The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047303	Vibrio cholerae O1 biovar El Tor strain E7946 chromosome 1, complete sequence	3011453	652995	659612	3011453		Staphylococcus_phage(66.67%)	7	NA	NA
WP_000210573.1|652995_654129_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.4e-64
WP_000366574.1|654140_655391_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.5	5.0e-100
WP_000543544.1|655490_655940_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001131994.1|655965_657069_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.1	1.3e-43
WP_000493874.1|657073_657727_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.2	1.2e-31
WP_001122865.1|657767_658877_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.8	6.7e-64
WP_000864130.1|659141_659612_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	6.8e-34
>prophage 2
NZ_CP047303	Vibrio cholerae O1 biovar El Tor strain E7946 chromosome 1, complete sequence	3011453	714411	780377	3011453	tail,plate,tRNA,capsid,integrase,terminase,portal,head	Vibrio_phage(89.13%)	70	747952:747975	781062:781085
WP_000216841.1|714411_715836_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000731531.1|716131_717097_+	OmpA family protein	NA	NA	NA	NA	NA
WP_001895039.1|717185_717692_-	Fe3+-citrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000279435.1|718303_720367_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000064348.1|720670_721486_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000523394.1|721731_728985_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	22.9	2.9e-30
WP_000739493.1|729114_730248_-	flagellar assembly protein T N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000759070.1|730408_731044_+	membrane protein	NA	NA	NA	NA	NA
WP_001881911.1|731051_731489_+	flagellar assembly lipoprotein FlgP	NA	NA	NA	NA	NA
WP_000729367.1|731598_732024_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_000907265.1|732127_732451_-	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_001881906.1|732581_733349_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_000145786.1|733405_734332_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	1.4e-35
WP_000125387.1|734342_735170_+	protein-glutamate O-methyltransferase	NA	NA	NA	NA	NA
WP_001007981.1|735389_735785_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_000051920.1|735789_736206_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_000929365.1|736223_736931_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_000122825.1|736959_738264_+	flagellar hook protein FlgE	NA	NA	NA	NA	NA
WP_000373284.1|738446_739196_+	flagellar basal-body rod protein FlgF	NA	NA	NA	NA	NA
WP_001182097.1|739215_740004_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_001911822.1|740027_740804_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_001225051.1|740894_741980_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_000609516.1|741990_742929_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M9Y4	Brevibacillus_phage	31.9	9.5e-11
WP_000135483.1|743108_744983_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_000934642.1|744995_746189_+	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_000154827.1|746596_747736_+	flagellin	NA	NA	NA	NA	NA
747952:747975	attL	GAAAAGGGGCTTTTCTTTTTTCTG	NA	NA	NA	NA
WP_000116333.1|748184_749222_-|integrase	site-specific integrase	integrase	U3PIJ4	Vibrio_phage	100.0	1.5e-198
