The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053234	Escherichia coli strain SCU-106 chromosome, complete genome	5186905	296913	368919	5186905	tRNA,lysis,portal,protease,capsid,head,terminase,integrase,transposase,tail	Enterobacteria_phage(50.75%)	89	306599:306615	370430:370446
WP_170969255.1|296913_298299_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	1.5e-44
WP_113440728.1|298334_298856_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|298963_299176_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|299177_300044_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|300524_301067_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|301286_301979_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_050864259.1|304630_305638_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250423.1|305648_306164_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|306166_306799_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
306599:306615	attL	GAAGGTAAAACCGTCTG	NA	NA	NA	NA
WP_000051902.1|307133_308297_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000488407.1|308495_308774_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_139817617.1|309138_309420_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_170969256.1|309430_309622_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	92.1	4.4e-24
WP_170969257.1|309648_309777_-	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	97.6	2.7e-17
WP_170969258.1|309773_310454_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.7	6.7e-131
WP_000100845.1|310450_311236_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_080075635.1|311241_311538_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	4.0e-48
WP_000372937.1|311612_311756_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|311724_311889_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000213975.1|312511_312712_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_001066175.1|312925_313507_+	super-infection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	98.4	1.1e-97
WP_000088203.1|313523_313796_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_170969259.1|313773_313956_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	96.7	6.9e-27
WP_001645093.1|314410_314635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096002361.1|314857_315553_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.6	3.3e-133
WP_000067727.1|315628_315844_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_170969260.1|315985_316282_+	hypothetical protein	NA	G9L678	Escherichia_phage	93.9	1.4e-45
WP_000185505.1|316314_317214_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788910.1|317210_317912_+	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000145931.1|317908_318199_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000736903.1|318272_318713_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000153270.1|318709_319237_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254223.1|319233_319410_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000386643.1|319412_319754_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001099699.1|319960_320323_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	2.5e-60
WP_000971068.1|320319_320460_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204791.1|320545_320929_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737275.1|321117_322200_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
WP_000839596.1|322788_323004_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|323003_323501_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|323717_323900_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|323990_324284_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001415975.1|324643_324838_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000453587.1|325226_325772_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027283.1|325746_327672_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|327668_327875_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_170969261.1|327871_328753_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.6	9.5e-162
WP_170969262.1|328901_330143_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	42.6	5.9e-93
WP_029488835.1|330144_330402_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_170969263.1|330456_331035_+	Bro-N domain-containing protein	NA	A0A1W6JPH8	Morganella_phage	60.5	1.1e-52
WP_170969264.1|330991_331942_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920679.1|331934_332120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001599514.1|332119_332311_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.5e-11
WP_001091146.1|332311_332533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001356812.1|332550_332850_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_170969265.1|332846_334598_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	41.1	1.7e-93
WP_170969266.1|334886_335144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126640.1|335140_335563_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000228106.1|335780_336821_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	3.0e-66
WP_000190773.1|336830_337172_+|head	head decoration protein	head	NA	NA	NA	NA
WP_170969267.1|337183_337567_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_049068110.1|337768_338311_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	48.8	9.9e-37
WP_000140265.1|338322_338604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123273.1|340173_341493_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.6e-232
WP_001369910.1|341502_341835_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.1e-54
WP_170969268.1|341890_342916_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	9.0e-188
WP_000158868.1|342957_343353_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000753019.1|343364_343718_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975051.1|343729_344308_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	3.5e-80
WP_000683105.1|344304_344700_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001345558.1|344707_345448_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
WP_000479154.1|345463_345886_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	9.7e-72
WP_000459458.1|345867_346302_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000840258.1|346294_348856_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
