The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053190	Enterobacter hormaechei strain EGYMCRVIM chromosome, complete genome	4673152	1131765	1174282	4673152	head,holin,integrase,tail,terminase	Salmonella_phage(22.64%)	65	1131706:1131761	1179881:1179936
1131706:1131761	attL	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATTTAAAAACAG	NA	NA	NA	NA
WP_165830982.1|1131765_1132821_-|integrase	tyrosine-type recombinase/integrase	integrase	G8C7S0	Escherichia_phage	98.9	5.7e-206
WP_071882737.1|1132805_1133141_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_109948439.1|1133247_1133574_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	79.0	1.6e-42
WP_045896254.1|1133583_1133823_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	73.1	1.1e-27
WP_109948440.1|1133800_1134388_-	hypothetical protein	NA	R9VWB9	Serratia_phage	48.2	4.7e-48
WP_109948441.1|1134384_1134603_-	TraR/DksA family transcriptional regulator	NA	V5USD3	Shigella_phage	62.0	2.3e-16
WP_022650956.1|1134694_1134886_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	66.1	4.1e-14
WP_058672549.1|1134882_1135494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023300422.1|1135490_1135709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109948442.1|1135705_1136836_-	site-specific DNA-methyltransferase	NA	A0A1P8DTZ3	Salmonella_phage	48.7	8.9e-88
WP_109948443.1|1136832_1136985_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	46.2	5.6e-06
WP_109948444.1|1136981_1137410_-	regulator	NA	M9NYX4	Enterobacteria_phage	95.1	7.5e-72
WP_024198026.1|1137406_1138087_-	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	95.6	6.9e-128
WP_032608701.1|1138083_1138929_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	55.4	4.5e-68
WP_109948445.1|1138947_1139232_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	93.6	1.2e-46
WP_001752704.1|1139310_1139517_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	100.0	3.6e-32
WP_023303583.1|1139513_1139672_-	hypothetical protein	NA	M9NZI5	Enterobacteria_phage	98.0	4.5e-22
WP_109948446.1|1139668_1140178_-	hypothetical protein	NA	G8C7T4	Escherichia_phage	98.8	3.3e-90
WP_058657095.1|1140342_1140780_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	98.6	2.1e-77
WP_109948447.1|1141604_1142192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109948448.1|1142203_1142959_-	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	58.3	5.2e-76
WP_033817243.1|1142994_1143222_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	56.3	3.1e-16
WP_109948449.1|1143251_1143797_+	hypothetical protein	NA	G8C7U3	Escherichia_phage	98.3	1.2e-95
WP_165830983.1|1143886_1144033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109948450.1|1144025_1144925_+	DNA replication protein	NA	A0A0N7C1Z7	Escherichia_phage	52.5	2.1e-76
WP_109948451.1|1144914_1146348_+	AAA family ATPase	NA	Q716D2	Shigella_phage	86.0	2.5e-236
WP_109948452.1|1146347_1146692_+	helix-turn-helix transcriptional regulator	NA	G8C7U7	Escherichia_phage	95.6	7.9e-56
WP_109948453.1|1146963_1147440_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	50.6	3.9e-37
WP_063931529.1|1147436_1148108_+	Lar family restriction alleviation protein	NA	M9NZE4	Enterobacteria_phage	37.5	2.6e-26
WP_063926221.1|1148464_1148704_+	DUF2767 family protein	NA	NA	NA	NA	NA
WP_109948454.1|1148856_1149138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109948455.1|1149348_1149798_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	46.5	4.2e-33
WP_109948456.1|1149790_1149961_+	NinE family protein	NA	G8C7V4	Escherichia_phage	80.0	1.1e-18
WP_045338843.1|1149953_1150598_+	recombination protein NinG	NA	S4TSR3	Salmonella_phage	71.0	7.6e-76
WP_170851296.1|1150707_1151397_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.4	5.3e-59
WP_109948458.1|1151587_1151830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170851297.1|1152366_1152768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001514184.1|1152764_1153040_+|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_045892348.1|1153043_1153484_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	71.1	2.6e-51
WP_045892349.1|1153480_1153867_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	36.5	1.9e-10
WP_045332076.1|1154163_1154697_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	99.4	6.7e-94
WP_170851298.1|1154746_1155301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032617987.1|1155392_1155833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109948459.1|1155855_1156398_+|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	74.2	4.7e-63
WP_109948460.1|1156394_1157642_+|terminase	PBSX family phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	97.0	2.0e-213
WP_109948461.1|1157657_1159007_+	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	88.2	7.1e-233
WP_109948462.1|1158966_1159893_+|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	93.2	6.2e-164
WP_109948500.1|1159959_1161219_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	88.5	4.4e-213
WP_032669780.1|1161231_1161681_+	hypothetical protein	NA	A0A1V0E5Q8	Salmonella_phage	86.6	7.1e-65
WP_109948463.1|1161699_1162776_+	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	91.9	2.0e-190
WP_109948464.1|1162785_1163079_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	90.7	5.0e-43
WP_170851299.1|1163141_1163543_+	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	82.3	9.2e-56
WP_109948466.1|1163542_1163713_+	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	50.0	1.3e-11
WP_059356552.1|1163716_1163953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109948467.1|1163956_1164313_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	65.0	3.2e-36
WP_109948468.1|1164315_1164780_+	hypothetical protein	NA	A0A2P1MXA4	Escherichia_phage	44.8	4.5e-30
WP_032648620.1|1164776_1165160_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	64.6	2.3e-40
WP_063929602.1|1165224_1165968_+	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	86.0	1.7e-71
WP_109948469.1|1166025_1166697_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	49.3	2.6e-55
