The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044335	Enterobacter hormaechei strain AKB48 chromosome, complete genome	4655363	1397572	1464022	4655363	transposase,capsid,lysis,tRNA,integrase	Enterobacteria_phage(25.0%)	57	1394293:1394340	1408692:1408739
1394293:1394340	attL	CCCTACGCTGGCATTATCCAGATCAGGTAATACGGGTATTTCTCAGCC	NA	NA	NA	NA
WP_169722553.1|1397572_1398610_-|capsid	major capsid protein E	capsid	NA	NA	NA	NA
WP_169722554.1|1398633_1399011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127341375.1|1399013_1399229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169722555.1|1399789_1400122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169722556.1|1400338_1400719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169722557.1|1404194_1404755_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_169722558.1|1404765_1404966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169724736.1|1406589_1407225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169722559.1|1407302_1408607_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_169722560.1|1409516_1410635_+	YadA-like family protein	NA	NA	NA	NA	NA
1408692:1408739	attR	CCCTACGCTGGCATTATCCAGATCAGGTAATACGGGTATTTCTCAGCC	NA	NA	NA	NA
WP_071524132.1|1410831_1411056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033487338.1|1411064_1411502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169722561.1|1411812_1413189_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.4	4.8e-27
WP_169722562.1|1413207_1414674_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_169722563.1|1414718_1416917_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_169722564.1|1416916_1417378_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
WP_169722565.1|1417365_1418505_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_047636951.1|1418987_1419320_+	RcnB family protein	NA	NA	NA	NA	NA
WP_169722566.1|1419270_1419750_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_169722567.1|1419839_1420949_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_169722568.1|1421086_1423120_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	28.3	3.6e-55
WP_015572337.1|1423227_1423698_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	79.4	3.4e-65
WP_169722569.1|1423744_1424464_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_169722570.1|1424457_1426143_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.8	7.9e-266
WP_169722571.1|1426361_1427102_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	82.4	5.6e-91
WP_017383372.1|1427171_1427285_+	protein YohO	NA	NA	NA	NA	NA
WP_169722572.1|1427259_1427997_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_169722573.1|1427980_1428931_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.1	1.3e-07
WP_062938288.1|1428923_1430081_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_169722574.1|1430093_1431011_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_169722575.1|1431147_1433445_-	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_169722576.1|1433634_1435392_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_169722577.1|1435494_1436049_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.2	3.6e-18
WP_169722578.1|1436154_1437078_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_003859296.1|1437245_1437833_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_169722579.1|1437990_1438563_+	DedA family protein	NA	NA	NA	NA	NA
WP_169722580.1|1438657_1439422_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_169722581.1|1439472_1440891_-	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_015572323.1|1441223_1442159_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_169722582.1|1442327_1442723_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_169722583.1|1442719_1443415_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_169722584.1|1443543_1444428_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_169722585.1|1444555_1445266_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_169722586.1|1446746_1447184_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_169722587.1|1447222_1448233_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_169722588.1|1448248_1449769_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.3e-09
WP_169722589.1|1449848_1450847_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_169722590.1|1451141_1452164_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_169722591.1|1452319_1453477_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_169722592.1|1453495_1454164_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	1.2e-55
WP_169722593.1|1454266_1455415_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_169722594.1|1455552_1456380_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_169722595.1|1456647_1458633_+	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	31.9	2.9e-09
WP_169722596.1|1460326_1461589_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	97.6	1.1e-38
WP_011091026.1|1461876_1462134_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_015243648.1|1462066_1462468_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_000608644.1|1462759_1464022_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 1
