The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046426	Bacteroides dorei strain JR03 chromosome, complete genome	5510617	456020	495370	5510617	transposase,integrase	Croceibacter_phage(25.0%)	45	448276:448290	496879:496893
448276:448290	attL	AATGTGCGTGAACTT	NA	NA	NA	NA
WP_005636919.1|456020_457184_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_170272886.1|457423_458563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005636926.1|458595_459606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080707039.1|460162_460549_+	DUF4134 domain-containing protein	NA	NA	NA	NA	NA
WP_005636934.1|460554_460881_+	DUF4133 domain-containing protein	NA	NA	NA	NA	NA
WP_035450349.1|460877_463412_+	TraG family conjugative transposon ATPase	NA	NA	NA	NA	NA
WP_005636939.1|463408_463765_+	DUF3876 domain-containing protein	NA	NA	NA	NA	NA
WP_005636941.1|463761_464391_+	DUF4141 domain-containing protein	NA	NA	NA	NA	NA
WP_005636943.1|464393_465407_+	conjugative transposon protein TraJ	NA	NA	NA	NA	NA
WP_005636947.1|465530_466154_+	conjugative transposon protein TraK	NA	NA	NA	NA	NA
WP_005656892.1|466150_466450_+	DUF3989 domain-containing protein	NA	NA	NA	NA	NA
WP_005636954.1|466400_467708_+	conjugative transposon protein TraM	NA	NA	NA	NA	NA
WP_005636955.1|467757_468672_+	conjugative transposon protein TraN	NA	NA	NA	NA	NA
WP_005636956.1|468668_469256_+	conjugal transfer protein TraO	NA	NA	NA	NA	NA
WP_005636957.1|469277_469739_+	DUF3872 domain-containing protein	NA	NA	NA	NA	NA
WP_005636958.1|469735_470215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005636594.1|470283_471438_-	hypothetical protein	NA	I6S2L4	Croceibacter_phage	42.2	6.1e-76
WP_005636596.1|471466_472348_-	hypothetical protein	NA	S0A100	Cellulophaga_phage	35.0	3.6e-36
WP_005656889.1|472360_473596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007851225.1|473628_474369_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_005636601.1|474355_475177_-	DUF4121 family protein	NA	NA	NA	NA	NA
WP_170272867.1|475163_475346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004312011.1|475667_477341_-|transposase	IS66-like element ISBf10 family transposase	transposase	A0A218MNE7	uncultured_virus	28.9	2.1e-37
WP_004312010.1|477416_477782_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_004319780.1|477785_478142_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_170272868.1|478218_478389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005942846.1|478670_478961_-	DUF4120 domain-containing protein	NA	NA	NA	NA	NA
WP_005636608.1|479291_479636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005840921.1|479694_480405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005636610.1|480406_481108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008778735.1|481118_482138_-	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_005802673.1|482151_482361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005637786.1|482336_482636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170272887.1|482632_483232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005864587.1|483279_483777_-	DUF4313 domain-containing protein	NA	NA	NA	NA	NA
WP_005634966.1|483827_484079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005828696.1|484148_485036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007851204.1|485039_486182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005634950.1|486166_486463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005640474.1|486875_487283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005640472.1|487795_489031_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005828681.1|489104_490310_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_005640468.1|490577_491945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005640453.1|492666_493956_+|transposase	IS1380-like element ISBvu1 family transposase	transposase	NA	NA	NA	NA
WP_005864602.1|494134_495370_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	36.3	1.4e-33
496879:496893	attR	AAGTTCACGCACATT	NA	NA	NA	NA
>prophage 2
NZ_CP046426	Bacteroides dorei strain JR03 chromosome, complete genome	5510617	3095587	3131347	5510617	protease,integrase	Helicobacter_phage(33.33%)	37	3094307:3094321	3132510:3132524
