The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053074	Streptococcus dysgalactiae subsp. equisimilis strain TPCH-A88 chromosome, complete genome	2180924	230107	294178	2180924	integrase,tRNA,transposase,protease	Planktothrix_phage(14.29%)	58	274087:274129	302454:302496
WP_003057862.1|230107_230551_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_015057254.1|230648_231971_-	streptokinase	NA	NA	NA	NA	NA
WP_041781478.1|232298_233147_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003057915.1|233445_234579_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.8	2.1e-20
WP_022554186.1|234660_236274_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_015057257.1|236439_240063_+	pullulanase	NA	NA	NA	NA	NA
WP_003057858.1|240215_240506_-	hypothetical protein	NA	Q938I9	Temperate_phage	47.1	5.0e-11
WP_003057937.1|240661_241012_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_015057260.1|241118_241478_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_015057262.1|241705_242455_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.2	1.5e-22
WP_015057263.1|242467_243262_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_015057264.1|243359_244619_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_170078126.1|244809_246666_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015057266.1|246718_247276_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_015057267.1|247392_251790_+	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	35.3	1.7e-17
WP_003057923.1|251955_252384_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003057874.1|252469_253021_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015057269.1|253088_253703_-	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	36.9	3.9e-13
WP_015057270.1|254002_254668_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015057271.1|254758_255940_+	MFS transporter	NA	NA	NA	NA	NA
WP_003046456.1|256087_256357_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_015057275.1|256709_258770_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_002982644.1|258762_259047_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_015057276.1|259073_260453_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_015057277.1|260465_261194_+	transaldolase	NA	M4SLG0	Cyanophage	31.2	3.2e-14
WP_015057278.1|261474_263619_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_015057279.1|263611_264364_+	SseB family protein	NA	NA	NA	NA	NA
WP_015057280.1|264372_264957_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003062212.1|265207_265438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015057281.1|265465_266809_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.5	1.1e-52
WP_003061211.1|266801_267203_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_015057283.1|267645_268350_+	FUSC family protein	NA	NA	NA	NA	NA
WP_014611994.1|268760_269546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003059560.1|269593_270340_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_003049554.1|270343_270862_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_003059562.1|270960_271821_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	32.8	2.2e-09
WP_015057286.1|271955_272654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002982695.1|272650_272857_+	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	56.1	2.3e-10
WP_022554204.1|272993_273962_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.1	1.2e-37
WP_170172060.1|274035_275055_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	3.9e-34
274087:274129	attL	AAATTTCAAGTTGAAGTTAGCCAGTTTTAACATTTCTACTGGC	NA	NA	NA	NA
WP_002982710.1|275337_275784_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002982716.1|275804_276197_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_015057289.1|276307_277525_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015057290.1|277595_277856_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015057291.1|277915_278944_-	replication initiation factor	NA	NA	NA	NA	NA
WP_015057292.1|278946_279369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015057293.1|279650_280094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015057294.1|280245_280821_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015057295.1|281172_281328_+	type A2 lantipeptide	NA	NA	NA	NA	NA
WP_015057297.1|284223_286368_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	25.0	5.3e-25
WP_015057298.1|286364_287102_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	2.3e-28
WP_152652335.1|287103_289011_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_015057301.1|289049_290612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015057302.1|290592_291198_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015057303.1|291408_292665_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	56.0	6.3e-127
WP_015057304.1|292806_293082_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041781483.1|293068_293437_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_080554381.1|293815_294178_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
302454:302496	attR	GCCAGTAGAAATGTTAAAACTGGCTAACTTCAACTTGAAATTT	NA	NA	NA	NA
>prophage 2
NZ_CP053074	Streptococcus dysgalactiae subsp. equisimilis strain TPCH-A88 chromosome, complete genome	2180924	437366	448670	2180924		Streptococcus_phage(83.33%)	17	NA	NA
WP_003058688.1|437366_438131_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	9.5e-17
WP_170172086.1|438136_438841_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.4	1.8e-17
WP_003058678.1|438885_439548_+	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	57.4	1.2e-60
WP_003058667.1|439634_440270_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	65.9	6.8e-69
