The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053247	Escherichia coli strain SCU-482 chromosome, complete genome	5152539	17510	118526	5152539	tRNA,portal,capsid,transposase,lysis,integrase,head,terminase,protease,holin,tail	Enterobacteria_phage(39.8%)	123	11526:11548	58249:58271
11526:11548	attL	AACGGGCGTGTTATACGCCCGTT	NA	NA	NA	NA
WP_000654172.1|17510_17789_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
WP_170969104.1|17785_19807_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.5	3.8e-182
WP_000515553.1|19865_23348_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_071592626.1|23408_24041_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	6.5e-96
WP_001309445.1|23977_24721_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	1.6e-149
WP_001152512.1|24726_25425_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	6.8e-131
WP_019842037.1|25424_25754_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	4.4e-56
WP_000459451.1|28324_28759_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.0e-63
WP_170969105.1|31273_31669_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	3.7e-57
WP_170969106.1|36909_37515_-|terminase	phage terminase large subunit family protein	terminase	A0A2I6TC92	Escherichia_phage	98.5	3.6e-120
WP_001322384.1|39069_39264_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	4.8e-26
WP_000738423.1|39623_39917_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|40007_40190_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000075162.1|40406_40904_-	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	98.8	4.9e-91
WP_000839583.1|40903_41119_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	94.4	4.5e-33
WP_170969107.1|41286_42024_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592551.1|42345_43305_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780585.1|43497_44022_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	4.2e-48
WP_001204782.1|44178_44556_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	85.0	1.3e-54
WP_000971075.1|44641_44782_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099522.1|44778_45141_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	5.6e-60
WP_000386642.1|45347_45689_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	95.6	4.7e-61
WP_001254223.1|45691_45868_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000153280.1|45864_46392_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000736903.1|46388_46829_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145931.1|46902_47193_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788877.1|47189_47891_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000185503.1|47887_48787_-	replication protein	NA	M1FN81	Enterobacteria_phage	100.0	1.7e-174
WP_000438490.1|48819_49119_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	96.0	2.0e-47
WP_001180318.1|49225_49453_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250470.1|49531_50239_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	98.7	2.2e-132
WP_000076840.1|50368_51268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000971595.1|51496_51712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000216183.1|51710_52019_+	hypothetical protein	NA	A0A075B8K6	Enterobacteria_phage	70.6	7.9e-31
WP_001066174.1|52035_52617_-	super-infection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	99.5	3.4e-99
WP_000065374.1|52877_53246_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198861.1|53318_53483_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|53451_53595_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995439.1|53669_53966_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|53971_54757_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|54753_55434_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149538.1|55430_55613_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	3.7e-28
WP_000548521.1|55585_55777_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	95.2	1.2e-24
WP_001309430.1|55787_56069_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	8.7e-45
WP_000763387.1|56167_56386_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	1.7e-35
WP_000944300.1|56433_56673_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	92.4	9.7e-37
WP_000088653.1|56812_57049_+	excisionase	NA	NA	NA	NA	NA
WP_000741344.1|57038_58181_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	99.4	3.1e-205
WP_000444487.1|58294_59545_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
58249:58271	attR	AACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
WP_001248673.1|59716_60370_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476103.1|60379_60841_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|60894_62001_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|62036_62678_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|62681_64052_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265481.1|64220_64892_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735421.1|64891_66352_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001306875.1|66427_67549_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|67597_68824_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|69073_70210_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799406.1|70193_71057_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000937481.1|71288_71555_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
WP_000240999.1|71611_72280_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885577.1|72334_72919_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000216486.1|72918_75945_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
WP_001233148.1|76096_76696_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_170969108.1|76763_80456_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.8	0.0e+00
WP_122991350.1|80799_81432_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.7	1.2e-102
WP_000194723.1|81377_82121_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_001309428.1|82131_82830_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.6	3.2e-128
WP_000847291.1|82829_83159_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001513281.1|83155_85711_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.3	0.0e+00
WP_000533401.1|85691_86105_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	4.6e-42
WP_001309426.1|86131_86563_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	7.4e-43
WP_000235048.1|86581_87331_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	2.7e-125
WP_000683079.1|87338_87734_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974996.1|87730_88264_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
WP_001204533.1|88279_88633_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000201530.1|88625_89000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522603.1|89051_90080_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.4e-116
WP_000256814.1|90137_90485_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_001253887.1|90521_91970_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	9.9e-100
WP_001322425.1|91959_93552_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
WP_170969109.1|93548_93725_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	57.1	1.2e-07
WP_000526135.1|93815_94274_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001309424.1|94449_96378_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
WP_000235436.1|96349_96859_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001322427.1|97341_97695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|97817_98144_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_032142285.1|98454_98922_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_001280932.1|98924_99056_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_001446668.1|99070_99253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092866.1|99409_99943_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001037013.1|99979_100870_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	1.2e-108