WP_000847379.1|348852_349182_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|349181_349880_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|349885_350629_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_071532093.1|350565_351198_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	1.4e-95
WP_000515725.1|351258_354672_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_001233071.1|354742_355342_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_000279163.1|355406_358367_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_000885616.1|358366_358942_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|359038_359629_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|359945_360179_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|360247_360361_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|360726_361395_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226378.1|361940_363425_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_170969243.1|365131_365290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000420935.1|367782_368919_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
370430:370446	attR	CAGACGGTTTTACCTTC	NA	NA	NA	NA
>prophage 2
NZ_CP053234	Escherichia coli strain SCU-106 chromosome, complete genome	5186905	705184	758766	5186905	tRNA,plate,portal,protease,capsid,head,terminase,integrase,tail	Enterobacteria_phage(50.0%)	61	691929:691943	716998:717012
691929:691943	attL	GCTAAAACCGCCATC	NA	NA	NA	NA
WP_001694397.1|705184_706423_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.7	4.9e-124
WP_024213440.1|706832_707027_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.1	7.7e-16
WP_077881502.1|707173_707401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107606.1|707458_707764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170969285.1|707951_708149_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_062860752.1|708141_708606_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_062860750.1|708598_708919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261503.1|708925_709225_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_170969286.1|709221_711039_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.4	7.5e-129
WP_033882729.1|711326_711572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170969287.1|711568_711979_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_032284976.1|711989_712262_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000796959.1|712502_712709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170969288.1|712708_713764_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.6	1.6e-70
WP_001554860.1|713775_714111_+|head	head decoration protein	head	NA	NA	NA	NA
WP_106889351.1|714123_714537_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_170969289.1|714744_715287_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	45.4	1.8e-33
WP_077170600.1|715542_715824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520781.1|716935_717256_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
716998:717012	attR	GCTAAAACCGCCATC	NA	NA	NA	NA
WP_106918539.1|717286_719563_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	5.6e-166
WP_001040187.1|720247_720466_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|720750_721455_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202188.1|721496_723218_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_170969290.1|723218_724985_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_000537418.1|725107_726073_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|726617_727112_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077016.1|727246_731314_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|731468_732080_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|732090_733434_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|733524_734817_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_001135720.1|735056_735197_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	84.4	3.6e-15
WP_001135719.1|735528_735669_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	82.6	1.6e-15
WP_016237816.1|735803_736106_-	ogr/Delta-like zinc finger family protein	NA	S4TNZ3	Salmonella_phage	51.9	5.4e-08
WP_050437348.1|736150_737275_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	79.2	2.4e-162
WP_032330888.1|737429_738617_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	76.1	5.7e-170
WP_032325813.1|738616_739126_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	62.5	2.1e-57
WP_050437347.1|739173_739563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032158288.1|739583_739721_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	71.1	2.0e-10
WP_077776887.1|739674_742503_+|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	48.0	5.1e-108
WP_024185454.1|742513_743005_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	67.1	1.9e-58
WP_000556902.1|743015_743603_-	DUF4376 domain-containing protein	NA	A0A2L1IV45	Escherichia_phage	60.5	3.2e-57
WP_050439235.1|743614_744955_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	43.7	3.5e-59
WP_032325810.1|744954_745578_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	51.4	5.8e-49
WP_032325809.1|745570_746467_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	64.8	1.1e-96
WP_032325807.1|746453_746819_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	57.4	4.5e-33
WP_032331603.1|746815_747397_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	58.5	5.4e-65
WP_024185455.1|747393_748035_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	48.8	1.1e-47
WP_062891622.1|748021_748489_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	56.8	2.4e-47
WP_016237822.1|748504_748678_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	56.1	9.6e-10
WP_170969291.1|748824_750870_-	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	54.8	4.4e-202
WP_072145547.1|750880_751063_-	peptidase	NA	NA	NA	NA	NA
WP_000773182.1|750998_751424_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_000918548.1|751420_751963_-	lysozyme	NA	A0A1S5Q8G1	Aeromonas_phage	40.1	6.5e-28
WP_000487739.1|751949_752234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000866986.1|752236_752437_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	69.7	6.5e-18
WP_000052292.1|752436_752931_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	62.6	8.4e-51