NZ_CP044336	Enterobacter hormaechei strain AKB48 plasmid unnamed1, complete sequence	126563	4086	11863	126563	tail	Salmonella_phage(83.33%)	6	NA	NA
WP_169724835.1|4086_4422_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	95.5	4.8e-58
WP_016051624.1|4511_5210_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	100.0	3.7e-137
WP_080112972.1|5202_6000_+	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	95.8	1.2e-155
WP_169724836.1|5987_6575_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.8	9.0e-100
WP_169724837.1|6596_11228_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.5	0.0e+00
WP_169724905.1|11245_11863_+	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.3	2.5e-28
>prophage 2
NZ_CP044336	Enterobacter hormaechei strain AKB48 plasmid unnamed1, complete sequence	126563	16301	122903	126563	holin,tail,terminase,capsid,integrase	Salmonella_phage(91.89%)	123	22724:22742	86546:86564
WP_169724838.1|16301_17090_+	receptor-recognizing protein	NA	E5DHZ0	Enterobacter_phage	62.4	2.8e-56
WP_000064173.1|17164_17488_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	92.5	1.4e-46
WP_169724839.1|17501_18194_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.2	6.2e-124
WP_000147960.1|18195_18447_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	89.2	1.9e-30
WP_080332520.1|18397_18604_+	hypothetical protein	NA	J9Q7G2	Salmonella_phage	80.0	8.1e-24
WP_169724906.1|18631_19135_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016582626.1|19159_19429_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_160859104.1|20516_20870_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.2e-45
WP_169724840.1|20911_21709_-	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	26.1	1.2e-11
WP_006812583.1|21972_22698_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	99.2	3.8e-140
22724:22742	attL	AGAAAACAAATTGTTTAAG	NA	NA	NA	NA
WP_169724841.1|22758_24099_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	99.6	2.9e-247
WP_169724907.1|24257_25373_+	DNA primase	NA	J9Q720	Salmonella_phage	97.6	2.5e-215
WP_169724842.1|25428_25848_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	54.9	8.8e-25
WP_169724843.1|25969_26764_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	97.0	3.2e-140
WP_169724908.1|27064_27322_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	94.1	2.2e-34
WP_169724844.1|27356_28679_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.1	2.4e-257
WP_022649968.1|28838_29051_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	5.8e-33
WP_116325911.1|29197_29503_+	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	98.0	4.1e-48
WP_169724845.1|30567_31293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169724846.1|31436_32363_-	DUF4238 domain-containing protein	NA	A0A0F7LBR6	Escherichia_phage	53.7	4.0e-86
WP_048228581.1|32440_32998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169724847.1|33207_33981_+	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.1	1.6e-88
WP_169724848.1|33991_34213_+	hypothetical protein	NA	A0A0B6VT64	Edwardsiella_phage	50.8	7.4e-07
WP_169724849.1|34209_34575_+	hypothetical protein	NA	K7PH35	Enterobacteria_phage	65.6	4.3e-36
WP_063137490.1|34574_34820_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	1.0e-12
WP_169724850.1|34915_35524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060458864.1|35533_35944_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_169724851.1|36116_37223_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.6	1.2e-25
WP_022649892.1|37214_37601_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_004110118.1|37864_38077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169724852.1|38186_40553_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	93.3	0.0e+00
WP_169724853.1|40649_41885_+	AAA family ATPase	NA	J9Q733	Salmonella_phage	99.0	2.5e-237
WP_169724854.1|42065_45584_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	98.9	0.0e+00
WP_165447193.1|45598_46024_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	99.3	2.8e-71
WP_169724855.1|46052_46616_-	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	65.1	9.9e-64
WP_169724856.1|47160_47592_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	3.4e-72
WP_169724857.1|47711_48740_+	regulator	NA	J9Q7Z3	Salmonella_phage	98.5	2.2e-162
WP_169724858.1|48800_49745_+	exonuclease	NA	J9Q7S6	Salmonella_phage	98.4	8.3e-180
WP_169724834.1|49744_50011_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	98.9	4.0e-39
WP_169724909.1|50058_51090_+	recombinase	NA	J9Q736	Salmonella_phage	98.8	7.6e-195
WP_000589750.1|51180_51381_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	93.9	9.3e-25
WP_004110049.1|51384_52215_+	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	99.3	1.1e-127
WP_169724859.1|52377_52749_+	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	97.6	2.0e-68
WP_004110038.1|53211_53487_+	hypothetical protein	NA	J9Q738	Salmonella_phage	97.8	4.1e-47
WP_004110036.1|53526_53706_+	hypothetical protein	NA	J9Q6J1	Salmonella_phage	98.3	7.3e-21