WP_003058651.1|440285_441158_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	41.4	5.9e-55
WP_003058683.1|441154_441955_+	signal peptidase II	NA	NA	NA	NA	NA
WP_003058686.1|441947_442271_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	64.2	7.0e-30
WP_003058668.1|442275_443139_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	76.0	3.5e-116
WP_003058684.1|443165_443558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003058655.1|443604_444234_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_015057358.1|444350_445442_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	62.8	7.7e-129
WP_003058661.1|445467_446019_+	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	54.1	2.7e-50
WP_003058665.1|446079_446577_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	52.9	1.4e-40
WP_003058672.1|446573_446930_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.0	1.8e-39
WP_003058659.1|446981_447290_-	VOC family protein	NA	NA	NA	NA	NA
WP_003058670.1|447291_447681_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_003058681.1|447842_448670_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	78.8	6.4e-128
>prophage 3
NZ_CP053074	Streptococcus dysgalactiae subsp. equisimilis strain TPCH-A88 chromosome, complete genome	2180924	460880	511778	2180924	protease,tRNA,transposase,bacteriocin	Mycobacterium_phage(18.18%)	53	NA	NA
WP_003055633.1|460880_462878_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.7	1.0e-86
WP_003055629.1|463410_464424_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	53.4	2.9e-98
WP_014612066.1|464427_464901_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	F8WQ19	Bacillus_phage	37.3	9.7e-12
WP_015057363.1|464884_467071_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	43.1	9.9e-168
WP_015057364.1|467368_468703_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_015057365.1|469101_469455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003054401.1|469803_470040_+	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_003054338.1|470032_470731_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_003054367.1|470727_470970_+	DUF3977 family protein	NA	NA	NA	NA	NA
WP_014612070.1|470987_471437_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_003054341.1|471438_472398_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003054334.1|472731_474069_+	MFS transporter	NA	NA	NA	NA	NA
WP_003061627.1|474187_475570_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	35.6	1.6e-30
WP_003054386.1|475600_476155_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003054365.1|476155_476407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015057367.1|476424_477120_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_003054353.1|477192_477840_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_003054333.1|477985_478918_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003054363.1|478982_479708_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.8	8.1e-18
WP_003054335.1|479708_480557_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003054349.1|480687_481494_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	37.8	2.1e-22
WP_037587270.1|481711_484120_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	51.1	2.5e-87
WP_012766635.1|484188_484542_-	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_003049875.1|484784_485210_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003049876.1|485315_486005_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_170078132.1|486279_486459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003054374.1|486507_486675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003049878.1|486942_487671_+	UMP kinase	NA	NA	NA	NA	NA
WP_003054381.1|487699_488257_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_015057368.1|488376_489234_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015057369.1|489306_489816_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_003060598.1|489812_490028_+	YozE family protein	NA	NA	NA	NA	NA
WP_065957590.1|490166_491351_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XB61	Gordonia_phage	38.7	2.8e-15
WP_015057371.1|491661_493434_+	oleate hydratase	NA	NA	NA	NA	NA
WP_015057372.1|493594_494656_+	PhoH family protein	NA	W8D063	Erwinia_phage	48.6	7.1e-47
WP_015057373.1|494702_495278_+	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_003054373.1|495436_495934_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_003054389.1|495914_496322_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_012766643.1|496442_497339_+	GTPase Era	NA	NA	NA	NA	NA
WP_015057375.1|497662_499069_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.6	5.6e-15
WP_003062179.1|499371_499599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002994587.1|499647_499965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003054359.1|500372_500612_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003054392.1|500625_500811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015057380.1|502584_503334_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015057381.1|503334_504669_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_011017462.1|504816_504942_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_015057382.1|505018_506383_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_015057385.1|508827_509052_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_015057386.1|509074_509407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003059989.1|509476_510340_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015057387.1|510597_511008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080147981.1|511475_511778_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP053074	Streptococcus dysgalactiae subsp. equisimilis strain TPCH-A88 chromosome, complete genome	2180924	1090985	1147674	2180924	tRNA,transposase,bacteriocin	Bacillus_virus(16.67%)	58	NA	NA