WP_000985033.1|749221_749635_-	hypothetical protein	NA	U3PDE6	Vibrio_phage	100.0	8.9e-70
WP_000132153.1|749634_750540_-	NAD-dependent DNA ligase	NA	U3PB51	Vibrio_phage	100.0	1.3e-161
WP_001881894.1|750565_751213_-	phage repressor protein CI	NA	A0A166YHA0	Vibrio_phage	100.0	1.1e-119
WP_000959026.1|751358_751571_+	hypothetical protein	NA	U3PFJ1	Vibrio_phage	100.0	6.4e-32
WP_000253093.1|751681_752221_+	phage regulatory CII family protein	NA	U3PIJ8	Vibrio_phage	100.0	5.5e-96
WP_001272765.1|752233_752668_+	hypothetical protein	NA	U3PDF0	Vibrio_phage	100.0	2.8e-74
WP_001031152.1|752749_753283_+	hypothetical protein	NA	U3PB56	Vibrio_phage	100.0	3.9e-86
WP_000997540.1|753279_753690_+	hypothetical protein	NA	U3PCE8	Vibrio_phage	100.0	1.8e-75
WP_001198814.1|753939_754167_+	hypothetical protein	NA	U3PIK2	Vibrio_phage	100.0	3.2e-37
WP_000099608.1|754163_754781_+	DNA methyltransferase	NA	U3PDF3	Vibrio_phage	100.0	1.2e-118
WP_000629095.1|754777_754888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000613058.1|754884_755469_+	hypothetical protein	NA	U3PB60	Vibrio_phage	100.0	3.2e-105
WP_001909657.1|755465_758051_+	replication endonuclease	NA	A0A166YHE2	Vibrio_phage	99.9	0.0e+00
WP_000756239.1|758060_758597_+	DUF262 domain-containing protein	NA	U3PFK3	Vibrio_phage	100.0	4.1e-99
WP_001140408.1|758670_759009_-	helix-turn-helix transcriptional regulator	NA	U3PIK7	Vibrio_phage	100.0	2.8e-53
WP_001292395.1|759246_759492_+	hypothetical protein	NA	U3PDF9	Vibrio_phage	100.0	1.5e-37
WP_001263191.1|759492_759744_-	ogr/Delta-like zinc finger family protein	NA	U3PB63	Vibrio_phage	100.0	1.9e-43
WP_000729650.1|759814_760030_-	hypothetical protein	NA	U3PCF7	Vibrio_phage	100.0	3.1e-34
WP_001999948.1|760013_761060_-|portal	phage portal protein	portal	U3PFK6	Vibrio_phage	100.0	5.7e-206
WP_000331803.1|761056_762874_-|terminase	terminase ATPase subunit family protein	terminase	U3PIL1	Vibrio_phage	100.0	0.0e+00
WP_001127095.1|763047_763947_+|capsid	GPO family capsid scaffolding protein	capsid	A0A160DHM4	Vibrio_phage	100.0	4.0e-123
WP_000078361.1|763983_764994_+|capsid	phage major capsid protein, P2 family	capsid	U3PB67	Vibrio_phage	100.0	7.0e-193
WP_000059165.1|765009_765726_+|terminase	terminase endonuclease subunit	terminase	U3PCG2	Vibrio_phage	100.0	1.3e-132
WP_000493401.1|765832_766294_+|head	head completion/stabilization protein	head	U3PFL1	Vibrio_phage	100.0	1.5e-78
WP_000122189.1|766290_766779_+|tail	phage tail protein	tail	U3PIL4	Vibrio_phage	100.0	1.6e-89
WP_000461677.1|766765_767425_+	phage virion morphogenesis protein	NA	U3PDG7	Vibrio_phage	100.0	9.1e-117
WP_000312540.1|767426_768536_+	DUF2586 family protein	NA	U3PB71	Vibrio_phage	100.0	1.5e-209
WP_000063627.1|768535_768994_+	DUF2597 family protein	NA	U3PCG7	Vibrio_phage	100.0	1.3e-82
WP_000382491.1|769008_769218_+	TraR/DksA family transcriptional regulator	NA	U3PFL5	Vibrio_phage	100.0	2.0e-33
WP_001077689.1|769214_769442_+	hypothetical protein	NA	U3PIL8	Vibrio_phage	100.0	2.1e-36
WP_000705022.1|769428_770016_+	lysozyme	NA	U3PDH1	Vibrio_phage	100.0	2.5e-110
WP_000990572.1|769990_770332_+	hypothetical protein	NA	U3PB75	Vibrio_phage	100.0	1.1e-52
WP_001899696.1|770381_770543_+	hypothetical protein	NA	U3PCH1	Vibrio_phage	98.1	1.1e-23
WP_000165786.1|770539_770821_+	hypothetical protein	NA	A9ZT39	Vibrio_virus	100.0	5.1e-45
WP_000343647.1|771017_772835_+|tail	phage tail tape measure protein	tail	U3PFL8	Vibrio_phage	100.0	0.0e+00