WP_000284506.1|100874_101090_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001309421.1|101239_101401_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
WP_001309419.1|101397_101601_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
WP_157835956.1|102463_102577_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001309418.1|102552_102750_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.8	1.7e-26
WP_001064909.1|102962_103652_-	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
WP_000140038.1|103644_104013_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.4e-34
WP_001265256.1|104013_105072_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
WP_001309417.1|105073_105352_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_001309416.1|105418_105670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|105886_106042_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000208092.1|106600_107587_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
WP_001229301.1|107583_107949_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
WP_000137947.1|107950_108358_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	6.1e-23
WP_000403791.1|108453_108810_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_001209475.1|108787_109249_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_001266130.1|109245_109542_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001141099.1|109538_109931_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_000450706.1|109946_110717_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
WP_001309414.1|110750_111293_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000020541.1|111204_112245_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_000705383.1|112216_112768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912294.1|112751_112979_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|113055_113463_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000379564.1|113669_113822_+	DUF1391 family protein	NA	NA	NA	NA	NA
WP_000394557.1|113833_114208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550042.1|114738_115593_+	Rha family transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	4.7e-65
WP_000450218.1|115603_115792_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_001093951.1|115788_115992_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102155.1|116069_118526_+	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	3.3e-103
>prophage 2
NZ_CP053247	Escherichia coli strain SCU-482 chromosome, complete genome	5152539	488224	535524	5152539	portal,capsid,transposase,integrase,head,terminase,protease,holin,tail,plate	Shigella_phage(54.17%)	57	522015:522074	535497:536691
WP_000931964.1|488224_488587_+	GtrA family protein	NA	U5P0S6	Shigella_phage	86.7	3.9e-53
WP_000703624.1|488583_489501_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	89.1	2.8e-156
WP_071781723.1|491189_491306_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_071593801.1|491277_491562_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	62.5	3.5e-17
WP_001587939.1|491682_492615_-	hypothetical protein	NA	U5P0I1	Shigella_phage	95.2	7.9e-50
WP_001587938.1|492618_493203_-	YmfQ family protein	NA	O22003	Shigella_phage	97.4	1.1e-110
WP_064771786.1|493193_494252_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	99.1	9.5e-201
WP_000424732.1|494238_494664_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_021528807.1|494663_495212_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	1.1e-96
WP_000999510.1|495211_496291_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
WP_021528806.1|496287_497616_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	7.2e-246
WP_071593209.1|497644_498031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001673693.1|498062_499895_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.5	1.8e-303
WP_000661054.1|500036_500306_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090998.1|500305_500662_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_001673692.1|500661_502158_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	96.4	1.6e-265
WP_000497758.1|502141_502312_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_000779292.1|502320_502881_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000224835.1|502877_503384_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_064771785.1|503358_503769_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.1	2.3e-70
WP_000927711.1|503765_504089_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|504091_504292_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257509.1|504341_505547_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.8	5.3e-224
WP_001193631.1|505561_506212_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466265.1|506189_507431_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	1.5e-242
WP_000605606.1|507430_507613_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_096954127.1|507624_509121_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	100.0	8.8e-301
WP_000929173.1|509354_509849_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.3e-88
WP_001135217.1|509974_510325_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	5.2e-63
WP_001247186.1|510382_510889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001673689.1|511225_511618_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	88.2	4.5e-55
WP_001075794.1|511614_512229_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	98.0	4.1e-111
WP_000422366.1|512228_512510_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001673688.1|512496_512883_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	89.1	2.7e-52
WP_001673687.1|512976_513762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075730.1|513955_514645_-	antitermination protein	NA	NA	NA	NA	NA
WP_001673686.1|514666_515662_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.8e-194
WP_064771738.1|515669_516479_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	1.1e-151
WP_000767124.1|516498_516888_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8SBE7	Shigella_phage	100.0	7.1e-69
WP_000210178.1|516884_517211_-	LexA repressor	NA	U5P451	Shigella_phage	97.2	2.9e-52
WP_122999592.1|517207_517555_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	7.5e-62
WP_001250269.1|519284_519464_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000450738.1|520531_521158_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_000559922.1|521385_521901_-	hypothetical protein	NA	NA	NA	NA	NA
522015:522074	attL	GGAAGGTGCGAACAAGTCCCTGATATGAGATCATGTTTGTCATCTGGAGCCATGGAACAG	NA	NA	NA	NA
WP_001322394.1|522046_523063_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
WP_001546523.1|523569_523932_+	hypothetical protein	NA	U5P4J6	Shigella_phage	99.2	3.3e-60
WP_000081287.1|523997_524822_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_001673683.1|524949_525486_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	97.8	9.0e-99
WP_001546522.1|525476_525839_+	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	7.5e-65
WP_000206811.1|525838_526144_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	4.9e-49
WP_001303849.1|526258_526477_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533656.1|526454_527525_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.5e-201
WP_001091561.1|527659_528943_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_100222095.1|529009_530358_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000593905.1|530519_532781_-	hydratase	NA	NA	NA	NA	NA
WP_170969159.1|532963_534355_-	anion permease	NA	NA	NA	NA	NA