WP_000957243.1|753035_753833_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	53.4	5.7e-57
WP_000113352.1|753873_754974_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	61.3	2.9e-120
WP_032330897.1|754991_755828_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	57.2	2.0e-84
WP_062863330.1|755983_757717_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	71.7	6.7e-252
WP_042109434.1|757722_758766_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	70.2	7.8e-147
>prophage 3
NZ_CP053234	Escherichia coli strain SCU-106 chromosome, complete genome	5186905	761771	812040	5186905	plate,protease,capsid,head,integrase,transposase,tail	Shigella_phage(51.16%)	71	762784:762800	792594:792610
WP_135560882.1|761771_764285_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	51.3	2.4e-210
762784:762800	attL	GCCGGTGTGCCTTTTGC	NA	NA	NA	NA
WP_001537144.1|764281_764698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013462.1|764766_764988_-	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	81.7	4.8e-22
WP_062891631.1|765233_765836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042109424.1|765809_766160_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	60.4	2.5e-25
WP_062863361.1|766150_766369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042109420.1|766646_767621_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	45.2	1.5e-67
WP_062863358.1|767854_768436_-	3'-5' exoribonuclease	NA	A0A2I7R065	Vibrio_phage	36.2	5.1e-23
WP_042109417.1|768432_768666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042109416.1|768864_769104_-	DUF4754 family protein	NA	NA	NA	NA	NA
WP_042109415.1|769128_769353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042109414.1|769366_769717_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	48.3	9.9e-22
WP_042109412.1|769742_769937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135560881.1|769988_770513_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_135560880.1|770617_770959_+	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	48.8	6.7e-15
WP_016237838.1|771028_772021_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	55.9	5.6e-102
WP_170969292.1|773455_773986_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_001310454.1|774176_774425_+	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_086258637.1|774426_776517_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	44.9	7.5e-165
WP_000129790.1|776588_777521_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000257925.1|777523_777745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783805.1|777757_778177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047891.1|778163_778394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049431.1|778468_778741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049303.1|778745_779039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032204014.1|779049_779580_+	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	54.3	3.0e-46
WP_044810022.1|779664_780243_+	DUF5420 family protein	NA	NA	NA	NA	NA
WP_058153328.1|780246_780780_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	65.5	2.3e-62
WP_044810024.1|780779_781295_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_086258395.1|781298_781850_+	AsnC family protein	NA	NA	NA	NA	NA
WP_000633437.1|781846_782179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000409991.1|782316_782604_+	hypothetical protein	NA	A0A0C4UQY6	Shigella_phage	48.9	3.9e-16
WP_032204020.1|782584_782824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047082301.1|782894_783407_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	44.6	3.6e-28
WP_170969293.1|783476_783902_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|783973_784474_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|784508_784937_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122255.1|784920_785139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044190866.1|785149_785377_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|785357_785666_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279082.1|785662_785953_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_170969294.1|785955_786537_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	2.4e-49
WP_001057665.1|786536_788201_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_170969295.1|788200_789790_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.5	7.9e-167
WP_170969296.1|789773_791099_+|capsid	minor capsid protein	capsid	A0A0C4UQY9	Shigella_phage	59.0	7.1e-153
WP_136764299.1|791217_791691_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	7.8e-38
WP_170969297.1|791867_792992_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.3	4.9e-78
792594:792610	attR	GCAAAAGGCACACCGGC	NA	NA	NA	NA
WP_170969298.1|792991_793939_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	66.2	7.9e-122
WP_170969299.1|793982_794390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104957.1|794386_794806_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	52.9	8.0e-34
WP_000627429.1|794802_795366_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	2.2e-42
WP_000207434.1|795369_795600_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_062875386.1|795599_797081_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.1	1.5e-130
WP_032307020.1|797089_797455_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_032307022.1|797469_797946_+|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	49.2	2.3e-21
WP_170969300.1|798073_800128_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	36.3	1.5e-72
WP_170969301.1|800114_801473_+	DNA circularization protein	NA	A0A0C4UR32	Shigella_phage	31.6	5.5e-52
WP_170969302.1|801456_802581_+|tail	phage tail protein	tail	C9DGQ3	Escherichia_phage	47.4	1.3e-94
WP_072148052.1|802570_803185_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	49.7	4.7e-51
WP_000763304.1|803177_803615_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	57.6	1.6e-40
WP_170969303.1|803614_804697_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	52.4	3.4e-97
WP_000301574.1|804687_805248_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	7.9e-45
WP_170969304.1|805247_806159_+|tail	phage tail protein	tail	C9DGQ8	Escherichia_phage	42.2	2.6e-29
WP_170969305.1|806193_806715_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.0	3.9e-46