WP_170172068.1|1090985_1092446_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	91.7	4.2e-255
WP_003057625.1|1092751_1093957_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_015057615.1|1094345_1094576_-	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_015057616.1|1094639_1095662_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_170078182.1|1095863_1096874_+|transposase	IS30-like element IS1239 family transposase	transposase	H7BVY4	unidentified_phage	31.9	6.0e-35
WP_015057618.1|1096870_1099330_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.1e-94
WP_012767067.1|1099526_1100345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003059704.1|1100411_1102361_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.7	1.2e-121
WP_014612314.1|1102495_1103137_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_015057619.1|1103196_1104468_-	dihydroorotase	NA	NA	NA	NA	NA
WP_015057620.1|1104591_1105245_-	uracil-DNA glycosylase	NA	A0A0N9QWR4	Chrysochromulina_ericina_virus	39.0	4.7e-33
WP_003057640.1|1105377_1106028_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_015057621.1|1106056_1106920_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_170078184.1|1107038_1108493_-	amidase	NA	NA	NA	NA	NA
WP_015057622.1|1108671_1109370_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	51.8	1.9e-40
WP_003053721.1|1109439_1110186_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003060988.1|1110226_1110856_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	34.1	1.4e-05
WP_003053723.1|1110916_1111609_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_012767079.1|1111820_1112369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003059838.1|1112592_1113510_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003053701.1|1113591_1114362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003053699.1|1114354_1115068_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_015057623.1|1115619_1116429_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_022554718.1|1116412_1116853_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	54.5	1.3e-34
WP_015057625.1|1116871_1118083_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_003060751.1|1118161_1118845_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_015057626.1|1118986_1120363_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_015057627.1|1120430_1121840_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_003054310.1|1122017_1122620_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_015057628.1|1122932_1123076_+	pyruvate oxidase	NA	NA	NA	NA	NA
WP_080936986.1|1123101_1124004_+	pyruvate oxidase	NA	NA	NA	NA	NA
WP_003054306.1|1123967_1124147_+	pyruvate oxidase	NA	NA	NA	NA	NA
WP_015057631.1|1124174_1124591_+	pyruvate oxidase	NA	NA	NA	NA	NA
WP_015057632.1|1124643_1126428_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003054304.1|1126557_1126707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170078185.1|1126762_1128139_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015057633.1|1128216_1128924_-	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_015057634.1|1129093_1129414_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015057635.1|1129475_1130471_+	permease	NA	NA	NA	NA	NA
WP_003051110.1|1130480_1130738_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_015057636.1|1131025_1131592_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003058422.1|1131607_1132282_-	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	27.0	1.5e-10
WP_003058426.1|1132400_1132907_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_015057637.1|1133002_1134052_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_065957640.1|1134038_1134833_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015057639.1|1134836_1136486_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_015057640.1|1136631_1137459_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_015057641.1|1137455_1138265_-	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_003058434.1|1138281_1138773_-	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_003058453.1|1138792_1139218_-	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
WP_015057642.1|1139424_1140444_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_003058420.1|1140554_1141724_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_003058441.1|1141913_1142210_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_015057644.1|1142209_1142440_-|bacteriocin	bacteriocin ubericin-A	bacteriocin	NA	NA	NA	NA
WP_014612329.1|1143310_1143748_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_014612330.1|1143922_1145755_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.0	2.2e-19
WP_003060137.1|1145824_1146283_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	46.3	4.8e-24
WP_155115628.1|1146568_1147674_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.6	3.3e-71
>prophage 5
NZ_CP053074	Streptococcus dysgalactiae subsp. equisimilis strain TPCH-A88 chromosome, complete genome	2180924	1219251	1291064	2180924	transposase	Bacillus_phage(21.43%)	51	NA	NA
WP_170078187.1|1219251_1220280_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.6	3.1e-39
WP_015057680.1|1220435_1221689_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003057790.1|1221969_1223331_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003051318.1|1223330_1224167_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_014612372.1|1224339_1225137_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015057685.1|1228345_1230049_-	alpha-glycosidase	NA	NA	NA	NA	NA