WP_169724860.1|53702_54038_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	99.1	3.5e-56
WP_006812558.1|54037_54250_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	98.6	3.1e-34
WP_169724861.1|54818_55883_-	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.9	2.4e-188
WP_022649908.1|56627_57272_+	hypothetical protein	NA	J9Q739	Salmonella_phage	99.1	2.2e-123
WP_169724862.1|57347_57842_+	N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	97.0	1.5e-87
WP_169724863.1|58018_59104_+	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	98.6	2.7e-206
WP_169724864.1|60746_61250_+	SMC family ATPase	NA	J9Q741	Salmonella_phage	98.8	2.4e-85
WP_169724865.1|61239_61986_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	97.6	3.2e-134
WP_169724866.1|61998_62568_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	98.9	2.9e-103
WP_169724867.1|62645_64961_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.5	0.0e+00
WP_169724868.1|65068_66211_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
WP_169724869.1|66293_67163_+	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	98.3	3.3e-159
WP_169724870.1|67351_68455_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.4	1.2e-214
WP_160956520.1|68474_68870_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.7	3.6e-68
WP_169724871.1|68872_69343_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	98.7	1.5e-86
WP_169724872.1|69342_69987_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	99.1	9.8e-116
WP_004109992.1|70050_70470_+	hypothetical protein	NA	J9Q743	Salmonella_phage	97.8	6.4e-68
WP_169724873.1|70479_71037_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	98.4	1.3e-100
WP_169724874.1|71165_72008_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	92.1	3.2e-106
WP_169724875.1|72193_72787_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	99.0	1.9e-110
WP_058671987.1|72990_73221_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	98.7	6.1e-36
WP_169724876.1|74061_76059_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.5	4.8e-20
WP_169724877.1|76123_77401_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_052768126.1|78150_78753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169724878.1|79147_79642_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	94.5	6.9e-77
WP_047055012.1|79651_79840_+	hypothetical protein	NA	J9Q800	Salmonella_phage	95.2	6.7e-25
WP_071692168.1|79957_80530_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.4	9.0e-97
WP_169724879.1|80671_82357_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	98.6	0.0e+00
WP_169724880.1|82415_83105_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	97.8	1.2e-122
WP_006812541.1|83101_83383_+	hypothetical protein	NA	J9Q801	Salmonella_phage	100.0	6.5e-48
WP_169724881.1|83385_83757_+	hypothetical protein	NA	J9Q7T4	Salmonella_phage	98.4	4.7e-62
WP_169724882.1|83848_84490_+	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	97.2	1.6e-110
WP_116325928.1|84486_85038_+	hypothetical protein	NA	J9Q748	Salmonella_phage	95.6	2.2e-100
WP_072105590.1|85076_85775_+	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	93.1	1.1e-115
WP_169724883.1|85830_86034_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	95.5	4.4e-30
WP_042863533.1|86573_86810_+	DUF1380 domain-containing protein	NA	J9Q7H8	Salmonella_phage	97.4	1.6e-39
86546:86564	attR	AGAAAACAAATTGTTTAAG	NA	NA	NA	NA
WP_040110257.1|86806_87127_+	hypothetical protein	NA	J9Q750	Salmonella_phage	93.4	1.3e-57
WP_169724884.1|87139_87538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165501436.1|88967_89210_-	hypothetical protein	NA	J9Q751	Salmonella_phage	93.8	2.0e-37
WP_169724885.1|89199_89514_-	DUF4084 domain-containing protein	NA	NA	NA	NA	NA
WP_169724886.1|89581_89800_+	hypothetical protein	NA	J9Q804	Salmonella_phage	95.8	1.2e-33
WP_016051706.1|89940_90252_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	100.0	6.5e-49
WP_100151356.1|90378_90774_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	97.7	9.7e-66
WP_160859095.1|90984_91182_+	hypothetical protein	NA	J9Q753	Salmonella_phage	98.5	1.6e-32
WP_169724887.1|91387_91870_+	hypothetical protein	NA	J9Q805	Salmonella_phage	95.6	5.7e-84
WP_016051712.1|92512_92716_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	100.0	1.3e-29
WP_105625583.1|92766_93417_-	hypothetical protein	NA	J9Q754	Salmonella_phage	98.6	6.0e-113
WP_169724888.1|93740_94268_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.6	9.9e-82
WP_000683475.1|94272_94695_-	hypothetical protein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
WP_169724889.1|94754_95033_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	96.7	7.1e-39
WP_169724890.1|95035_96595_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.2	2.2e-294
WP_169724891.1|96659_97358_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.3	6.2e-124
WP_169724892.1|97357_98026_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	96.8	4.0e-112
WP_006812519.1|98022_98661_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	99.5	1.1e-111
WP_169724893.1|98653_98908_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	96.4	7.7e-40