WP_074433614.1|806794_806998_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_170969306.1|807219_807780_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.1	4.3e-75
WP_170969307.1|807879_809919_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	80.6	1.7e-278
WP_032307036.1|810066_810249_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114107.1|810284_810530_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_001310452.1|811148_811349_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_170969308.1|811302_812040_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.5	1.5e-104
>prophage 4
NZ_CP053234	Escherichia coli strain SCU-106 chromosome, complete genome	5186905	1076110	1145238	5186905	protease,capsid,holin,head,terminase,tRNA,transposase,tail	Escherichia_phage(33.33%)	70	NA	NA
WP_001025336.1|1076110_1077844_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001300190.1|1078059_1078626_+	VOC family protein	NA	NA	NA	NA	NA
WP_170969326.1|1078639_1079386_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214304.1|1079773_1080874_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_000176773.1|1080898_1083328_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000399648.1|1083597_1084578_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000564745.1|1084771_1085743_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|1085739_1086483_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|1086523_1086919_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_044713004.1|1086971_1087742_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000362007.1|1087723_1089037_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	95.4	6.0e-245
WP_000528717.1|1089092_1089329_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	9.9e-42
WP_001030145.1|1089337_1089484_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	100.0	7.5e-24
WP_000457737.1|1089487_1089730_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	98.8	2.6e-37
WP_000586690.1|1089853_1090423_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	39.4	3.0e-28
WP_042014334.1|1090419_1091169_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	83.5	2.1e-117
WP_000734576.1|1091212_1092040_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	97.8	9.0e-130
WP_048956921.1|1092285_1092684_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	56.3	9.9e-34
WP_160392285.1|1092680_1092803_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	82.5	1.6e-11
WP_000752460.1|1093079_1093439_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	99.2	9.4e-60
WP_000632553.1|1093623_1093815_-	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	100.0	2.7e-29
WP_000781553.1|1093811_1094003_-	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	98.4	1.7e-28
WP_001617650.1|1094004_1094421_-	helix-turn-helix transcriptional regulator	NA	Q8W649	Enterobacteria_phage	95.3	7.6e-61
WP_000838346.1|1094524_1095181_-	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	99.5	2.8e-126
WP_170969327.1|1096228_1097887_+	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	95.8	0.0e+00
WP_000844628.1|1097888_1098857_+	toprim domain-containing protein	NA	A0A1B5FPA8	Escherichia_phage	99.7	1.9e-187
WP_001258397.1|1098856_1099714_+	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	92.3	1.6e-150
WP_042014363.1|1099713_1100529_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	81.2	7.0e-119
WP_042014364.1|1100665_1101610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170969328.1|1102534_1104514_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	59.3	1.9e-218
WP_024194314.1|1104653_1104848_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	9.4e-22
WP_001537095.1|1104873_1105143_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	74.2	3.7e-08
WP_000284506.1|1105218_1105434_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_032331516.1|1105438_1105972_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	96.6	1.3e-100
WP_122990151.1|1106489_1106675_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.1e-18
WP_000736383.1|1106760_1106985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828070.1|1107330_1107657_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|1107788_1107989_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_042109591.1|1108030_1108396_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	94.2	5.1e-61
WP_000958387.1|1108685_1109249_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_170969329.1|1109245_1110907_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.9	0.0e+00
WP_170969330.1|1110970_1112908_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
WP_001063099.1|1112952_1113174_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126002.1|1115700_1116027_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	99.1	1.6e-53
WP_001537078.1|1116036_1116387_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	97.4	3.9e-58
WP_000573391.1|1116383_1116830_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1116826_1117171_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001537075.1|1117237_1117954_+	hypothetical protein	NA	A0A0P0ZD29	Stx2-converting_phage	99.2	8.6e-129
WP_001030063.1|1117959_1118334_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001513217.1|1118429_1118639_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_113440875.1|1118686_1121929_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.0	0.0e+00
WP_001672459.1|1121921_1122263_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	92.9	5.8e-59
WP_062864471.1|1122469_1123633_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.8	2.5e-130
WP_001537069.1|1123829_1124528_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	95.3	2.3e-126
WP_001537068.1|1124584_1125121_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
WP_000675426.1|1125120_1125369_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	46.2	8.9e-09
WP_000868195.1|1125479_1125620_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001537067.1|1125682_1126597_+	phage repressor protein/antirepressor Ant	NA	A0A0P0ZE73	Stx2-converting_phage	88.4	1.5e-93
WP_001537065.1|1126651_1127389_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	93.9	7.0e-142
WP_122990144.1|1127334_1127967_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.8	2.2e-104
WP_170969331.1|1128221_1131695_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	94.5	0.0e+00
WP_170969332.1|1131762_1132362_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	88.4	1.4e-95