WP_045336471.1|1166875_1167508_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	36.9	1.4e-18
WP_109948470.1|1167565_1170472_+|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	39.5	3.3e-126
WP_109948471.1|1170471_1170969_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	89.1	6.2e-86
WP_015571561.1|1170968_1171439_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	80.1	1.0e-66
WP_032665473.1|1171452_1171818_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	89.1	1.3e-61
WP_109948472.1|1171804_1174282_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.2	0.0e+00
1179881:1179936	attR	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATTTAAAAACAG	NA	NA	NA	NA
>prophage 2
NZ_CP053190	Enterobacter hormaechei strain EGYMCRVIM chromosome, complete genome	4673152	1790918	1900361	4673152	capsid,portal,transposase,head,holin,integrase,protease,tail,terminase,tRNA,plate	Enterobacteria_phage(23.81%)	137	1820368:1820390	1870038:1870060
WP_170851308.1|1790918_1791410_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003857909.1|1791498_1792620_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_015570801.1|1792711_1794175_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_026094318.1|1794175_1794847_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_022650801.1|1795241_1795634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022650802.1|1795721_1797092_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.8	1.9e-108
WP_006809213.1|1797111_1797741_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_032103856.1|1797768_1798881_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_022650804.1|1798921_1799395_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_022650805.1|1799394_1800057_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_003857898.1|1800174_1801425_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
WP_148735415.1|1801589_1803296_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_148735416.1|1803373_1804231_+	DNA adenine methylase	NA	NA	NA	NA	NA
WP_170851309.1|1804223_1805354_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	59.2	6.1e-121
WP_071785721.1|1805334_1805580_-	excisionase	NA	NA	NA	NA	NA
WP_170851310.1|1805632_1807684_-	3'-5' exoribonuclease	NA	S4TNL0	Salmonella_phage	52.0	7.9e-127
WP_075211551.1|1807860_1808043_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_080396121.1|1808445_1808874_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	63.4	5.8e-40
WP_072202864.1|1808963_1809194_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	60.5	4.7e-20
WP_058647416.1|1809196_1809751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080337585.1|1810631_1811303_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	77.5	6.1e-68
WP_058647414.1|1811317_1811737_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_058647413.1|1811740_1812001_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	73.5	1.8e-28
WP_022651653.1|1811997_1812330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112013561.1|1812326_1812704_+	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	54.8	5.3e-13
WP_032658078.1|1813052_1813286_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	72.7	2.2e-25
WP_080337586.1|1813324_1813558_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	66.2	3.3e-21
WP_072052043.1|1813841_1815419_+	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_032658080.1|1815428_1815683_+	cloacin	NA	NA	NA	NA	NA
WP_063136151.1|1816146_1817166_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	51.9	3.6e-96
WP_058647433.1|1817178_1817784_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.2	9.3e-76
WP_032619483.1|1818419_1818824_+	exported phage-related protein	NA	NA	NA	NA	NA
WP_044489029.1|1818820_1819117_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	33.8	5.5e-05
WP_058647410.1|1819113_1819743_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	89.5	5.4e-103
WP_058647409.1|1819750_1820029_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	47.1	9.7e-12
1820368:1820390	attL	TCACCGGGAGGCACCCGGCACCA	NA	NA	NA	NA
WP_170851311.1|1820665_1821163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127673973.1|1821197_1821959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170851365.1|1822031_1822535_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	62.9	4.0e-48
WP_170851312.1|1822538_1824659_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.7	1.2e-303
WP_044703838.1|1824655_1824871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163293703.1|1824879_1826400_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.2	3.7e-153
WP_044703843.1|1826389_1828450_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	53.2	6.0e-199
WP_044703845.1|1828517_1828853_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	42.7	4.4e-11
WP_023303463.1|1828852_1829209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044703847.1|1829210_1829873_+	hypothetical protein	NA	R9TR34	Vibrio_phage	37.1	5.0e-22
WP_044703850.1|1829881_1830436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044703852.1|1830428_1831052_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	30.8	5.5e-07
WP_044703854.1|1831090_1832560_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	46.8	1.9e-77
WP_044703856.1|1832556_1833063_+|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_023299869.1|1833115_1833403_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_032619500.1|1835646_1836117_+|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	33.8	3.8e-16
WP_044703957.1|1836091_1836307_+|tail	tail protein X	tail	R9TR63	Vibrio_phage	52.9	5.2e-13
WP_044703859.1|1836309_1837428_+	late control protein D	NA	R9TNM7	Vibrio_phage	32.3	4.6e-36
WP_032619502.1|1837464_1837818_+	GPW/gp25 family protein	NA	E5FFH4	Burkholderia_phage	50.0	8.5e-21
WP_039269039.1|1837801_1838716_+|plate	baseplate J/gp47 family protein	plate	V5YTH6	Pseudomonas_phage	46.0	6.3e-60
WP_044703861.1|1838708_1839260_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	41.0	5.6e-27