3094307:3094321	attL	CACTGAACGCCCTTA	NA	NA	NA	NA
WP_008665036.1|3095587_3096721_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_022219044.1|3096724_3097891_+|integrase	site-specific integrase	integrase	A0A1S5RH00	Helicobacter_phage	23.8	5.2e-06
WP_008665039.1|3098229_3099663_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_008665040.1|3099668_3100289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008665041.1|3100285_3100699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008665042.1|3100946_3101189_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_008665043.1|3101217_3101691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157463314.1|3101658_3101892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157463313.1|3101927_3102599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022219048.1|3102588_3103806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008665046.1|3103816_3104395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082431359.1|3105170_3105518_+	PcfJ domain-containing protein	NA	NA	NA	NA	NA
WP_005807974.1|3105406_3105703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008665050.1|3105709_3106471_-|protease	serine protease	protease	NA	NA	NA	NA
WP_005807978.1|3106472_3107120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008665053.1|3107125_3108766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005807981.1|3108769_3109588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005807983.1|3109591_3110455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005807985.1|3110447_3113930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005807987.1|3113932_3115351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005807989.1|3115362_3115779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005807991.1|3115780_3116962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005807993.1|3116987_3117722_-	UpxY family transcription antiterminator	NA	NA	NA	NA	NA
WP_007219414.1|3118523_3118775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004289359.1|3120638_3120806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004289356.1|3121219_3121735_+	DUF4313 domain-containing protein	NA	NA	NA	NA	NA
WP_170273017.1|3121861_3122116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170272952.1|3122891_3124190_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_004289352.1|3124186_3124501_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005776149.1|3124870_3125068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008666811.1|3125079_3125352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004289349.1|3125362_3125635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004289348.1|3125675_3126053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004289347.1|3126288_3126474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149941956.1|3127783_3129397_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	22.1	6.7e-12
WP_154577496.1|3129399_3130341_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_149941957.1|3130333_3131347_+|integrase	tyrosine-type recombinase/integrase	integrase	S6C485	Thermus_phage	23.2	2.0e-06
3132510:3132524	attR	TAAGGGCGTTCAGTG	NA	NA	NA	NA
>prophage 3
NZ_CP046426	Bacteroides dorei strain JR03 chromosome, complete genome	5510617	3321776	3351510	5510617	transposase,tRNA,integrase	unidentified_phage(44.44%)	38	3329158:3329171	3355527:3355540
WP_032536584.1|3321776_3322757_-|transposase	IS982-like element IS1187 family transposase	transposase	NA	NA	NA	NA
WP_087336888.1|3322847_3324077_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	36.3	1.5e-32
WP_132040141.1|3324105_3324348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_132040699.1|3324740_3325100_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_132040139.1|3325089_3327132_+	bifunctional DNA primase/helicase	NA	NA	NA	NA	NA
WP_132040137.1|3327144_3327498_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_132040135.1|3328029_3329355_+	AAA family ATPase	NA	NA	NA	NA	NA
3329158:3329171	attL	AAGAATAATAAAGA	NA	NA	NA	NA
WP_170272960.1|3329385_3330669_+	serine/threonine protein kinase	NA	I6PD73	Cronobacter_phage	30.4	1.6e-16
WP_132040697.1|3330758_3330905_-	DNA methylase	NA	NA	NA	NA	NA