WP_033804532.1|1132512_1133934_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9LA62	Enterobacterial_phage	99.1	4.9e-59
WP_001537058.1|1134283_1134955_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	86.1	1.5e-106
WP_170969333.1|1135313_1136780_+	YadA-like family protein	NA	Q9LA53	Enterobacteria_phage	84.2	2.2e-147
WP_001539080.1|1136868_1137339_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	100.0	5.9e-86
WP_170969334.1|1137612_1141620_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	99.1	0.0e+00
WP_016238065.1|1141986_1142235_-	DinI-like family protein	NA	H6WZN4	Escherichia_phage	86.4	2.6e-32
WP_170969335.1|1142589_1143156_-	hydrolase	NA	NA	NA	NA	NA
WP_170969336.1|1143465_1145238_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP053234	Escherichia coli strain SCU-106 chromosome, complete genome	5186905	1562720	1624912	5186905	transposase,protease,plate,tRNA	Cronobacter_phage(12.5%)	51	NA	NA
WP_000611742.1|1562720_1563134_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|1563137_1564988_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|1564951_1566034_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113703.1|1566058_1567339_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|1567335_1567860_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246416.1|1567862_1569194_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343293.1|1569198_1569960_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_106918581.1|1569968_1572728_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.0	4.7e-82
WP_000088873.1|1572724_1573468_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240543.1|1573472_1574888_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_170969583.1|1574996_1578431_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000377959.1|1578441_1579794_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001284199.1|1579817_1580300_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908057.1|1580343_1581258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|1581267_1581747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|1581883_1582669_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|1583208_1583940_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|1584004_1584472_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|1584468_1585191_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|1585224_1585980_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|1586051_1587410_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211690.1|1587457_1588228_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|1588305_1589106_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648606.1|1589346_1590261_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|1590257_1591061_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140174.1|1596819_1597392_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|1597579_1598611_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|1598603_1599257_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|1599296_1600112_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|1600229_1600634_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|1600630_1601338_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|1601449_1603168_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000399648.1|1604248_1605229_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|1605478_1606189_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|1606202_1606625_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|1606621_1607167_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|1607332_1607533_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|1607519_1607780_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176578.1|1607828_1609127_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|1609191_1609581_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|1609637_1611779_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|1611877_1612837_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|1612849_1616332_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|1616368_1616965_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139667.1|1616961_1618110_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|1618109_1618898_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|1618901_1619357_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|1619461_1620487_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_170969369.1|1620490_1620976_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_170969370.1|1621097_1623530_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001346129.1|1623559_1624912_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 6
NZ_CP053234	Escherichia coli strain SCU-106 chromosome, complete genome	5186905	2035557	2098598	5186905	tRNA,protease,integrase,transposase,tail	Vibrio_phage(23.08%)	60	2081049:2081064	2101128:2101143
WP_001232412.1|2035557_2036562_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|2036564_2037824_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|2037909_2039190_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|2039265_2039574_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|2039659_2040610_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_106918601.1|2040602_2042450_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	7.5e-60
WP_170969392.1|2042459_2043797_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|2043815_2044277_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_106918602.1|2044248_2045796_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294219.1|2045794_2046934_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|2046916_2046970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045172127.1|2047833_2048574_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001295188.1|2048613_2049159_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|2049253_2050306_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_021499494.1|2050402_2051371_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236850.1|2051392_2054716_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001307536.1|2054866_2056369_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|2056587_2057565_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192973.1|2057889_2059698_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