WP_170851313.1|1839262_1841440_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	38.9	1.5e-54
WP_032619505.1|1841439_1842018_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	54.9	5.2e-52
WP_044703863.1|1842094_1843165_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_044703865.1|1843204_1843609_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	50.0	1.1e-35
WP_012906750.1|1843631_1843811_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	72.9	1.3e-17
WP_023292711.1|1844096_1844249_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	94.0	3.4e-19
WP_022650806.1|1844324_1844570_+	YmjA family protein	NA	NA	NA	NA	NA
WP_047055268.1|1844574_1846074_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_071524166.1|1846198_1846291_-	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_003857896.1|1846661_1846910_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_015570794.1|1846963_1847038_-	protein YoaJ	NA	NA	NA	NA	NA
WP_015570793.1|1847038_1847137_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_022650808.1|1847182_1848211_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.1	5.0e-13
WP_057979958.1|1848514_1848778_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_022650810.1|1848858_1849164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003857886.1|1849164_1849509_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_022650811.1|1849659_1850367_+	CTP synthase	NA	NA	NA	NA	NA
WP_022650812.1|1850398_1851586_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_022650813.1|1851685_1852477_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003857881.1|1852460_1852907_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_109948537.1|1853013_1855050_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_003857879.1|1855065_1856397_-	MFS transporter	NA	NA	NA	NA	NA
WP_003857877.1|1856806_1857307_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_170851314.1|1857526_1858669_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	48.7	3.2e-93
WP_022650818.1|1858643_1858907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045617030.1|1858939_1859209_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	80.9	6.6e-34
WP_045617028.1|1859275_1859413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170851277.1|1859409_1860135_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	40.8	1.9e-30
WP_163343997.1|1860131_1860959_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	85.9	1.1e-122
WP_170851366.1|1860958_1861372_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	85.4	5.6e-56
WP_165586831.1|1861995_1862376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023315868.1|1862490_1863117_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	1.6e-46
WP_023315869.1|1863216_1863432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023315870.1|1863454_1864009_+	hypothetical protein	NA	S5FXP0	Shigella_phage	53.6	1.6e-45
WP_032619902.1|1864172_1864352_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	3.3e-13
WP_117309003.1|1864341_1865220_+	conserved phage C-terminal domain-containing protein	NA	U5P0A0	Shigella_phage	82.0	7.7e-39
WP_170851315.1|1865216_1865711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170851316.1|1865710_1866370_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	79.8	2.9e-99
WP_022650831.1|1866366_1866594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170851317.1|1866590_1866911_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	75.5	5.5e-43
WP_025760115.1|1866907_1867315_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	84.3	5.5e-56
WP_023330784.1|1867385_1868180_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	61.4	1.1e-92
WP_032636960.1|1868187_1869177_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	93.0	2.2e-183
WP_032636959.1|1869189_1869768_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.8	9.6e-46
WP_032624437.1|1870352_1870748_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	3.4e-63
1870038:1870060	attR	TCACCGGGAGGCACCCGGCACCA	NA	NA	NA	NA
WP_022648766.1|1870734_1871016_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	93.5	4.1e-42
WP_059509680.1|1871015_1871645_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	94.3	9.3e-111
WP_170851318.1|1871652_1871922_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	83.1	9.0e-31
WP_170851319.1|1872160_1872700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170851320.1|1872763_1874221_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	91.5	7.5e-273
WP_063159276.1|1874232_1874568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023296834.1|1874521_1874779_-	hypothetical protein	NA	K7P7V5	Enterobacteria_phage	96.3	9.2e-33
WP_032665381.1|1874944_1875535_+	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	81.1	1.8e-95
WP_032682360.1|1875534_1875885_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.9	9.2e-52
WP_170851321.1|1876042_1876516_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	97.5	5.0e-85
WP_016063095.1|1876515_1878252_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	100.0	0.0e+00
WP_045326236.1|1878251_1879556_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.3	4.0e-233
WP_170851322.1|1879569_1880418_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	91.1	1.3e-136
WP_032104393.1|1880427_1881639_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.4	5.2e-195
WP_045326240.1|1881681_1882008_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	87.0	1.6e-50
WP_045326242.1|1882016_1882355_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	72.3	1.3e-39
WP_006809157.1|1882351_1882801_+	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	100.0	2.0e-75
WP_042863305.1|1882797_1883145_+	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	80.9	1.4e-47
WP_032624422.1|1883204_1883648_+	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	94.5	1.6e-72
WP_045338900.1|1883656_1884040_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	7.4e-63
WP_023305929.1|1884048_1884327_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	96.7	8.1e-43