WP_001322394.1|534507_535524_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
535497:536691	attR	CTGTTCCATGGCTCCAGATGACAAACATGATCTCATATCAGGGACTTGTTCGCACCTTCCCTAATATCAGAATTAGCTTCCATAACGATTTTTTATTCATTTAAAATCCTGTTCTTTCTGTATGACTCATACAGAAGTCCTTTATTGATTGTCCTTATCCTGACAACGAATTTTTTCAGGGAAGAAAAACTTCACCGGAAAATATTTTTCTGGTTGTCCGAATAACAGATGCGCGTAACGTCGTGGCATCCTGACCTTCATTACTTAAATGAACGTCGAGCGCACCACTGGGGTGTTCAATATTGATATTGCCGTATCCTACAGAAGGGACGATTTGTCGGGTGACGGTGCCTTCCAATGCACAACTACTGGAAATGGCAATAGCACCGGTTATCGCCAGCGCGCGATGGCAAGAATGCGGCATAAAATAACGCACATTAATTGCTCCGCCTTTCTGCGCTGGAGAAATAAGCACAGGTTTAGGGATAACCATATTACTGACATCGCCTAAGCCCATTGCTTTACCCGCTTGTAGACGGATAGATTCAATGCGGGCTAATAATGCTTTGTCGGCATCCAGCTCCGCCGGTAATTCATAGCCTGTTTTTCCCAGATATTCAGCAGGAATAATGACAACTGGCATCGCCATATCGATACAGGTCACCGGGACATCGTCAAAATAATCAATCTGATTATCCGTCGGGAAGACTTTTCCGGTTTTGGTTCCGGCGGCATTCAGGAAAGTGAGCGCAACCGGTGCGGCAGTACCCGGTACGCCGTCAATTCTGGCGCTACCCTCGTACTCGACAACACCATTTGGCGTTTGCACATCAGCTTCGATGAACGTACCCGTATTGACGTTGCGGATACGTACGCGGGTAACTGGCGAAGTCGCTGCAATCAAACCATTTTCAATGGCGAATGCCCCAACGCCAGACAGCATATTGCCGCAGTTAGGCGTGGTATCGACACGTTGCTCATGGACGATAACTTGAGCAAACAGATAATCGACATCAGCACGCGGATCGCTGGAACGGCTAATAATGGCGACTTTACTGGTCAGCGGATTACCGCCGCCAATACCGTCAATTTCCAGATCGTTACCGGAACCCATAATTGCCATCAATATTTTATCGCGCTGCGTTTGATCTTCGGGTAAATGTTCCGCTAACAGGAACGCGCCCCTCGAGGTTCC	NA	NA	NA	NA
>prophage 3
NZ_CP053247	Escherichia coli strain SCU-482 chromosome, complete genome	5152539	753816	799896	5152539	portal,capsid,lysis,integrase,head,terminase,protease,tail	Enterobacteria_phage(50.0%)	60	753347:753393	799910:799956
753347:753393	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201810.1|753816_754770_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_097337482.1|756761_756992_-|tail	phage tail protein	tail	A0A1X7QGH6	Escherichia_phage	60.0	1.6e-15
WP_000654147.1|757476_757758_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	1.2e-17
WP_000290535.1|757754_760124_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	43.7	9.3e-87
WP_016249752.1|760184_763682_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	98.5	0.0e+00
WP_071592626.1|763741_764374_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	6.5e-96
WP_000194783.1|764310_765054_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_001152511.1|765059_765758_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	1.2e-130
WP_019842037.1|765757_766087_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	4.4e-56
WP_170969115.1|766083_768639_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.0	0.0e+00
WP_000459479.1|768631_769066_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	2.2e-63
WP_000479141.1|769047_769470_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.0e-69
WP_001309909.1|769485_770226_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.8	2.5e-131
WP_000683122.1|770233_770629_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	3.2e-69
WP_000985123.1|770625_771204_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.7e-79
WP_000752986.1|771215_771569_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	2.6e-62
WP_000158868.1|771580_771976_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063217.1|772017_773043_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	5.2e-188
WP_000201478.1|773098_773431_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_000123266.1|773440_774772_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.3	8.0e-229
WP_001322715.1|774752_776354_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	2.5e-309
WP_000198149.1|776350_776557_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027256.1|776553_778479_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453611.1|778453_778999_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001309326.1|779387_779621_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079510.1|779678_780089_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	9.8e-53
WP_001139678.1|780440_780593_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000092273.1|780580_781048_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_001135256.1|781044_781542_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	95.2	5.6e-87
WP_000839596.1|781541_781757_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|782330_783413_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204780.1|783602_783986_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000971055.1|784071_784212_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099522.1|784208_784571_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	5.6e-60
WP_000774491.1|784567_784858_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.7e-46
WP_000224914.1|784850_785021_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053016.1|785020_785476_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	68.2	2.2e-61
WP_001309322.1|785472_785574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001309958.1|785670_785922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211451.1|786415_787024_-	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	42.1	6.3e-32
WP_170969116.1|787836_788097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000348712.1|788124_789348_+	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	53.7	3.1e-62
WP_000145913.1|789596_789899_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	96.8	2.7e-44
WP_000788915.1|789895_790597_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	97.9	9.3e-128
WP_000147900.1|790593_791613_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	8.8e-111
WP_001182772.1|791609_792149_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.5e-61
WP_001067458.1|792218_792449_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|792553_793243_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000414677.1|793324_793798_+	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	61.6	1.3e-53
WP_001288169.1|793794_794727_+	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	54.4	2.8e-87
WP_001309317.1|795125_795416_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	83.8	5.0e-27
WP_000995439.1|795491_795788_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|795793_796579_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186792.1|796575_797256_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.6	4.6e-132
WP_000149534.1|797252_797435_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	95.0	9.1e-27
WP_001513180.1|797407_797599_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	8.0e-26
WP_077252933.1|797609_797897_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.6e-47
WP_000763385.1|797989_798208_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|798255_798534_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_001299447.1|798732_799896_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
799910:799956	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 4
NZ_CP053247	Escherichia coli strain SCU-482 chromosome, complete genome	5152539	1162317	1193293	5152539	plate,transposase	Shigella_phage(20.0%)	24	NA	NA
WP_085949589.1|1162317_1163530_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
WP_000006263.1|1163689_1164187_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000093873.1|1164363_1165113_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001225679.1|1165413_1166154_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|1166124_1166892_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|1167097_1167676_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973081.1|1167915_1170360_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|1170402_1170876_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118007.1|1171029_1171800_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_001306803.1|1172071_1172560_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001306804.1|1174861_1176112_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	3.6e-29