WP_169724894.1|98913_99804_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.3	6.4e-166
WP_000176291.1|99813_100080_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_169724895.1|100275_100917_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	97.7	3.7e-107
WP_002211787.1|100919_102176_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_169724896.1|102209_103784_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	98.5	1.2e-297
WP_169724897.1|103806_104703_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	3.6e-148
WP_169724898.1|104729_105605_+|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	99.3	5.5e-162
WP_169724899.1|105679_106345_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	93.5	3.0e-99
WP_000801184.1|106388_106823_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
WP_045339227.1|106822_107656_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	1.3e-152
WP_001027662.1|107753_108098_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_000523626.1|108088_108562_+	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
WP_169724900.1|108563_108947_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	99.2	2.9e-67
WP_006812510.1|109021_109768_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.4	6.8e-129
WP_000163862.1|109827_110145_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_169724901.1|110270_110495_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	98.6	1.2e-33
WP_169724902.1|110502_115086_+	tape measure protein	NA	J9Q712	Salmonella_phage	90.6	0.0e+00
WP_169724835.1|115127_115463_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	95.5	4.8e-58
WP_169724903.1|115552_116251_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.6	1.1e-136
WP_080112972.1|116243_117041_+	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	95.8	1.2e-155
WP_169724836.1|117028_117616_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.8	9.0e-100
WP_169724904.1|117637_122269_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.5	0.0e+00
WP_169724905.1|122285_122903_+	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.3	2.5e-28
>prophage 1
NZ_CP044337	Enterobacter hormaechei strain AKB48 plasmid unnamed2, complete sequence	94408	26971	65180	94408	transposase,protease	Escherichia_phage(40.0%)	35	NA	NA
WP_151316232.1|26971_27676_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_151317919.1|27908_28769_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|28781_29324_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_156660299.1|29805_29997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|30020_30248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169724928.1|30298_31435_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_169724929.1|31549_32920_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_014342213.1|33061_33187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169724930.1|34163_34868_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	98.7	2.2e-137
WP_151292574.1|35906_36404_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.1	4.1e-21
WP_001336345.1|36515_36806_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|36811_37603_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_134906484.1|37767_38115_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_169724931.1|38108_38948_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.8	6.5e-11
WP_000050481.1|39352_40894_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_169724932.1|41130_41967_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	58.1	4.3e-87
WP_000359986.1|42292_43066_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_077252464.1|43046_43328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002026779.1|43547_43733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169724933.1|43781_44966_+|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	34.8	1.5e-48
WP_000052512.1|45364_46840_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|46895_47780_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_169724934.1|48021_49425_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_130952409.1|49453_49777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169724935.1|49832_50813_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	2.0e-184
WP_169722059.1|51761_52730_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	2.8e-183
WP_004896925.1|53281_53824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169724936.1|54708_55413_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	98.7	2.9e-137
WP_169724937.1|58638_59148_-	MucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_169724938.1|59195_61283_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_169724939.1|61295_62246_-	DsbC family protein	NA	NA	NA	NA	NA
WP_169724940.1|62256_63519_-	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_169724941.1|63563_63839_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_045626302.1|64063_64447_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_169724942.1|64526_65180_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