WP_042863304.1|1884448_1884685_+	cor protein	NA	Q5G8V7	Enterobacteria_phage	68.8	9.0e-27
WP_058691911.1|1884892_1888357_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	95.2	0.0e+00
WP_022648745.1|1888359_1888698_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
WP_006809150.1|1888694_1889453_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	64.0	1.0e-95
WP_023296258.1|1889455_1890166_+	Mov34/MPN/PAD-1 family protein	NA	F1C573	Cronobacter_phage	70.2	1.3e-97
WP_129258466.1|1890165_1890753_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.4	2.3e-47
WP_080337223.1|1890799_1890985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129258468.1|1891576_1895422_+	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	63.8	0.0e+00
WP_017382568.1|1895464_1895779_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	64.7	1.5e-32
WP_006809145.1|1895779_1896451_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	2.0e-87
WP_017382566.1|1896558_1896792_+	hypothetical protein	NA	E4WL42	Enterobacteria_phage	78.9	3.9e-30
WP_109949037.1|1896850_1898176_+|tail	phage tail protein	tail	K7P6I4	Enterobacteria_phage	55.5	6.7e-127
WP_154232874.1|1898270_1898510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022650865.1|1898497_1898818_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.8	1.0e-25
WP_023299884.1|1899077_1900361_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.1e-09
>prophage 3
NZ_CP053190	Enterobacter hormaechei strain EGYMCRVIM chromosome, complete genome	4673152	2936123	2943870	4673152		Bodo_saltans_virus(16.67%)	7	NA	NA
WP_109948674.1|2936123_2936735_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	1.6e-14
WP_109948673.1|2936773_2937754_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_109948672.1|2937946_2938951_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	2.5e-33
WP_003859477.1|2939000_2940167_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	4.1e-112
WP_003859476.1|2940406_2941288_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.4	1.5e-103
WP_048244523.1|2941288_2942374_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.3	1.8e-98
WP_006811221.1|2942463_2943870_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	5.2e-37
>prophage 4
NZ_CP053190	Enterobacter hormaechei strain EGYMCRVIM chromosome, complete genome	4673152	3354152	3422450	4673152	terminase,holin,tRNA,tail	Cronobacter_phage(17.02%)	71	NA	NA
WP_003860666.1|3354152_3354878_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_003860668.1|3355010_3355814_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_045330514.1|3355875_3356856_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_045345469.1|3356846_3357485_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_109948729.1|3357610_3358888_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_003860673.1|3358888_3360028_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_003860675.1|3360200_3360623_+	DoxX family protein	NA	NA	NA	NA	NA
WP_003860678.1|3360676_3361930_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	3.0e-100
WP_003860681.1|3362234_3363425_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_003860685.1|3363501_3363840_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_003860687.1|3363920_3365258_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	33.0	2.0e-09
WP_022651603.1|3365254_3366007_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_003860691.1|3366003_3367437_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.8	8.8e-16
WP_109948730.1|3367969_3371857_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	7.7e-131
WP_022651605.1|3372124_3373675_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_022651606.1|3373562_3374102_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_003860696.1|3374126_3374762_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_023314660.1|3374765_3376130_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003860700.1|3376139_3377036_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_003860702.1|3377154_3378003_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003860704.1|3378059_3378320_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	51.2	1.4e-17
WP_003860706.1|3378316_3378697_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003860707.1|3378696_3379428_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_003860708.1|3379503_3380211_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003860709.1|3380228_3381134_-	GTPase Era	NA	NA	NA	NA	NA
WP_003860711.1|3381130_3381811_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.0	9.6e-21
WP_003860712.1|3382034_3383009_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003860714.1|3383024_3384830_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.1e-23
WP_109948731.1|3385806_3386739_-	helix-turn-helix domain-containing protein	NA	A0A077SL42	Escherichia_phage	43.4	3.4e-69
WP_032635822.1|3386884_3388555_-	flagellin FliC	NA	NA	NA	NA	NA
WP_047729222.1|3389313_3389736_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.1	5.4e-22
WP_006811570.1|3389852_3390401_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	80.6	7.6e-77
WP_045343158.1|3391573_3392101_+	hypothetical protein	NA	A0A220NRP2	Escherichia_phage	74.9	1.7e-73
WP_170851341.1|3392078_3393311_-|tail	phage tail protein	tail	K7PM99	Enterobacterial_phage	65.2	4.3e-144
WP_017382566.1|3393369_3393603_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	78.9	3.9e-30
WP_045892418.1|3393710_3394382_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.5	1.2e-87
WP_022651029.1|3394382_3394697_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	64.7	1.5e-32
WP_048219649.1|3394740_3398286_-|tail	phage tail protein	tail	Q9MCU0	Escherichia_phage	88.2	0.0e+00
WP_015570918.1|3398338_3398968_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.4	1.6e-54
WP_048219647.1|3399001_3399712_-	C40 family peptidase	NA	K7PJX1	Enterobacterial_phage	95.7	2.0e-141
WP_048219645.1|3399713_3400469_-|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	76.8	1.3e-114