WP_132040131.1|3331253_3331721_+	TraG family conjugative transposon ATPase	NA	NA	NA	NA	NA
WP_132040129.1|3331726_3331999_+	DUF3876 domain-containing protein	NA	NA	NA	NA	NA
WP_170272961.1|3332082_3332316_+	DUF4141 domain-containing protein	NA	NA	NA	NA	NA
WP_162614061.1|3332355_3332517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032535361.1|3332866_3334672_+	maturase	NA	A0A0U4J920	Pseudomonas_phage	29.7	5.0e-32
WP_170272962.1|3334664_3335201_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_132040125.1|3335202_3336210_+	conjugative transposon protein TraJ	NA	NA	NA	NA	NA
WP_132040123.1|3336239_3336863_+	conjugative transposon protein TraK	NA	NA	NA	NA	NA
WP_132040121.1|3337148_3338471_+	conjugative transposon protein TraM	NA	NA	NA	NA	NA
WP_132040695.1|3338518_3339529_+	conjugative transposon protein TraN	NA	NA	NA	NA	NA
WP_170272963.1|3339530_3340115_+	conjugal transfer protein TraO	NA	NA	NA	NA	NA
WP_132040119.1|3340118_3341000_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1B1IVS4	uncultured_Mediterranean_phage	41.3	3.4e-34
WP_132040117.1|3341014_3341458_+	DUF3872 domain-containing protein	NA	NA	NA	NA	NA
WP_132040115.1|3341454_3342024_+|tRNA	tRNA (adenine-N(6)-)-methyltransferase	tRNA	A0A0K0KVF7	Prochlorococcus_phage	50.9	4.2e-46
WP_132040113.1|3342141_3342366_-	DUF3873 family protein	NA	NA	NA	NA	NA
WP_132040111.1|3342394_3342982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_132040109.1|3343001_3343259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_132040107.1|3343277_3343496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170272964.1|3343502_3343991_-	DUF1273 family protein	NA	A0A1P8L625	Pectobacterium_phage	35.1	1.1e-13
WP_132040103.1|3344002_3344266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_132040101.1|3344841_3345114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132040097.1|3345702_3345894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132040093.1|3346132_3346471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_132040091.1|3346473_3347391_-	ribonucleotide-diphosphate reductase subunit beta	NA	NA	NA	NA	NA
WP_132040089.1|3347474_3347888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170272965.1|3347926_3348544_-|integrase	integrase catalytic domain-containing protein	integrase	NA	NA	NA	NA
WP_132040085.1|3348561_3348816_-|integrase	tyrosine-type recombinase/integrase	integrase	H7BUI8	unidentified_phage	51.5	3.1e-09
WP_007831920.1|3349043_3350273_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	31.1	2.9e-23
WP_132040083.1|3350292_3351510_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	26.9	1.1e-14
3355527:3355540	attR	AAGAATAATAAAGA	NA	NA	NA	NA
>prophage 4
NZ_CP046426	Bacteroides dorei strain JR03 chromosome, complete genome	5510617	4687655	4765661	5510617	integrase	Bacillus_phage(33.33%)	50	4687543:4687602	4766721:4767839
4687543:4687602	attL	AAGCTCATATGTTGCGTAGCCATTTATGTTGGCTTCCAACTCTAATCCTTTGTATATAAA	NA	NA	NA	NA
WP_149941957.1|4687655_4688669_-|integrase	tyrosine-type recombinase/integrase	integrase	S6C485	Thermus_phage	23.2	2.0e-06
WP_154577496.1|4688661_4689603_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_149941956.1|4689605_4691219_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	22.1	6.7e-12
WP_007840925.1|4691687_4694858_+	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_007832961.1|4694877_4696833_+	SusD/RagB family nutrient-binding outer membrane lipoprotein	NA	NA	NA	NA	NA
WP_007856284.1|4698215_4701626_+	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_007851419.1|4701653_4703540_+	SusD/RagB family nutrient-binding outer membrane lipoprotein	NA	NA	NA	NA	NA
WP_008654582.1|4704004_4707160_+	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_005841087.1|4707181_4709152_+	SusD/RagB family nutrient-binding outer membrane lipoprotein	NA	NA	NA	NA	NA
WP_005841085.1|4709463_4709928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007832955.1|4709972_4711625_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	31.9	8.8e-60
WP_007832953.1|4711709_4712264_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_087338733.1|4712510_4713002_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_087338730.1|4713262_4713679_-	DUF1893 domain-containing protein	NA	NA	NA	NA	NA