WP_000536467.1|1177914_1178877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001306805.1|1178991_1180563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000446997.1|1180584_1181424_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_001306807.1|1181423_1183382_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	1.9e-24
WP_001142963.1|1183602_1184121_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000041478.1|1184825_1185329_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000111580.1|1185351_1186836_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001189669.1|1186840_1187266_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000863395.1|1187271_1189113_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000896719.1|1189076_1190126_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000433571.1|1190130_1191423_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001013424.1|1191419_1191944_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000224513.1|1191946_1193293_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 5
NZ_CP053247	Escherichia coli strain SCU-482 chromosome, complete genome	5152539	1671439	1731601	5152539	protease,transposase	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|1671439_1672792_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|1672885_1673437_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219793.1|1673587_1674961_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|1675136_1676135_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|1676167_1677163_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001296689.1|1677149_1678172_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205796.1|1678185_1679688_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	2.4e-11
WP_000265933.1|1679997_1680954_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|1681263_1681794_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_001219160.1|1682173_1682515_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060914.1|1682517_1686297_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269337.1|1686293_1688027_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001305659.1|1688232_1688871_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|1689193_1690537_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|1690597_1690804_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_001550273.1|1691128_1691686_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886909.1|1691675_1692416_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589436.1|1692605_1694549_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084623.1|1694677_1695058_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560581.1|1695145_1696006_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001305661.1|1696114_1697080_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331457.1|1697187_1697850_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000936773.1|1697894_1699379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000240846.1|1699412_1700576_-	DKNYY domain-containing protein	NA	NA	NA	NA	NA
WP_000228342.1|1700709_1702113_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|1702421_1703042_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|1703259_1703898_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_024228004.1|1704044_1705241_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.7	1.0e-206
WP_001526538.1|1705248_1705863_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	8.9e-42
WP_001305664.1|1706305_1707100_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|1707170_1707620_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|1707661_1707889_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|1707893_1708208_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216677.1|1708214_1708610_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492918.1|1708936_1709212_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170835.1|1709341_1710028_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949501.1|1710027_1710882_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056771.1|1710891_1711542_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776521.1|1711555_1712020_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218360.1|1712029_1712335_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001323091.1|1712350_1713748_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|1714102_1715167_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|1715274_1716030_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569688.1|1716026_1716776_-	esterase	NA	NA	NA	NA	NA
WP_000254644.1|1716957_1717287_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|1717435_1717711_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001309151.1|1717827_1719453_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943963.1|1719536_1720700_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	8.3e-81
WP_000101676.1|1720702_1721341_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|1721350_1721749_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012564.1|1721766_1722426_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|1722476_1723175_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220120.1|1723193_1723595_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|1723721_1724453_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076319.1|1724543_1726985_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
WP_001177639.1|1727023_1727449_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|1727653_1728952_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|1729055_1729253_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|1729334_1730339_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|1730341_1731601_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 6
NZ_CP053247	Escherichia coli strain SCU-482 chromosome, complete genome	5152539	2010553	2084884	5152539	tRNA,portal,capsid,lysis,integrase,head,terminase,protease,holin,tail,plate	Escherichia_phage(46.67%)	85	2027892:2027934	2057662:2057704
WP_000208242.1|2010553_2011084_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293344.1|2011093_2012425_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|2012491_2013418_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2013510_2013996_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001309890.1|2014055_2014730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000232683.1|2014852_2015479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296623.1|2015517_2015763_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2016187_2017033_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|2017055_2018564_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|2018698_2019709_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796330.1|2019805_2020552_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323555.1|2020556_2020985_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|2021011_2021311_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155255.1|2021522_2021963_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|2022063_2022663_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|2022770_2023538_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|2023592_2024348_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045689.1|2024454_2025444_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|2025763_2026726_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|2026906_2027809_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
2027892:2027934	attL	AAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|2028045_2028264_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_097325394.1|2028345_2029509_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.1e-205