WP_015570921.1|3400465_3400813_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	63.5	7.5e-38
WP_020690998.1|3400869_3401223_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	98.3	6.0e-59
WP_048219643.1|3401297_3404210_-|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	38.5	1.2e-152
WP_032654529.1|3404206_3404521_-	DUF1799 domain-containing protein	NA	I6PD79	Cronobacter_phage	65.0	8.6e-17
WP_022651271.1|3404517_3404829_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	68.0	1.8e-35
WP_048219641.1|3404890_3405562_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	48.4	4.4e-50
WP_048219639.1|3405619_3406030_-	DUF4128 domain-containing protein	NA	I6PDJ8	Cronobacter_phage	49.3	1.2e-31
WP_048219637.1|3406026_3406611_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	54.7	1.9e-49
WP_032654538.1|3406612_3406963_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	60.3	2.7e-35
WP_032654540.1|3406966_3407227_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	60.5	2.5e-22
WP_048219635.1|3407228_3407711_-	hypothetical protein	NA	A0A2I7RQ74	Vibrio_phage	31.3	8.6e-08
WP_165831034.1|3407747_3408104_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_015570929.1|3408028_3408982_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	75.0	4.1e-134
WP_045331455.1|3408994_3409765_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.6	6.3e-69
WP_109949107.1|3409851_3410943_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	57.7	6.3e-115
WP_109949108.1|3410944_3412333_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	50.3	1.3e-125
WP_045349479.1|3412334_3413642_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	57.0	1.9e-142
WP_109949109.1|3413619_3414618_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	44.0	1.1e-38
WP_017692897.1|3414837_3415068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032635818.1|3416439_3417069_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.6	5.1e-101
WP_045892218.1|3417068_3417350_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	7.5e-20
WP_015570936.1|3417336_3417723_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	78.1	3.2e-45
WP_015570937.1|3417900_3418863_-	hypothetical protein	NA	A9YX09	Burkholderia_phage	44.7	3.3e-67
WP_109949110.1|3419449_3420259_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	69.8	2.0e-110
WP_048244230.1|3420258_3420396_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	2.4e-08
WP_109949111.1|3420392_3420749_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	94.9	4.5e-62
WP_109949112.1|3420745_3421039_-	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	97.8	5.3e-45
WP_023304243.1|3421029_3421230_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	66.7	4.8e-21
WP_017692884.1|3421235_3421838_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	86.5	5.0e-98
WP_045135255.1|3422225_3422450_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	67.5	3.0e-24
>prophage 5
NZ_CP053190	Enterobacter hormaechei strain EGYMCRVIM chromosome, complete genome	4673152	3427704	3443290	4673152	integrase	Enterobacteria_phage(42.86%)	21	3436513:3436525	3440878:3440890
WP_109949114.1|3427704_3428391_-	phage replication protein	NA	G8C7U6	Escherichia_phage	63.4	4.4e-82
WP_165831032.1|3428387_3429305_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	71.7	3.6e-111
WP_063162878.1|3429389_3429941_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	45.9	2.2e-31
WP_029882071.1|3429943_3430171_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	64.9	1.4e-21
WP_080465257.1|3430243_3430657_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	75.4	5.2e-46
WP_109949116.1|3430779_3431721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063162881.1|3432082_3432274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109949117.1|3432261_3432543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063162863.1|3432751_3432937_+	YebW family protein	NA	NA	NA	NA	NA
WP_032654607.1|3432946_3433105_+	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	76.9	4.8e-16
WP_063162864.1|3433191_3433479_+	hypothetical protein	NA	H6WRX2	Salmonella_phage	66.3	2.1e-33
WP_109949118.1|3433601_3436667_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7PJT5	Enterobacteria_phage	67.5	0.0e+00
3436513:3436525	attL	TGGAGCTGGGCAT	NA	NA	NA	NA
WP_109949119.1|3436676_3437762_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	53.5	9.1e-106
WP_109949120.1|3437796_3438408_+	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	50.5	3.6e-43
WP_017692869.1|3438394_3438637_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	7.8e-34
WP_022651668.1|3438683_3438968_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	83.0	4.3e-39
WP_006811608.1|3438945_3440175_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	98.8	9.9e-242
WP_006811609.1|3440606_3441083_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
3440878:3440890	attR	ATGCCCAGCTCCA	NA	NA	NA	NA
WP_003860717.1|3441079_3442033_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_003860719.1|3442032_3442683_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_006176728.1|3442714_3443290_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
>prophage 1
NZ_CP053191	Enterobacter hormaechei strain EGYMCRVIM plasmid pMS-37a, complete sequence	270915	59136	102104	270915	protease,transposase,integrase	Acinetobacter_phage(20.0%)	42	70177:70189	105389:105401
WP_000795949.1|59136_60312_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|60481_60694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232447.1|61054_62137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284318.1|62302_63802_-	kinase	NA	NA	NA	NA	NA
WP_107535687.1|63827_65465_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253656.1|65464_66505_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|66589_67228_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|67227_67869_-	TerD family protein	NA	NA	NA	NA	NA
WP_001253657.1|67891_68530_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|68992_69460_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_011152964.1|69477_70686_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