WP_015057686.1|1230213_1231473_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_015057687.1|1231870_1233127_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_002984216.1|1233119_1233359_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_015057688.1|1233376_1234633_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	28.5	3.0e-20
WP_012767157.1|1234629_1236168_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.1	3.5e-42
WP_012767158.1|1236179_1236323_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_014612377.1|1236575_1238567_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_015057689.1|1238753_1240931_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011284902.1|1240930_1241671_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.1	1.5e-35
WP_170078188.1|1241881_1242424_+	nicotinamide riboside transporter PnuC	NA	NA	NA	NA	NA
WP_002984154.1|1242428_1242587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003060980.1|1242655_1243969_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_002989532.1|1244023_1244152_-	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_015057691.1|1244328_1245570_+	aminopeptidase	NA	NA	NA	NA	NA
WP_003059989.1|1245734_1246598_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_041781645.1|1246611_1247517_+	magnesium transporter CorA	NA	NA	NA	NA	NA
WP_015057695.1|1247567_1248299_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_015057696.1|1248414_1248780_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_003061288.1|1248878_1250099_-	MFS transporter	NA	NA	NA	NA	NA
WP_003056493.1|1250471_1251956_+	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_003056508.1|1252032_1252803_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_003056491.1|1252799_1253456_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.9	3.5e-20
WP_003056505.1|1253659_1254052_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003060407.1|1254133_1254928_-	nucleoside phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	83.5	1.0e-77
WP_111711604.1|1256950_1258076_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	27.3	3.4e-15
WP_015057705.1|1260724_1261549_-	replication initiator protein A	NA	A0A286QNA4	Streptococcus_phage	35.5	4.9e-11
WP_014612392.1|1261545_1261719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014612393.1|1261930_1263613_-	recombinase family protein	NA	A0A1B1P7M0	Bacillus_phage	27.3	2.9e-34
WP_000368178.1|1263703_1263865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000032597.1|1264353_1264764_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003059989.1|1265054_1265918_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_000806660.1|1266002_1267355_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_000889914.1|1267391_1268801_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.0	9.6e-15
WP_000269781.1|1268788_1269481_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001208951.1|1269480_1270062_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_000668731.1|1270092_1271829_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	5.3e-31
WP_000726617.1|1271832_1273746_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.2	1.1e-37
WP_000332326.1|1273862_1274468_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000013381.1|1274918_1275275_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001018659.1|1275277_1276609_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_003059989.1|1276864_1277728_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_000464629.1|1280685_1281510_-	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_001210633.1|1282815_1283022_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	51.6	3.3e-09
WP_000384985.1|1283162_1283822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155115630.1|1289958_1291064_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	49.6	1.1e-71
>prophage 6
NZ_CP053074	Streptococcus dysgalactiae subsp. equisimilis strain TPCH-A88 chromosome, complete genome	2180924	1471864	1524724	2180924	integrase,tRNA,tail,transposase	Wolbachia_phage(16.67%)	50	1473141:1473155	1520897:1520911
WP_170078948.1|1471864_1473094_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.3	1.6e-34
1473141:1473155	attL	AGGATAAACAATAAA	NA	NA	NA	NA
WP_022554978.1|1473320_1474286_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_022554979.1|1474364_1475306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015057896.1|1475307_1476786_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	2.3e-11
WP_003051896.1|1476801_1477200_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_170172070.1|1477174_1478086_-	ribokinase	NA	NA	NA	NA	NA
WP_003053684.1|1478078_1479062_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015057897.1|1479340_1480378_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_003051905.1|1480364_1480856_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	34.2	6.1e-17
WP_041781651.1|1480845_1481385_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003061055.1|1481578_1482571_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.9	2.1e-53
WP_015057899.1|1482897_1483848_-	carbamate kinase	NA	NA	NA	NA	NA
WP_003054206.1|1484151_1485381_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.3	1.1e-33
WP_015057902.1|1485485_1486817_-	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
WP_014612467.1|1486833_1488327_-	YfcC family protein	NA	NA	NA	NA	NA
