia_phage	98.2	1.6e-92
WP_029401421.1|72558_73821_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.0	6.6e-233
WP_000684869.1|74122_74824_-	hypothetical protein	NA	Q71TJ0	Escherichia_phage	97.0	4.3e-141
WP_024262884.1|74820_75498_-	metallophosphoesterase	NA	Q71TJ1	Escherichia_phage	96.4	6.2e-129
WP_000484111.1|75494_76121_-	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	99.5	1.0e-122
WP_032288828.1|76018_76681_-	hypothetical protein	NA	A0A077SL54	Escherichia_phage	99.5	5.9e-124
WP_000095380.1|76622_76778_-	hypothetical protein	NA	A0A077SK20	Escherichia_phage	100.0	1.2e-19
WP_029401427.1|76844_77423_-	VRR-NUC domain-containing protein	NA	A0A077SLK0	Escherichia_phage	99.0	1.3e-106
WP_000840930.1|77425_77671_-	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
WP_000235786.1|77817_78195_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_001141901.1|78204_79422_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	99.8	1.9e-224
WP_000896801.1|79425_80154_+	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_029401429.1|80140_80926_+	hypothetical protein	NA	A0A077SLJ8	Escherichia_phage	98.9	6.1e-144
WP_000212018.1|80927_81944_+	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
WP_000535202.1|81936_82569_+|plate	baseplate protein	plate	Q71TK2	Escherichia_phage	100.0	6.9e-90
WP_001198667.1|82615_83614_-	hypothetical protein	NA	A0A077SL52	Escherichia_phage	99.7	1.6e-194
WP_001276602.1|83613_84978_-	replicative DNA helicase	NA	O80281	Escherichia_phage	99.6	3.6e-253
WP_000234829.1|85449_85614_-	DUF3927 family protein	NA	A0A1B0VDU8	Salmonella_phage	100.0	1.2e-17
WP_000900640.1|85613_86039_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	100.0	1.8e-70
WP_124842104.1|87792_90057_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	68.4	0.0e+00
WP_000472526.1|90053_90959_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.3	4.5e-159
WP_001177860.1|90951_91236_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_029401362.1|91698_92487_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	96.2	2.4e-116
WP_001514466.1|92526_92949_+	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	99.3	6.1e-58
WP_029401364.1|93126_93519_+	hypothetical protein	NA	Q1MVJ1	Enterobacteria_phage	98.5	2.0e-71
93493:93509	attR	GGTCTTCTTATCGAAAG	NA	NA	NA	NA