70177:70189	attL	GGCGTGGCGCTCA	NA	NA	NA	NA
WP_011152965.1|70696_71653_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001585166.1|71652_72732_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040058.1|72733_73507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280115.1|73499_74642_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_012695441.1|74651_75710_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_000254137.1|76030_76612_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_044704557.1|76611_77769_+	TerD family protein	NA	NA	NA	NA	NA
WP_000007449.1|77791_78247_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|78269_79310_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|79358_79937_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301247.1|80005_80581_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053340.1|81009_82251_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000374058.1|82341_82797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398479.1|83037_83229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151572.1|83320_83662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880375.1|84648_84903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166877.1|84905_86945_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	25.3	1.7e-25
WP_000211823.1|86941_87928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|88848_89241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462754.1|89899_90556_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_000340139.1|90758_91256_+	membrane protein	NA	NA	NA	NA	NA
WP_012695445.1|91260_92649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012477377.1|93049_93343_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088044.1|93347_94673_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|94733_94940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985909.1|95040_95451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001805097.1|95463_95988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|96169_97174_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|97252_100225_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|100227_100785_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845054.1|101090_102104_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
105389:105401	attR	GGCGTGGCGCTCA	NA	NA	NA	NA
>prophage 2
NZ_CP053191	Enterobacter hormaechei strain EGYMCRVIM plasmid pMS-37a, complete sequence	270915	105717	157784	270915	transposase,integrase	uncultured_Caudovirales_phage(28.57%)	54	122431:122490	133325:133555
WP_032492010.1|105717_106761_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000679427.1|106983_107331_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|107324_108164_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|108291_108792_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|109298_110063_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_021242992.1|110237_110456_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001087807.1|110521_110758_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|110754_111120_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|111137_112823_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|112861_113287_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|113314_113590_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|113605_113971_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|114042_114498_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001287391.1|115778_116183_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001100635.1|116360_116654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175475.1|116679_116916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000916941.1|116956_117412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001447900.1|117471_118137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371925.1|118194_118575_-	hypothetical protein	NA	NA	NA	NA	NA
122431:122490	attL	AGGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACAT	NA	NA	NA	NA
WP_001067855.1|122484_123189_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_078310596.1|123449_123647_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	57.4	1.2e-11
WP_013851373.1|124010_124652_-	tetracycline resistance transcriptional repressor TetR	NA	NA	NA	NA	NA
WP_031942321.1|124779_125979_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_013851371.1|126493_126997_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001067855.1|127033_127738_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001749988.1|128049_128619_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_002075255.1|129011_130025_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_032488579.1|130201_130756_+	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_012695455.1|130983_131724_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	41.7	4.4e-43
WP_077249983.1|131710_133219_-|transposase	IS21-like element ISCfr8 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	32.7	9.9e-26
WP_044704969.1|134318_135941_-	MCR-9 family phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
133325:133555	attR	AGGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCC	NA	NA	NA	NA
WP_072196614.1|136129_137098_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	1.1e-184
WP_004248839.1|137136_138483_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
WP_000723070.1|138700_139135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572377.1|139392_140508_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019951.1|140630_140903_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_044704764.1|141368_142187_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|142183_143389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|143668_144988_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000220758.1|145010_145178_-	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