WP_014612468.1|1488497_1489511_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_012767312.1|1489634_1489976_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002983803.1|1490075_1491311_-	arginine deiminase	NA	NA	NA	NA	NA
WP_003061466.1|1491586_1492267_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003057398.1|1492408_1492882_+	arginine repressor	NA	NA	NA	NA	NA
WP_015057903.1|1493059_1493776_-	B3/4 domain-containing protein	NA	NA	NA	NA	NA
WP_015057904.1|1493789_1494869_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_015057905.1|1494941_1496675_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	34.1	7.9e-27
WP_014612471.1|1496671_1497412_-	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	32.4	8.0e-05
WP_003055983.1|1497499_1498606_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003055993.1|1498648_1499272_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_003055974.1|1499284_1499995_-	thiol-disulfide oxidoreductase-associated membrane protein CcdA2	NA	NA	NA	NA	NA
WP_003055981.1|1500214_1501147_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_015057907.1|1501238_1502198_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003044506.1|1503360_1503654_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_170172071.1|1503664_1504690_-	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_015057909.1|1504686_1505361_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_015057910.1|1505362_1506211_-	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_015057911.1|1506215_1508111_-	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_015057912.1|1508110_1508839_-	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_015057913.1|1508971_1511398_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_015057915.1|1511574_1512708_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_015057916.1|1512990_1515639_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.2	1.1e-149
WP_003062442.1|1515640_1516204_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_015057917.1|1516200_1516791_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012767324.1|1516804_1517188_-	VOC family protein	NA	V5UQY3	Oenococcus_phage	50.0	2.6e-31
WP_012767325.1|1517542_1517938_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003055949.1|1517958_1518213_-	DUF1912 family protein	NA	NA	NA	NA	NA
WP_170172072.1|1518314_1519292_-|transposase	IS30-like element IS1239 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.4e-35
WP_015057919.1|1519620_1520757_-|integrase	tyrosine-type recombinase/integrase	integrase	A8ATX2	Listeria_phage	30.6	1.0e-27
WP_015057920.1|1520806_1521133_-	DUF771 domain-containing protein	NA	A0A075LYF5	Staphylococcus_phage	29.5	2.4e-06
1520897:1520911	attR	AGGATAAACAATAAA	NA	NA	NA	NA
WP_015057921.1|1521325_1521925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015057922.1|1522028_1522790_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_015057923.1|1522814_1523372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015057924.1|1523371_1524724_-|tail	phage tail lysozyme domain-containing protein	tail	NA	NA	NA	NA
>prophage 7
NZ_CP053074	Streptococcus dysgalactiae subsp. equisimilis strain TPCH-A88 chromosome, complete genome	2180924	1601793	1644966	2180924	terminase,portal,integrase,holin,capsid,tail	Streptococcus_phage(43.33%)	68	1611336:1611351	1645504:1645519
WP_041781606.1|1601793_1602723_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.3	2.6e-37
WP_012767355.1|1603182_1604541_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	NA	NA	NA	NA
WP_170078152.1|1604731_1604914_-	Paratox	NA	A3F673	Streptococcus_phage	90.0	3.6e-23
WP_048327315.1|1605389_1605599_-	helix-turn-helix transcriptional regulator	NA	A3F668	Streptococcus_phage	98.6	7.7e-30
WP_164406938.1|1605752_1605899_+	hypothetical protein	NA	A3F667	Streptococcus_phage	100.0	2.3e-17
WP_048327312.1|1606040_1606292_+	hypothetical protein	NA	A3F666	Streptococcus_phage	96.4	1.6e-42
WP_115261972.1|1606436_1607189_-	SH3 domain-containing protein	NA	A3F665	Streptococcus_phage	100.0	1.8e-145
WP_003058873.1|1607310_1607538_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
WP_003058867.1|1607534_1607807_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	89.9	2.1e-35
WP_170172075.1|1607818_1608430_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	88.2	1.2e-78
WP_155961741.1|1608432_1608864_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	80.4	1.1e-57
WP_170078151.1|1608877_1610770_-	hyaluronidase	NA	A3F659	Streptococcus_phage	65.4	8.6e-144
WP_170078150.1|1610778_1611417_-	hypothetical protein	NA	A0A097PBF7	Streptococcus_pyogenes_phage	74.0	8.0e-86
1611336:1611351	attL	TGCCTTTTTGTAATAA	NA	NA	NA	NA
WP_170078149.1|1611416_1612250_-	collagen-like protein	NA	A3F657	Streptococcus_phage	69.4	6.7e-16
WP_170078148.1|1612249_1614397_-	peptidase	NA	Q938K1	Temperate_phage	90.7	0.0e+00
WP_170078147.1|1614393_1615110_-|tail	phage tail protein	tail	Q938K2	Temperate_phage	92.9	6.6e-129
WP_170078146.1|1615109_1618367_-	tape measure protein	NA	Q938K3	Temperate_phage	95.3	0.0e+00
WP_065361216.1|1618356_1618938_-	hypothetical protein	NA	Q938K4	Temperate_phage	71.0	3.6e-77
WP_030127689.1|1618946_1619381_-	hypothetical protein	NA	Q938K5	Temperate_phage	75.7	2.3e-52
WP_030127725.1|1619426_1619912_-	hypothetical protein	NA	Q938K6	Temperate_phage	83.1	5.2e-69
WP_030127726.1|1619911_1620310_-|capsid	phage capsid protein	capsid	Q79S87	Temperate_phage	98.5	7.2e-69
WP_065361215.1|1620306_1620663_-|capsid	capsid protein	capsid	Q79S88	Temperate_phage	99.2	4.5e-62
WP_030127753.1|1620662_1620995_-	hypothetical protein	NA	Q79S86	Temperate_phage	94.5	4.5e-56
WP_030127695.1|1620984_1621401_-	hypothetical protein	NA	Q938K7	Temperate_phage	91.0	2.2e-52