WP_000978896.1|2029508_2029988_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	100.0	6.6e-85
WP_170969123.1|2030002_2032450_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.0	0.0e+00
WP_000785970.1|2032442_2032562_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|2032594_2032870_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|2032926_2033445_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286716.1|2033457_2034648_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_052897725.1|2034707_2035301_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	1.8e-103
WP_170969124.1|2037940_2038552_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.0	4.2e-116
WP_097431503.1|2038544_2039453_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.0	3.7e-161
WP_000127172.1|2039457_2039805_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_001474016.1|2039801_2040437_-|plate	phage baseplate assembly protein V	plate	A0A0F7LDY9	Escherichia_phage	97.6	7.2e-111
WP_001001786.1|2040503_2040956_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_000917190.1|2040948_2041416_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	9.7e-81
WP_072134039.1|2041378_2041552_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	6.8e-24
WP_170969125.1|2041523_2041949_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	6.1e-66
WP_089575694.1|2041936_2042362_-	protein lysA	NA	M1SV74	Escherichia_phage	95.7	3.0e-57
WP_001144101.1|2042376_2042874_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|2042873_2043155_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_021517614.1|2043158_2043362_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	98.5	3.4e-30
WP_032139889.1|2043361_2043871_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	7.3e-90
WP_001297850.1|2043970_2044708_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	100.0	9.4e-131
WP_001248591.1|2044711_2045785_-|capsid	phage major capsid protein, P2 family	capsid	Q778Z0	Enterobacteria_phage	100.0	8.7e-202
WP_001085952.1|2045843_2046698_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_029488803.1|2046871_2048644_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
WP_000038161.1|2048643_2049678_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_001039677.1|2050112_2050469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000194053.1|2050465_2050852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000554769.1|2051070_2051292_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	86.2	1.1e-21
WP_029784824.1|2051291_2051744_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	94.7	5.7e-78
WP_024222687.1|2051743_2054029_-	replication endonuclease	NA	Q858T4	Yersinia_virus	98.2	0.0e+00
WP_000027672.1|2054018_2054294_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	98.9	8.6e-45
WP_170969126.1|2054290_2054515_-	TraR/DksA C4-type zinc finger protein	NA	A0A0F7LDI3	Escherichia_phage	95.9	3.2e-34
WP_001277891.1|2054517_2054817_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	100.0	8.4e-46
WP_000557703.1|2054816_2055041_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|2055104_2055605_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001333116.1|2055601_2055799_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.5	3.6e-29
WP_000453534.1|2055774_2056047_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_001192859.1|2056199_2056493_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	99.0	8.8e-48
WP_000023385.1|2056562_2057543_+|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	99.7	2.3e-185
WP_001223800.1|2057727_2058228_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
2057662:2057704	attR	AAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033722.1|2058377_2059076_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580422.1|2059072_2060446_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270252.1|2060550_2061225_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001309889.1|2061373_2062339_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|2062616_2063237_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_000063505.1|2063521_2064556_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000230731.1|2064552_2065491_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000217149.1|2065474_2066311_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000144068.1|2066598_2068068_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_001309886.1|2068064_2069324_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001179732.1|2069406_2070231_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000619508.1|2070240_2070555_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000749944.1|2070595_2071990_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_000753589.1|2073123_2073957_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_012602895.1|2074150_2077201_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000331377.1|2077213_2078116_+	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_000829013.1|2078112_2078748_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000027720.1|2078744_2079674_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_001309881.1|2079855_2080098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295676.1|2080316_2080535_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_000226320.1|2081230_2083045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001377153.1|2083460_2084402_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000560983.1|2084446_2084884_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP053247	Escherichia coli strain SCU-482 chromosome, complete genome	5152539	3098437	3158933	5152539	protease,integrase,lysis,transposase	Stx2-converting_phage(53.85%)	44	3156919:3156933	3165511:3165525
WP_001568363.1|3098437_3099976_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.1	8.5e-283
WP_000624647.1|3101103_3101454_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	61.2	2.7e-35
WP_000435657.1|3101450_3101876_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	5.2e-33
WP_001149834.1|3102537_3103455_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000629094.1|3103488_3104364_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000376546.1|3104412_3105885_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.9e-06
WP_000948500.1|3105888_3106719_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000274668.1|3110408_3111395_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_000074487.1|3111553_3112747_-	MFS transporter	NA	NA	NA	NA	NA
WP_064771774.1|3112882_3114607_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287497.1|3114607_3115555_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015709.1|3115554_3117297_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750139.1|3117293_3118631_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_016265865.1|3118636_3120832_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_011076574.1|3121382_3121526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034089.1|3121778_3125666_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	8.8e-228
WP_000291745.1|3125712_3126294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309734.1|3126631_3127066_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000624688.1|3127062_3127413_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_000555401.1|3129121_3130255_-|transposase	IS110-like element ISEc45 family transposase	transposase	NA	NA	NA	NA