WP_000833382.1|145238_146666_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_031942328.1|146880_147396_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975181.1|147398_148295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005009.1|148342_148657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000637193.1|148730_148988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371914.1|149974_150172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000864986.1|150312_150588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000927306.1|151079_152558_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_001066652.1|152576_153404_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000065802.1|153463_153889_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_000922628.1|153901_155191_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000941305.1|155236_155557_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000130816.1|155643_156348_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_044704760.1|156380_157784_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP053193	Enterobacter hormaechei strain EGYMCRVIM plasmid pMS-37c, complete sequence	108277	0	107534	108277	portal,tail,protease,integrase,terminase	Salmonella_phage(93.4%)	120	1067:1089	108156:108178
WP_040110284.1|0_1065_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.0	7.9e-187
1067:1089	attL	CCAACCACTGTAGAGAGTAGAAA	NA	NA	NA	NA
WP_170851385.1|1270_1411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006812558.1|1633_1846_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	98.6	3.1e-34
WP_004110033.1|1845_2181_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	99.1	1.6e-56
WP_004110036.1|2177_2357_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	98.3	7.3e-21
WP_040110285.1|2397_2673_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	2.3e-45
WP_032655922.1|2741_3152_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	98.5	4.8e-76
WP_004110046.1|3135_3507_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	99.2	1.0e-69
WP_059306406.1|3669_4500_-|protease	serine protease	protease	J9Q7Z4	Salmonella_phage	98.9	3.2e-127
WP_000589750.1|4503_4704_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	93.9	9.3e-25
WP_162183712.1|4795_5827_-	recombinase	NA	J9Q736	Salmonella_phage	98.8	1.3e-194
WP_000920226.1|5874_6141_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_170851386.1|6140_7085_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	2.0e-181
WP_004110098.1|7145_8174_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	99.7	1.3e-165
WP_040110290.1|8293_8725_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	99.3	8.9e-73
WP_052255174.1|8851_9775_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_160389865.1|9806_10232_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	99.3	1.7e-71
WP_170851387.1|10246_13765_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	98.9	0.0e+00
WP_042863512.1|13945_15181_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	99.5	1.3e-238
WP_170851388.1|15277_17650_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	93.3	0.0e+00
WP_004110118.1|17759_17972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022649892.1|18235_18622_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_170851389.1|18613_19720_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.2	2.1e-25
WP_170851390.1|19894_20305_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_072105571.1|20314_20923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170851415.1|21018_21264_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	1.0e-12
WP_170851391.1|21263_21644_-	hypothetical protein	NA	Q716B1	Shigella_phage	66.4	2.6e-39
WP_170851392.1|21659_21863_-	hypothetical protein	NA	A0A0B6VT64	Edwardsiella_phage	50.8	1.2e-06
WP_170851393.1|21873_22647_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.1	1.1e-89
WP_170851394.1|22767_24159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004110166.1|24249_25119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058652458.1|26238_26544_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	97.0	4.1e-48
WP_022649968.1|26692_26905_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	5.8e-33
WP_170851395.1|27064_28387_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.9	3.1e-257
WP_170851416.1|28421_28679_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	96.5	2.6e-35
WP_058652460.1|28979_29774_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	74.2	9.9e-110
WP_116344161.1|29960_31214_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_170851396.1|31205_32321_-	DNA primase	NA	J9Q720	Salmonella_phage	91.6	1.0e-205
WP_170851397.1|32471_33812_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	99.1	4.2e-246
WP_129256633.1|33872_34598_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	97.9	5.4e-139
WP_129256632.1|34767_35190_-	hypothetical protein	NA	J9Q6F2	Salmonella_phage	36.8	6.8e-17
WP_170851417.1|35182_35632_-	hypothetical protein	NA	J9Q719	Salmonella_phage	38.5	1.0e-10
WP_165298168.1|35984_36338_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	5.5e-44
WP_129256630.1|36343_37009_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	93.7	1.5e-111
WP_129256629.1|37204_37954_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	30.6	9.3e-17
WP_058662226.1|37938_38322_-	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	43.3	1.0e-11
WP_000147960.1|38712_38964_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	89.2	1.9e-30
WP_129256627.1|38965_39658_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	5.0e-126
WP_000064173.1|39671_39995_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	92.5	1.4e-46
WP_170851398.1|40069_40858_-	receptor-recognizing protein	NA	E5DHZ0	Enterobacter_phage	62.4	3.1e-55
WP_170851399.1|40922_45191_-|tail	tail fiber domain-containing protein	tail	J9Q6E3	Salmonella_phage	71.2	0.0e+00
WP_023316017.1|49964_50552_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.3	1.9e-102