WP_010922080.1|1621454_1622273_-|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	100.0	4.0e-146
WP_030127694.1|1622276_1622891_-	hypothetical protein	NA	Q938K8	Temperate_phage	99.0	2.2e-96
WP_136019522.1|1623101_1623371_-	hypothetical protein	NA	Q938K9	Temperate_phage	81.8	1.8e-31
WP_030127692.1|1623430_1623670_-	hypothetical protein	NA	Q938L0	Temperate_phage	96.2	4.1e-35
WP_030127691.1|1623641_1625120_-|capsid	phage capsid protein	capsid	Q938L1	Temperate_phage	94.1	1.3e-256
WP_076636814.1|1625124_1626627_-|portal	phage portal protein	portal	Q938L2	Temperate_phage	97.0	1.3e-275
WP_111705332.1|1626640_1627891_-|terminase	PBSX family phage terminase large subunit	terminase	Q938L3	Temperate_phage	97.3	3.4e-221
WP_030126039.1|1627929_1628643_-|terminase	terminase	terminase	A0A2H4J4R0	uncultured_Caudovirales_phage	34.5	2.6e-29
WP_143935192.1|1629171_1629609_-	DUF1492 domain-containing protein	NA	A0A097PBF1	Streptococcus_pyogenes_phage	98.6	3.9e-76
WP_152652371.1|1629972_1630308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170078145.1|1630366_1630726_-	DUF1642 domain-containing protein	NA	Q938L9	Temperate_phage	36.9	9.3e-07
WP_170078218.1|1630728_1631091_-	HNH endonuclease	NA	Q7Y4J8	Streptococcus_phage	70.3	6.8e-42
WP_170078144.1|1631080_1631563_-	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	96.2	1.5e-89
WP_170172076.1|1631564_1631792_-	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	65.2	8.4e-14
WP_155977159.1|1631784_1631985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155977161.1|1631971_1632202_-	hypothetical protein	NA	A0A2I6QQY3	Streptococcus_phage	94.3	2.0e-31
WP_155977163.1|1632201_1632363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165746059.1|1632359_1632542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165746060.1|1632544_1632964_-	hypothetical protein	NA	A0A141E233	Streptococcus_phage	55.2	1.6e-34
WP_165746061.1|1632960_1633236_-	DUF1599 domain-containing protein	NA	J7KDH9	Streptococcus_phage	73.6	2.6e-33
WP_170078142.1|1633477_1633834_-	hypothetical protein	NA	A0A1P8VVP9	Streptococcus_phage	85.6	8.5e-53
WP_111681758.1|1633830_1634271_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A097PAS0	Streptococcus_pyogenes_phage	89.7	2.7e-72
WP_170078141.1|1634270_1634477_-	hypothetical protein	NA	Q938M6	Temperate_phage	72.6	6.4e-21
WP_170078140.1|1634488_1634911_-	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	91.4	8.8e-65
WP_170078139.1|1634903_1635578_-	single-stranded DNA-binding protein	NA	A0A097PBE8	Streptococcus_pyogenes_phage	90.6	3.2e-109
WP_170078138.1|1635578_1636061_-	siphovirus Gp157 family protein	NA	A0A1P8VVS5	Streptococcus_phage	97.5	1.9e-76
WP_170078137.1|1636082_1636337_-	hypothetical protein	NA	Q938N0	Temperate_phage	89.3	6.1e-37
WP_170078136.1|1636323_1636674_-	hypothetical protein	NA	A0A097PAU3	Streptococcus_pyogenes_phage	69.8	2.0e-38
WP_126425998.1|1636811_1637594_-	ATP-binding protein	NA	A0A097PAQ0	Streptococcus_pyogenes_phage	97.7	6.0e-144
WP_159333941.1|1637580_1638297_-	replication initiator protein A	NA	A0A097PBE7	Streptococcus_pyogenes_phage	87.0	3.6e-119
WP_021340647.1|1638415_1638556_-	hypothetical protein	NA	A0A1P8VVR9	Streptococcus_phage	93.3	1.5e-16
WP_170078135.1|1638586_1638841_-	hypothetical protein	NA	A0A1P8VVV6	Streptococcus_phage	96.4	6.9e-41
WP_021340658.1|1638911_1639097_-	helix-turn-helix transcriptional regulator	NA	J7KH19	Streptococcus_phage	83.6	1.4e-22
WP_048327839.1|1639243_1639468_+	hypothetical protein	NA	B3GVX5	Streptococcus_phage	67.1	4.3e-18
WP_021341082.1|1639667_1639811_+	hypothetical protein	NA	M1PFC9	Streptococcus_phage	72.3	2.4e-11
WP_170078134.1|1639783_1639960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110408006.1|1639972_1640698_-	phage antirepressor KilAC domain-containing protein	NA	A0A141E1D3	Streptococcus_phage	81.6	1.4e-105
WP_046176844.1|1640730_1640919_-	helix-turn-helix transcriptional regulator	NA	A0A0B5A7F0	Streptococcus_phage	66.7	1.1e-14
WP_110408000.1|1641013_1641745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110408001.1|1641719_1641992_-	hypothetical protein	NA	Q7Y4L1	Streptococcus_phage	83.3	2.9e-05
WP_110408002.1|1642026_1642185_-	hypothetical protein	NA	J7KH24	Streptococcus_phage	98.1	5.3e-23
WP_110408003.1|1642544_1643309_+	helix-turn-helix transcriptional regulator	NA	E8ZDN4	Streptococcus_phage	64.1	2.6e-83
WP_111706070.1|1643318_1643624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170078133.1|1643799_1644966_+|integrase	tyrosine-type recombinase/integrase	integrase	A3F610	Streptococcus_phage	42.9	9.2e-80
1645504:1645519	attR	TTATTACAAAAAGGCA	NA	NA	NA	NA
>prophage 8
NZ_CP053074	Streptococcus dysgalactiae subsp. equisimilis strain TPCH-A88 chromosome, complete genome	2180924	1933677	1999023	2180924	tRNA,transposase,protease	Bacillus_phage(30.77%)	51	NA	NA
WP_003053372.1|1933677_1935126_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012767572.1|1935258_1936527_-	MFS transporter	NA	NA	NA	NA	NA
WP_003053382.1|1936621_1937323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015058072.1|1938001_1938718_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_003053380.1|1938853_1939348_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_041781622.1|1939537_1940899_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003053378.1|1940981_1941428_-	dUTP diphosphatase	NA	Q332E8	Clostridium_botulinum_C_phage	52.7	5.9e-35
WP_015058074.1|1941535_1942303_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_015058075.1|1942421_1944206_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	8.6e-45
WP_003053361.1|1944205_1945915_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	3.1e-36