WP_001223352.1|3132609_3134700_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001363144.1|3135561_3135804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001443103.1|3136094_3136463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266543.1|3136466_3136682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322949.1|3137234_3137663_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_001110186.1|3138305_3138566_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001513409.1|3140391_3140505_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_001309729.1|3142371_3142593_-	P fimbrial regulatory protein KS71A	NA	NA	NA	NA	NA
WP_000930062.1|3143011_3143326_+	major pilus subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
WP_000597753.1|3143532_3144069_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001239364.1|3144138_3144726_+	P fimbrial minor subunit PapH	NA	NA	NA	NA	NA
WP_064771773.1|3144784_3147295_+	P fimbrial usher protein PapC	NA	NA	NA	NA	NA
WP_000265729.1|3147365_3148100_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000261299.1|3148136_3148718_+	protein papJ	NA	NA	NA	NA	NA
WP_000597712.1|3148727_3149264_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000723784.1|3149290_3149818_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000113350.1|3149892_3150393_+	P fimbrial tip protein PapF	NA	NA	NA	NA	NA
WP_000758680.1|3150436_3151447_+	P fimbria tip G-adhesin PapG-II	NA	NA	NA	NA	NA
WP_170969133.1|3151760_3152261_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_156628901.1|3152610_3154149_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	97.5	3.6e-289
WP_000612626.1|3154197_3154545_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|3154541_3154946_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000147018.1|3156368_3157412_-	hypothetical protein	NA	NA	NA	NA	NA
3156919:3156933	attL	GCGCCAGTGCGTAAC	NA	NA	NA	NA
WP_001218868.1|3157667_3158933_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.8	1.0e-76
WP_001218868.1|3157667_3158933_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.8	1.0e-76
3165511:3165525	attR	GCGCCAGTGCGTAAC	NA	NA	NA	NA
>prophage 8
NZ_CP053247	Escherichia coli strain SCU-482 chromosome, complete genome	5152539	3682467	3688129	5152539	transposase	Escherichia_phage(66.67%)	7	NA	NA
WP_001296289.1|3682467_3683934_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000138279.1|3684002_3685580_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000526135.1|3685777_3686236_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000755164.1|3686383_3686923_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	95.0	2.2e-44
WP_012602838.1|3686938_3687457_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_000076001.1|3687767_3687959_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|3687976_3688129_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 9
NZ_CP053247	Escherichia coli strain SCU-482 chromosome, complete genome	5152539	4077830	4087273	5152539		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569372.1|4077830_4078757_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.3	1.1e-22
WP_000783145.1|4078761_4079493_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4079473_4079581_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|4079640_4080372_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001309587.1|4080593_4082279_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_000598641.1|4082275_4082995_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4083041_4083512_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|4083553_4084015_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001309586.1|4084139_4086140_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001292789.1|4086136_4087273_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.3e-163
>prophage 10
NZ_CP053247	Escherichia coli strain SCU-482 chromosome, complete genome	5152539	4380797	4473291	5152539	portal,capsid,protease,transposase,head,terminase,tRNA,holin,tail	Escherichia_phage(36.07%)	103	NA	NA
WP_001025308.1|4380797_4382531_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	4.4e-86
WP_001304291.1|4382746_4383313_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185724.1|4383326_4384073_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214346.1|4384458_4385559_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_000176790.1|4385583_4388013_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564725.1|4388047_4389019_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019598.1|4389015_4389759_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.4	1.2e-24
WP_000252980.1|4389799_4390195_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_050483776.1|4390247_4391018_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	1.4e-71
WP_000362005.1|4390999_4392313_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	95.6	4.1e-246
WP_000528718.1|4392368_4392605_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_001030156.1|4392613_4392760_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
WP_000457723.1|4392763_4393006_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_000208033.1|4393090_4393603_-	hypothetical protein	NA	A0A1U9AJ59	Stx1_converting_phage	97.4	2.2e-78
WP_000224229.1|4393613_4393877_-	hypothetical protein	NA	S4TNB5	Salmonella_phage	71.3	1.1e-30
WP_001555124.1|4393878_4394478_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.5	1.2e-104
WP_000476207.1|4394474_4394714_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	9.1e-35
WP_000111289.1|4394706_4394910_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_001242713.1|4394906_4395269_-	phage protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
WP_000008232.1|4395259_4395796_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_000775327.1|4395886_4396804_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	37.9	3.0e-49
WP_001513551.1|4397358_4397853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450740.1|4398209_4398836_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	3.2e-47
WP_000205494.1|4398933_4399134_+	cell division protein	NA	NA	NA	NA	NA
WP_000515869.1|4399171_4399729_+	protein YmfL	NA	U5P4K1	Shigella_phage	96.8	8.8e-97
WP_071594037.1|4399904_4400096_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	7.1e-14
WP_064771754.1|4400073_4400913_+	Rha family transcriptional regulator	NA	A5LH69	Enterobacteria_phage	63.5	4.3e-87
WP_170969145.1|4400909_4401851_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	92.7	3.2e-139
WP_074160030.1|4401847_4402342_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	91.4	2.8e-78
WP_021530864.1|4402341_4402995_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.1	4.7e-126
WP_000767127.1|4402991_4403381_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_064771743.1|4403400_4404210_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.3	2.0e-150
WP_001358491.1|4404217_4405207_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001204806.1|4405224_4405605_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_077462104.1|4405702_4406035_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.9	2.0e-48
WP_000839574.1|4406766_4406982_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	100.0	2.4e-34
WP_016239030.1|4406986_4407331_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	92.9	5.3e-36
WP_064771789.1|4407381_4407915_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	92.7	3.4e-98
WP_149021348.1|4408131_4408317_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	91.8	2.1e-15
WP_001139555.1|4408421_4408772_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	99.1	1.5e-65
WP_001330091.1|4408919_4409402_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	2.5e-84
WP_001140907.1|4409401_4411159_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
WP_000811487.1|4411155_4411317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513556.1|4411306_4412533_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	9.0e-203