WP_170851400.1|50539_51337_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	94.7	3.3e-153
WP_169724903.1|51329_52028_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.6	1.1e-136
WP_170851401.1|52117_52453_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	96.4	2.8e-58
WP_170851402.1|52494_57075_-	tape measure protein	NA	J9Q712	Salmonella_phage	91.7	0.0e+00
WP_000952684.1|57082_57307_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|57432_57750_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_170851403.1|57809_58556_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.0	6.8e-129
WP_000469441.1|58630_59014_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
WP_000523626.1|59015_59489_-	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
WP_001027662.1|59479_59824_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_000057119.1|59921_60755_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
WP_000801184.1|60754_61189_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
WP_040110313.1|62230_63106_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	1.9e-162
WP_040110314.1|63132_64029_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	98.0	5.1e-147
WP_040110315.1|64051_65626_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	99.2	3.2e-301
WP_002211787.1|65659_66916_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_006812517.1|66918_67560_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	3.4e-108
WP_000176291.1|67757_68024_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_058652471.1|68033_68924_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	3.1e-168
WP_001113021.1|68929_69184_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
WP_016051719.1|69176_69815_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	100.0	3.8e-112
WP_040110316.1|69811_70480_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	99.1	4.3e-114
WP_170851404.1|70479_71178_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	7.3e-125
WP_006812522.1|71242_72802_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.6	4.4e-295
WP_001291547.1|72804_73083_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
WP_000683475.1|73142_73565_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
WP_006812523.1|73569_74097_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	99.3	2.6e-82
WP_040110254.1|74420_75071_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.1	2.1e-113
WP_006812525.1|75121_75325_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	98.5	4.8e-29
WP_006812526.1|75969_76452_-	hypothetical protein	NA	J9Q805	Salmonella_phage	97.5	2.5e-87
WP_058652473.1|76657_76939_-	hypothetical protein	NA	J9Q753	Salmonella_phage	97.8	6.5e-48
WP_006812529.1|77065_77461_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	66.2	2.0e-42
WP_170851405.1|77589_77901_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	95.1	2.3e-46
WP_160859106.1|78041_78257_-	hypothetical protein	NA	J9Q804	Salmonella_phage	97.2	4.1e-34
WP_129256622.1|78270_78486_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	97.2	4.5e-33
WP_048231961.1|78643_78853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063136831.1|78933_79134_-	hypothetical protein	NA	J9Q7I0	Salmonella_phage	96.1	3.3e-22
WP_170851406.1|80265_81456_-	hypothetical protein	NA	J9Q803	Salmonella_phage	55.1	4.9e-121
WP_170851407.1|81597_82434_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_006812535.1|82515_82833_-	hypothetical protein	NA	J9Q750	Salmonella_phage	81.9	3.3e-48
WP_006812537.1|83369_83573_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	97.0	6.8e-31
WP_170851408.1|83628_84327_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	92.7	3.1e-115
WP_170851418.1|84365_84581_-	hypothetical protein	NA	J9Q748	Salmonella_phage	93.0	4.8e-35
WP_170851409.1|86101_86674_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	1.4e-97
WP_170851410.1|86791_86980_-	hypothetical protein	NA	J9Q800	Salmonella_phage	98.4	2.7e-26
WP_170851411.1|86989_87484_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	2.5e-79
WP_170851412.1|87877_88480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032640048.1|88650_89091_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049120020.1|89231_89699_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000262979.1|90355_90586_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
WP_170851413.1|90788_91382_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	99.5	2.7e-112
WP_023180903.1|91567_92410_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	92.5	2.0e-108
WP_000208226.1|92538_93096_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
WP_004109992.1|93105_93525_-	hypothetical protein	NA	J9Q743	Salmonella_phage	97.8	6.4e-68
WP_000386471.1|93588_94233_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
WP_160859086.1|94232_94703_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	100.0	2.0e-89
WP_160859100.1|94705_95101_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	96.9	3.9e-67
WP_022649915.1|95120_96224_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	99.2	1.1e-218
WP_105625575.1|96403_97282_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	98.6	6.8e-160
WP_002231164.1|97364_98507_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
WP_170851414.1|98614_100930_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.6	0.0e+00
WP_002214145.1|101007_101577_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_006812552.1|101588_102335_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.4	3.4e-136
WP_160859089.1|102324_102828_-	SMC family ATPase	NA	J9Q741	Salmonella_phage	99.4	8.2e-86
WP_040110281.1|104470_105556_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	98.3	1.7e-205
WP_040110282.1|105784_106288_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.6	2.1e-89
WP_058662776.1|106319_106814_-	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	97.6	6.6e-88
WP_022649908.1|106889_107534_-	hypothetical protein	NA	J9Q739	Salmonella_phage	99.1	2.2e-123
108156:108178	attR	CCAACCACTGTAGAGAGTAGAAA	NA	NA	NA	NA