WP_003053369.1|1945907_1946357_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015058076.1|1946557_1947574_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003061497.1|1947605_1948508_+	UTP--glucose-1-phosphate uridylyltransferase HasC	NA	A0A127AW70	Bacillus_phage	51.5	2.1e-76
WP_003053389.1|1949492_1950167_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_012767579.1|1950163_1950691_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_170078207.1|1951231_1952899_-	thioester-forming surface-anchored protein	NA	NA	NA	NA	NA
WP_022554204.1|1953228_1954197_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.1	1.2e-37
WP_015058080.1|1954521_1956027_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003060194.1|1956140_1957265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003058263.1|1957300_1957798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143978853.1|1958024_1959014_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	5.0e-34
WP_003058262.1|1959145_1960495_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_015058082.1|1960734_1961316_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_012767582.1|1961430_1962051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015058083.1|1962135_1962840_-	exotoxin	NA	NA	NA	NA	NA
WP_003053479.1|1963264_1964485_+	lipoprotein	NA	NA	NA	NA	NA
WP_012767586.1|1964586_1965114_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_015058086.1|1965113_1965893_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003062556.1|1966032_1966572_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_012767589.1|1966575_1966887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015058087.1|1967104_1968247_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.9	1.3e-86
WP_015058088.1|1968466_1969333_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_012767592.1|1969453_1969921_-	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_015058089.1|1969987_1970428_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_041781623.1|1970634_1973277_-	DNA polymerase I	NA	S5M8J1	Bacillus_phage	34.7	4.5e-50
WP_015058091.1|1973421_1975149_-	ABC transporter permease/substrate binding protein	NA	NA	NA	NA	NA
WP_003061128.1|1975166_1976363_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.7	1.5e-29
WP_003055714.1|1976795_1977707_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	25.7	1.8e-14
WP_170078208.1|1977919_1979011_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_003055705.1|1979307_1980954_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_012767596.1|1981236_1981953_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_015058093.1|1981954_1982818_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003055711.1|1982821_1983484_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_015017460.1|1983592_1984078_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002986367.1|1984200_1984479_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_015058094.1|1984549_1985983_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_015058095.1|1986287_1988789_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.5	0.0e+00
WP_155115635.1|1989864_1990815_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.7	2.5e-35
WP_014612618.1|1991981_1992299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003059989.1|1996311_1997175_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_170078972.1|1997918_1999023_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	49.6	5.1e-72
>prophage 9
NZ_CP053074	Streptococcus dysgalactiae subsp. equisimilis strain TPCH-A88 chromosome, complete genome	2180924	2015550	2059319	2180924	portal,terminase,transposase,protease,head,integrase,holin,capsid,tail	Streptococcus_phage(92.45%)	56	2024760:2024783	2056615:2056638
WP_015058108.1|2015550_2017995_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	36.4	1.6e-129
WP_003054759.1|2017994_2018456_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003053018.1|2018651_2018855_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	81.5	1.2e-24
WP_170078210.1|2020316_2021771_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	91.5	7.1e-255
WP_015058113.1|2022192_2022417_-	hypothetical protein	NA	Q938K9	Temperate_phage	60.2	2.3e-16
WP_015058114.1|2022469_2022889_-	HD domain-containing protein	NA	A0A060QNR4	Streptococcus_phage	61.8	2.2e-39
WP_015058115.1|2022885_2023092_-	hypothetical protein	NA	A0A141E1X9	Streptococcus_phage	35.4	8.2e-08
2024760:2024783	attL	CGCCCCAAATTCGCCCCAAATTAT	NA	NA	NA	NA
WP_000179397.1|2024779_2025850_-|integrase	site-specific integrase	integrase	A0A1P8VVR7	Streptococcus_phage	100.0	2.1e-200
WP_001173134.1|2025971_2026376_-	DUF4429 domain-containing protein	NA	A0A1P8VVY3	Streptococcus_phage	100.0	8.1e-68
WP_000762727.1|2026428_2026809_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVS0	Streptococcus_phage	100.0	4.5e-68
WP_000114553.1|2026815_2027178_-	helix-turn-helix transcriptional regulator	NA	A0A1P8VVY1	Streptococcus_phage	100.0	3.0e-61
WP_000511144.1|2027463_2027628_+	hypothetical protein	NA	A0A1P8VVU2	Streptococcus_phage	100.0	1.8e-21
WP_001052630.1|2027610_2028081_-	hypothetical protein	NA	A0A1P8VVS1	Streptococcus_phage	98.7	8.8e-82
WP_000082755.1|2028141_2028351_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVQ4	Streptococcus_phage	91.3	3.2e-28
WP_001002368.1|2028353_2029064_+	ORF6C domain-containing protein	NA	A0A1S5SF52	Streptococcus_phage	82.1	3.5e-114
WP_000998973.1|2029123_2029408_+	hypothetical protein	NA	A0A1P8VVZ3	Streptococcus_phage	93.6	2.5e-47
WP_001061697.1|2029424_2029640_+	hypothetical protein	NA	C5J986	Streptococcus_phage	62.0	6.1e-14
WP_000343908.1|2029648_2030980_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	98.0	7.7e-240