WP_000999828.1|4412525_4413125_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000766109.1|4413139_4414357_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000719066.1|4414433_4414751_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_064771791.1|4414759_4415098_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	87.5	2.4e-49
WP_000347792.1|4415097_4415544_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.4	3.9e-63
WP_001206304.1|4415540_4415885_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	98.2	4.6e-56
WP_064771792.1|4415943_4416648_+	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	93.2	3.4e-114
WP_000164661.1|4416662_4417034_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000978930.1|4417057_4417336_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	3.6e-43
WP_170969146.1|4417382_4420610_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	93.3	0.0e+00
WP_000807954.1|4420602_4420944_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_170969147.1|4425432_4425654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170969148.1|4426776_4427379_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	1.9e-105
WP_064771726.1|4429931_4430213_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	9.1e-18
WP_170969149.1|4430222_4430927_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.1	6.6e-57
WP_170969150.1|4430937_4431225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217553.1|4431342_4431591_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000891630.1|4431944_4432511_-	hydrolase	NA	NA	NA	NA	NA
WP_001258662.1|4432820_4434593_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_076611058.1|4434585_4435038_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|4435066_4435807_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|4435841_4436363_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024936.1|4436364_4436967_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072123646.1|4437037_4437103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|4437241_4437853_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568522.1|4437861_4438872_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571478.1|4439023_4439809_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202988.1|4439805_4440561_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001376899.1|4440639_4441572_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|4441587_4442910_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448381.1|4443029_4444001_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091148.1|4444132_4445575_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056694.1|4445702_4446572_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000301727.1|4446909_4448385_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001069467.1|4448619_4450431_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|4450467_4451109_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173461.1|4451163_4452342_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257738.1|4452475_4452766_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|4452832_4453189_+	protein YebF	NA	NA	NA	NA	NA
WP_000024735.1|4453515_4454175_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000942660.1|4454338_4455508_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	99.2	2.7e-204
WP_000064873.1|4455564_4455990_+|transposase	IS200/IS605-like element ISEc46 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	49.6	8.9e-25
WP_000936971.1|4456146_4458207_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944256.1|4458203_4458866_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011651.1|4458889_4459546_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|4459647_4459878_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204705.1|4460016_4460391_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879330.1|4460394_4461267_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976481.1|4461279_4461621_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812712.1|4462016_4462673_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_001296140.1|4462673_4462865_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|4462969_4463206_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001309555.1|4463323_4464763_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001306757.1|4464842_4467476_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207282.1|4467444_4468728_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001033105.1|4468857_4469355_+	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_000431370.1|4469451_4470150_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001055785.1|4470169_4472218_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|4472409_4473291_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 11
NZ_CP053247	Escherichia coli strain SCU-482 chromosome, complete genome	5152539	4710490	4774892	5152539	portal,transposase,lysis,integrase,terminase,protease,tail	Enterobacteria_phage(41.3%)	72	4718066:4718081	4749259:4749274
WP_001260856.1|4710490_4711312_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233092.1|4711411_4711495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743947.1|4711587_4711923_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091836.1|4712319_4713573_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019558.1|4713679_4714573_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225257.1|4714707_4715928_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|4716052_4716748_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000546460.1|4716700_4717993_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
4718066:4718081	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000148697.1|4718150_4718765_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	7.3e-28
WP_000526517.1|4718807_4719662_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|4719663_4720281_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_012602795.1|4720291_4722715_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	1.4e-207
WP_000041650.1|4722775_4725202_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.3e-213
WP_001295396.1|4725400_4725706_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001309527.1|4725813_4726524_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|4726526_4727087_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|4727121_4727463_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001306081.1|4727597_4727924_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_064771722.1|4728129_4729344_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	2.4e-46
WP_000836037.1|4729355_4730375_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001513307.1|4730432_4730543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170969154.1|4730557_4731844_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	1.5e-155
WP_000005552.1|4731878_4732130_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048333.1|4732202_4734674_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	55.6	2.1e-57
WP_001083276.1|4734767_4734959_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|4734955_4735144_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000344958.1|4735630_4736206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|4736207_4736363_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001003381.1|4736555_4736963_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|4737040_4737268_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|4737251_4737773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054487.1|4737753_4738719_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_001151189.1|4738759_4739161_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_001322394.1|4739199_4740216_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