WP_087338728.1|4713691_4715218_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_007832943.1|4716814_4717711_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_007832942.1|4717982_4718756_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_007832940.1|4718940_4720065_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_005841042.1|4720078_4721047_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_007832937.1|4721052_4722261_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_007832935.1|4722368_4722926_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_007832933.1|4722949_4723426_-	arginine repressor	NA	NA	NA	NA	NA
WP_007832931.1|4723733_4725212_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_085930143.1|4725251_4726508_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_007832930.1|4726601_4727621_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_008654569.1|4727706_4728516_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_007832928.1|4728874_4729372_+	DUF4251 domain-containing protein	NA	NA	NA	NA	NA
WP_007832927.1|4729472_4730987_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_007841057.1|4731154_4732774_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_008654568.1|4732785_4735857_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_007832924.1|4735997_4740158_-	response regulator	NA	W8CYM9	Bacillus_phage	32.5	2.2e-11
WP_007832923.1|4740305_4741226_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_007855245.1|4741233_4742232_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_008654565.1|4742257_4743115_-	ion transporter	NA	NA	NA	NA	NA
WP_008654564.1|4743230_4746326_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	34.3	5.5e-148
WP_087338725.1|4746725_4749293_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_087338722.1|4749347_4749875_+	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_087338720.1|4749871_4750882_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_007832913.1|4751003_4752245_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_008672805.1|4752447_4752669_+|integrase	phage integrase SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_007832909.1|4752738_4753668_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_087338718.1|4753691_4754540_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	7.2e-50
WP_007848826.1|4754583_4755447_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	27.9	9.3e-29
WP_007832903.1|4755453_4756203_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.8	1.9e-22
WP_087338740.1|4756229_4756787_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007832896.1|4757399_4758401_-	glycosidase	NA	NA	NA	NA	NA
WP_007841087.1|4758433_4759732_-	MFS transporter	NA	NA	NA	NA	NA
WP_007832894.1|4759855_4761871_-	glycoside hydrolase family 97 protein	NA	NA	NA	NA	NA
WP_149941956.1|4763103_4764717_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	22.1	6.7e-12
WP_154577496.1|4764719_4765661_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4766721:4767839	attR	TTTATATACAAAGGATTAGAGTTGGAAGCCAACATAAATGGCTACGCAACATATGAGCTTAAATCCGGAAAATTCCGCACTTCTTATTTGGGGCAGTTGAATACTTATCTATCCGCTTTAGATACATATATCAGAAAACCGCACGAAAACCCTTCTATCGGAATAATTCTTTGCAAAGAAATGAACCAAACCTTTGTAGAGTTTGCCGTTCGTGATTATAACAAGCCGATGGGAGTTGCCACTTACCGTGCATCTAAAGATATGCCGGAACGACTTCGTAACGCTCTGCCAAACATTGAAGATTTGAAAAAGTTATTGTAATACAAACGCCGATAAAGCCCTTTTAAAGACTCTACCGGCGTAAGTTCACCTATTAAAAAAATCAGAATTCCAAGTCAGCCAACTGAGGATTATGATCGGAAAGCAAAGCTTCCGGTACTTCAGCCGGTATCTCACAGTTCTTTACCAGAACTTGCGGAGTGACAAAGATGAAATCAATCTTTTCACAATCCTCGGCCGGAATACGGGCAAAATCATGAAAAGTATAATCAACGCCGGTCACACGGGCAGCCGTCTTATAAGCATCCTTCATCACAAACTCGTTGGTAGTAATCGTTTCGTATGCATCGCTCGCATCGGTCACATTAAAGTCACCCGTAACCACTGCGGGGCGTTCGCCTACGATCTCTTTTATCTTACGGATAATGAGCAATGCGCTTTGACGGCGAGCCTCTTCACCTACATGGTCAAAATGAGTATTGACAGCCATGAATATCTTTCCGGTGGCCTTGTCTTTAAATTTCGCCCAAGTGGCGATACGGACACAAACCGCATCCCATCCCATCATTCCTACGCTATCGGGATTTTCGGCCAACCAGAAAGTATTGGAGTCCAACACCTCATATTTGTCCTTACGATAGAATAGCGGCGCATATTCACCTGCTGTCTTCCCGTCATCACGTCCCACGCCGATACCATCGTATTCGGGCAAGCCTGCACGAAGATCCTGAAATTGGTTATGCAAAACTTCCTGCATACCGACAATATCCAGTTCACGGTCCTTAATAAACTGGCACACACGGTCTTTCCGATATTGCCAATTGTTCAAACTGTCTTGCG	NA	NA	NA	NA