WP_001113003.1|772824_773157_+	DUF2590 family protein	NA	U3PIM1	Vibrio_phage	100.0	1.7e-55
WP_000044509.1|773153_774353_+|plate	baseplate J/gp47 family protein	plate	U3PDH5	Vibrio_phage	100.0	1.0e-222
WP_000005870.1|774349_775009_+	hypothetical protein	NA	U3PB79	Vibrio_phage	100.0	8.2e-126
WP_000083759.1|775005_776868_+|tail	phage tail protein	tail	Q8HA58	Vibrio_phage	100.0	0.0e+00
WP_000369864.1|776867_777392_+	hypothetical protein	NA	A9ZT45	Vibrio_virus	100.0	4.8e-97
WP_000267787.1|777394_778288_+	hypothetical protein	NA	U3PIM3	Vibrio_phage	100.0	2.8e-161
WP_000457681.1|778275_778749_+	hypothetical protein	NA	U3PDI0	Vibrio_phage	100.0	6.6e-77
WP_000779002.1|778745_780377_+	hypothetical protein	NA	U3PB83	Vibrio_phage	100.0	0.0e+00
781062:781085	attR	GAAAAGGGGCTTTTCTTTTTTCTG	NA	NA	NA	NA
>prophage 3
NZ_CP047303	Vibrio cholerae O1 biovar El Tor strain E7946 chromosome 1, complete sequence	3011453	1536475	1581451	3011453	coat	Vibrio_phage(42.86%)	40	NA	NA
WP_001161489.1|1536475_1536643_+	hypothetical protein	NA	E3U9J0	Vibrio_phage	100.0	2.3e-13
WP_000005769.1|1537841_1538393_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001881266.1|1538569_1540138_+	replication protein	NA	A7BJY2	Enterobacteria_phage	32.3	2.7e-58
WP_000512956.1|1540157_1540427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001052672.1|1540556_1541249_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001161489.1|1541326_1541494_+	hypothetical protein	NA	E3U9J0	Vibrio_phage	100.0	2.3e-13
WP_000170634.1|1541486_1542071_+	DNA-binding protein	NA	E3U9I9	Vibrio_phage	100.0	6.4e-114
WP_000693566.1|1542560_1542899_-	helix-turn-helix transcriptional regulator	NA	U5TNA1	Satellite_phage	100.0	7.3e-54
WP_000743997.1|1543024_1544104_+	replication initiation factor domain-containing protein	NA	U5TQR3	Satellite_phage	100.0	2.2e-213
WP_001911551.1|1544105_1544456_+	hypothetical protein	NA	U5TMH5	Satellite_phage	100.0	1.0e-63
WP_000053920.1|1544549_1544774_+	RstC protein	NA	U5TMI6	Satellite_phage	100.0	1.1e-34
WP_000693566.1|1545285_1545624_-	helix-turn-helix transcriptional regulator	NA	U5TNA1	Satellite_phage	100.0	7.3e-54
WP_000743997.1|1545750_1546830_+	replication initiation factor domain-containing protein	NA	U5TQR3	Satellite_phage	100.0	2.2e-213
WP_001911548.1|1546831_1547191_+	hypothetical protein	NA	A0A0N9HE73	Vibrio_phage	100.0	4.4e-65
WP_000493022.1|1547326_1547575_+	colonization factor	NA	A0A0N7F140	Vibrio_phage	100.0	8.8e-33
WP_001268534.1|1547681_1548869_+|coat	minor coat protein pIII	coat	A0A142I701	Vibrio_phage	100.0	1.4e-200
WP_000979342.1|1548865_1549159_+	accessory cholera enterotoxin	NA	A0A0F6YNQ7	Vibrio_phage	100.0	3.7e-46
WP_000021616.1|1549155_1550355_+	zonula occludens toxin ZOT	NA	A0A142I6Z1	Vibrio_phage	100.0	5.3e-240
WP_001881225.1|1550453_1551230_+	cholera enterotoxin catalytic subunit CtxA	NA	A0A142I6Y0	Vibrio_phage	100.0	1.3e-151
WP_000593522.1|1551226_1551601_+	cholera enterotoxin binding subunit CtxB	NA	Q77DH7	Vibrio_virus	100.0	7.8e-65
WP_000693566.1|1552202_1552541_-	helix-turn-helix transcriptional regulator	NA	U5TNA1	Satellite_phage	100.0	7.3e-54
WP_000743997.1|1552666_1553746_+	replication initiation factor domain-containing protein	NA	U5TQR3	Satellite_phage	100.0	2.2e-213
WP_001911551.1|1553747_1554098_+	hypothetical protein	NA	U5TMH5	Satellite_phage	100.0	1.0e-63
WP_000053920.1|1554191_1554416_+	RstC protein	NA	U5TMI6	Satellite_phage	100.0	1.1e-34