WP_000340970.1|4740578_4742366_-	DUF4209 domain-containing protein	NA	Q2P9X5	Enterobacteria_phage	23.1	9.3e-15
WP_000887485.1|4742983_4743196_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.7e-24
WP_000980991.1|4743412_4743664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309521.1|4743730_4744009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513304.1|4744010_4745060_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	56.7	6.9e-111
WP_001047132.1|4745073_4745826_+	antitermination protein	NA	Q8SBE4	Shigella_phage	95.2	2.5e-131
WP_120795389.1|4746103_4746193_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|4746247_4746460_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|4746760_4746976_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|4747731_4747947_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_001309518.1|4747930_4748263_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.3	1.1e-25
WP_001092971.1|4748259_4748793_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|4748789_4749287_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
4749259:4749274	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000066495.1|4749650_4749863_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|4749873_4750062_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122134696.1|4750064_4750130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|4750208_4750364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001031431.1|4751581_4751788_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000373425.1|4752350_4752845_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934101.1|4752844_4754947_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.9	0.0e+00
WP_001072975.1|4754943_4755156_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_011478361.1|4755083_4756664_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_001136587.1|4756608_4758636_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097050.1|4758722_4759046_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|4759038_4759314_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677108.1|4759325_4759904_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001079398.1|4759900_4760302_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211109.1|4760313_4761057_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001297778.1|4761117_4761504_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
WP_001161009.1|4761512_4761842_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372011.1|4761813_4764879_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_000447253.1|4764878_4765208_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152385.1|4765217_4765916_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_000140729.1|4765921_4766665_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	7.0e-150
WP_001309913.1|4766562_4767210_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
WP_000515574.1|4767270_4770669_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_001230343.1|4770735_4771335_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	99.0	6.7e-111
WP_000885596.1|4774316_4774892_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	2.9e-103
>prophage 1
NZ_CP053248	Escherichia coli strain SCU-482 plasmid pSCU-482-1, complete sequence	145015	1220	58689	145015	integrase,transposase	Escherichia_phage(37.5%)	46	NA	NA
WP_001066952.1|1220_1961_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001309252.1|2081_2270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016245172.1|2967_3816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|4662_4935_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001298664.1|6177_8148_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_000977394.1|8154_8946_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001323403.1|9684_10464_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001310017.1|10463_11486_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_000612626.1|12555_12903_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|12899_13304_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001189113.1|13805_15314_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001020413.1|17579_18755_-	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_001100763.1|18823_21085_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000981091.1|21253_22030_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_001224623.1|22037_22913_-	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_001080732.1|25376_25712_-	colicin transporter	NA	NA	NA	NA	NA
WP_000142452.1|25840_26188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194542.1|26207_26717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371882.1|26713_26974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189106.1|28487_28976_+|transposase	transposase	transposase	A0A077SK28	Escherichia_phage	93.2	6.7e-24
WP_000874189.1|29880_30366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267176.1|30390_30876_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|30862_31558_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729218.1|31562_32693_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|32682_33966_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|33968_35348_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|35451_35979_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|36019_37906_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|38252_39068_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949452.1|39250_39757_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_000449408.1|39746_39905_-	DsbA family protein	NA	NA	NA	NA	NA
WP_001512989.1|44602_45055_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	3.2e-49
WP_001067855.1|45094_45799_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001137892.1|46619_47204_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219391.1|48436_49342_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|49463_50168_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|50752_51613_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|51762_52164_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|52210_52915_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000184001.1|53047_54253_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|54408_54612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|54739_55579_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|55572_55920_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|56125_56914_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|57044_57518_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845046.1|57675_58689_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.4e-71
>prophage 2
NZ_CP053248	Escherichia coli strain SCU-482 plasmid pSCU-482-1, complete sequence	145015	132803	140353	145015	integrase,transposase	Enterobacteria_phage(28.57%)	9	131585:131597	140539:140551
131585:131597	attL	GCCAGTGCCCGCC	NA	NA	NA	NA
WP_000619112.1|132803_133052_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.2e-13
WP_000109079.1|133048_133486_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.6	1.1e-25
WP_000952372.1|134608_135781_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
WP_000544830.1|135780_136578_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
WP_000340835.1|136895_137288_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001103694.1|137292_138264_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000633911.1|138492_139137_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_000239529.1|139130_139406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016979.1|139543_140353_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	7.8e-54
140539:140551	attR	GGCGGGCACTGGC	NA	NA	NA	NA