WP_025194474.1|2030982_2031585_+	hypothetical protein	NA	A0A1P8VVT8	Streptococcus_phage	64.0	3.8e-69
WP_000079054.1|2031562_2032309_+	conserved phage C-terminal domain-containing protein	NA	A0A1P8VVR3	Streptococcus_phage	98.4	1.5e-136
WP_001067867.1|2032309_2033131_+	ATP-binding protein	NA	A0A1P8VVV9	Streptococcus_phage	92.3	2.9e-144
WP_153204894.1|2033173_2033329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169322.1|2033321_2033813_+	hypothetical protein	NA	A0A1P8VVP1	Streptococcus_phage	95.7	4.9e-83
WP_000793494.1|2033812_2034142_+	DUF1372 family protein	NA	A0A1P8VVQ5	Streptococcus_phage	94.5	1.1e-54
WP_070467532.1|2034270_2034498_+	DUF3310 domain-containing protein	NA	M1NRN1	Streptococcus_phage	87.7	4.4e-31
WP_000748199.1|2034494_2034701_+	hypothetical protein	NA	A0A1P8VVV0	Streptococcus_phage	100.0	6.2e-32
WP_000609565.1|2034690_2035107_+	single-stranded DNA-binding protein	NA	A0A1P8VVS8	Streptococcus_phage	100.0	8.6e-73
WP_001008140.1|2035116_2035377_+	hypothetical protein	NA	A0A1P8VVV2	Streptococcus_phage	100.0	9.9e-43
WP_000776714.1|2035373_2035721_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVV5	Streptococcus_phage	100.0	4.0e-63
WP_000163169.1|2035717_2036182_+	hypothetical protein	NA	A0A1P8VVT5	Streptococcus_phage	100.0	1.8e-82
WP_001028147.1|2036291_2036834_+|integrase	site-specific integrase	integrase	A0A1S5SCL7	Streptococcus_phage	100.0	9.8e-101
WP_000651009.1|2037123_2037411_+	hypothetical protein	NA	A0A1P8VVZ1	Streptococcus_phage	100.0	3.6e-46
WP_000542279.1|2037410_2037770_+	HNH endonuclease	NA	A0A1P8VVU5	Streptococcus_phage	100.0	6.3e-64
WP_170172081.1|2037857_2038343_+	hypothetical protein	NA	A0A1P8VVU4	Streptococcus_phage	98.7	1.2e-78
WP_000230004.1|2038335_2040048_+|terminase	terminase large subunit	terminase	A0A1P8VVW5	Streptococcus_phage	100.0	0.0e+00
WP_001067328.1|2040056_2041199_+|portal	phage portal protein	portal	A0A1P8VVT4	Streptococcus_phage	100.0	6.6e-216
WP_000413200.1|2041248_2041791_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1P8VVX2	Streptococcus_phage	100.0	2.7e-98
WP_000749070.1|2041801_2043064_+|capsid	phage major capsid protein	capsid	A0A1P8VVT0	Streptococcus_phage	100.0	2.6e-229
WP_000153862.1|2043084_2043420_+	hypothetical protein	NA	A0A1P8VVS7	Streptococcus_phage	100.0	7.0e-57
WP_000842789.1|2043416_2043722_+|head,tail	head-tail adaptor protein	head,tail	A0A1P8VVX4	Streptococcus_phage	100.0	5.8e-42
WP_001074486.1|2043721_2044069_+	hypothetical protein	NA	A0A1P8VVS6	Streptococcus_phage	100.0	1.1e-60
WP_000508738.1|2044055_2044400_+	hypothetical protein	NA	A0A1P8VVU6	Streptococcus_phage	100.0	1.5e-59
WP_000222195.1|2044414_2045098_+	hypothetical protein	NA	A0A1P8VVR1	Streptococcus_phage	100.0	9.1e-128
WP_000591558.1|2045097_2045574_+	hypothetical protein	NA	A0A1P8VVU0	Streptococcus_phage	100.0	9.2e-87
WP_000140779.1|2045759_2048495_+|tail	phage tail tape measure protein	tail	A0A1P8VVW8	Streptococcus_phage	100.0	7.3e-269
WP_000161557.1|2048491_2049214_+	hypothetical protein	NA	A0A1P8VVR4	Streptococcus_phage	100.0	2.8e-135
WP_170172082.1|2049214_2052889_+|tail	phage tail protein	tail	A0A1P8VVT1	Streptococcus_phage	99.8	0.0e+00
WP_001071121.1|2052905_2053136_+	hypothetical protein	NA	A0A1P8VVV7	Streptococcus_phage	100.0	2.9e-30
WP_000213866.1|2053138_2053477_+	hypothetical protein	NA	A0A1P8VVU3	Streptococcus_phage	100.0	4.3e-62
WP_001135353.1|2053511_2053922_+	hypothetical protein	NA	A0A1P8VVS2	Streptococcus_phage	100.0	2.0e-69
WP_000192161.1|2053924_2054254_+|holin	phage holin	holin	A0A1P8VVR0	Streptococcus_phage	100.0	4.8e-50
WP_000405192.1|2054257_2055664_+	glucosaminidase domain-containing protein	NA	A0A1P8VVS3	Streptococcus_phage	100.0	6.9e-231
WP_000139836.1|2055870_2056056_+	type II toxin-antitoxin system HicA family toxin	NA	A0A1P8VVU8	Streptococcus_phage	100.0	2.6e-29
WP_000878126.1|2056116_2056521_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A1P8VVW2	Streptococcus_phage	100.0	1.4e-67
WP_003058719.1|2057205_2057766_+	peroxiredoxin	NA	NA	NA	NA	NA
2056615:2056638	attR	CGCCCCAAATTCGCCCCAAATTAT	NA	NA	NA	NA
WP_015058118.1|2057786_2059319_+	alkyl hydroperoxide reductase subunit F	NA	V9VEY6	Lactococcus_phage	29.4	1.5e-21
>prophage 10
NZ_CP053074	Streptococcus dysgalactiae subsp. equisimilis strain TPCH-A88 chromosome, complete genome	2180924	2136009	2143217	2180924	integrase	Streptococcus_phage(57.14%)	12	2135125:2135137	2143519:2143531
2135125:2135137	attL	TCCTTGAAGCTGT	NA	NA	NA	NA
WP_015058156.1|2136009_2137623_-	hypothetical protein	NA	A0A1P8BMF9	Lactococcus_phage	52.9	1.2e-146
WP_170078214.1|2137612_2138134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011285315.1|2138143_2138512_-	hypothetical protein	NA	A0A1X9I6M4	Streptococcus_phage	47.1	2.6e-12
WP_015058158.1|2138420_2138618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014612652.1|2138598_2138739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015058159.1|2138735_2139068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170078215.1|2139276_2139519_-	phage antirepressor protein	NA	NA	NA	NA	NA
WP_015058161.1|2139574_2140138_-	hypothetical protein	NA	A0A0A7S0G2	Clostridium_phage	45.8	6.3e-26
WP_015058162.1|2140208_2140397_-	hypothetical protein	NA	A0A1X9I5U7	Streptococcus_phage	39.3	7.7e-05
WP_015058163.1|2140569_2140974_+	helix-turn-helix transcriptional regulator	NA	A0A286QRM9	Streptococcus_phage	47.8	1.3e-09
WP_012767673.1|2141284_2141809_+	hypothetical protein	NA	A8ASM1	Listeria_phage	34.3	5.3e-11
WP_015058164.1|2142053_2143217_+|integrase	site-specific integrase	integrase	A0A1X9I6A9	Streptococcus_phage	70.8	1.3e-161
2143519:2143531	attR	ACAGCTTCAAGGA	NA	NA	NA	NA