WP_000743997.1|1555390_1556470_+	replication initiation factor domain-containing protein	NA	U5TQR3	Satellite_phage	100.0	2.2e-213
WP_001911548.1|1556471_1556831_+	hypothetical protein	NA	A0A0N9HE73	Vibrio_phage	100.0	4.4e-65
WP_000493022.1|1556966_1557215_+	colonization factor	NA	A0A0N7F140	Vibrio_phage	100.0	8.8e-33
WP_001268534.1|1557321_1558509_+|coat	minor coat protein pIII	coat	A0A142I701	Vibrio_phage	100.0	1.4e-200
WP_000979342.1|1558505_1558799_+	accessory cholera enterotoxin	NA	A0A0F6YNQ7	Vibrio_phage	100.0	3.7e-46
WP_000021616.1|1558795_1559995_+	zonula occludens toxin ZOT	NA	A0A142I6Z1	Vibrio_phage	100.0	5.3e-240
WP_001881225.1|1560093_1560870_+	cholera enterotoxin catalytic subunit CtxA	NA	A0A142I6Y0	Vibrio_phage	100.0	1.3e-151
WP_000593522.1|1560866_1561241_+	cholera enterotoxin binding subunit CtxB	NA	Q77DH7	Vibrio_virus	100.0	7.8e-65
WP_000693566.1|1561842_1562181_-	helix-turn-helix transcriptional regulator	NA	U5TNA1	Satellite_phage	100.0	7.3e-54
WP_000743997.1|1562306_1563386_+	replication initiation factor domain-containing protein	NA	U5TQR3	Satellite_phage	100.0	2.2e-213
WP_001911551.1|1563387_1563738_+	hypothetical protein	NA	U5TMH5	Satellite_phage	100.0	1.0e-63
WP_000053920.1|1563831_1564056_+	RstC protein	NA	U5TMI6	Satellite_phage	100.0	1.1e-34
WP_000517826.1|1564423_1578061_-	MARTX multifunctional-autoprocessing repeats-in-toxin holotoxin RtxA	NA	B3Y8K3	Vibrio_virus	100.0	8.4e-07
WP_001881196.1|1578084_1578546_-	RTX toxin-activating lysine-acyltransferase RtxC	NA	NA	NA	NA	NA
WP_001906284.1|1578571_1578919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149591715.1|1579345_1581451_+	RTX toxin T1SS ABC transporter subunit RtxB	NA	W8CYL7	Bacillus_phage	27.1	4.9e-39
>prophage 4
NZ_CP047303	Vibrio cholerae O1 biovar El Tor strain E7946 chromosome 1, complete sequence	3011453	2319815	2327008	3011453		Anguillid_herpesvirus(16.67%)	9	NA	NA
WP_001162850.1|2319815_2320244_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	38.4	1.0e-20
WP_000107237.1|2320447_2321737_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.3	1.7e-34
WP_000872176.1|2321956_2322151_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124187.1|2322199_2322538_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196560.1|2322551_2324402_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.1	5.3e-106
WP_001105747.1|2324425_2324941_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000301571.1|2324989_2325313_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	3.0e-25
WP_000331703.1|2325373_2325757_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	5.4e-53
WP_000775253.1|2325793_2327008_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.5	1.1e-32
>prophage 5
NZ_CP047303	Vibrio cholerae O1 biovar El Tor strain E7946 chromosome 1, complete sequence	3011453	2558636	2565860	3011453		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_001279365.1|2558636_2559524_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	41.1	4.1e-56
WP_001894770.1|2559791_2562380_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.0	2.2e-33
WP_000116737.1|2562472_2563480_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.2	6.0e-35
WP_000177568.1|2563553_2564489_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.7	7.8e-05
WP_000002982.1|2564488_2565115_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.1	2.0e-36
WP_000698379.1|2565107_2565860_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.3	8.0e-69