|2059690_2060425_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_170969393.1|2060435_2060831_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|2060841_2061201_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_170969394.1|2061263_2062397_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|2062485_2063019_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|2063015_2063333_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|2063507_2063654_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|2063764_2063890_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|2063941_2064508_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|2064549_2065578_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008073.1|2065967_2066837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000399648.1|2067085_2068066_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000558209.1|2068318_2068672_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|2068809_2070456_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|2070499_2070793_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_137443029.1|2071068_2072247_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|2072262_2072739_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_044307780.1|2073075_2074512_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|2074629_2075931_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000883400.1|2076046_2076385_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068978.1|2076360_2078058_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|2078094_2078670_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001682069.1|2079057_2080155_-|integrase	site-specific integrase	integrase	A0A0K2CP59	Brevibacillus_phage	22.8	1.3e-06
WP_001682068.1|2080193_2081699_-	TraI domain-containing protein	NA	NA	NA	NA	NA
2081049:2081064	attL	ACCGGCCAGATTCTGA	NA	NA	NA	NA
WP_136764415.1|2081691_2083200_-	ATP-dependent helicase	NA	A0A2I7RIK5	Vibrio_phage	30.7	4.4e-42
WP_136764416.1|2083737_2083968_+	DUF1187 family protein	NA	NA	NA	NA	NA
WP_021544243.1|2084467_2085139_+	TcpQ domain-containing protein	NA	NA	NA	NA	NA
WP_021544244.1|2085139_2085574_+	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_001682061.1|2085823_2087425_+	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_032146685.1|2087448_2088744_+	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_021544246.1|2088902_2089439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021544247.1|2089574_2090171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682059.1|2090341_2090803_+	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_170969395.1|2090812_2092333_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_021531930.1|2092334_2093435_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_021531929.1|2093485_2094022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000871802.1|2094080_2094557_+	lytic transglycosylase domain-containing protein	NA	A0A0A8J856	Ralstonia_phage	36.1	1.9e-07
WP_001292581.1|2094569_2095220_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_136769800.1|2095216_2096521_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_089577059.1|2096525_2096903_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	43.4	6.7e-24
WP_001672437.1|2097473_2098598_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	38.4	1.9e-37
2101128:2101143	attR	TCAGAATCTGGCCGGT	NA	NA	NA	NA
>prophage 7
NZ_CP053234	Escherichia coli strain SCU-106 chromosome, complete genome	5186905	2147134	2158962	5186905		Salmonella_phage(28.57%)	14	NA	NA
WP_021544269.1|2147134_2149147_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.6	9.4e-40
WP_001682051.1|2149159_2149840_-	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_141071638.1|2149983_2150505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682049.1|2150513_2151800_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001682048.1|2152063_2152291_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	60.3	2.6e-15
WP_001682047.1|2152287_2152503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001682046.1|2152499_2152922_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	53.1	7.8e-21
WP_062864520.1|2153435_2154164_-	ead/Ea22-like family protein	NA	Q1MVF9	Enterobacteria_phage	76.3	6.3e-95
WP_000063336.1|2154150_2154408_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	81.2	1.7e-31
WP_001682043.1|2154417_2154666_-	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	45.3	9.2e-06
WP_000069531.1|2154662_2155241_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_001682042.1|2155237_2155969_-	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_021544272.1|2155958_2157584_-	ParB family protein	NA	NA	NA	NA	NA
WP_001682040.1|2157573_2158962_-	replicative DNA helicase	NA	O80281	Escherichia_phage	49.4	3.4e-113
>prophage 8
NZ_CP053234	Escherichia coli strain SCU-106 chromosome, complete genome	5186905	3869674	3876814	5186905		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|3869674_3870313_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590388.1|3870309_3871572_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
WP_000847985.1|3871568_3872477_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|3872672_3873440_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|3873490_3874147_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|3874252_3876814_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 9
NZ_CP053234	Escherichia coli strain SCU-106 chromosome, complete genome	5186905	3912167	4027239	5186905	tRNA,plate,lysis,portal,capsid,head,terminase,integrase,transposase,tail	Salmonella_phage(67.86%)	115	3955961:3956006	3988169:3988214
WP_170969488.1|3912167_3914798_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|3915032_3915218_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273309.1|3916811_3917378_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287457.1|3917374_3917803_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611802.1|3917875_3919432_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130210.1|3919581_3920097_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|3920160_3921699_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001295175.1|3921715_3922888_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378442.1|3923014_3923545_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_048265082.1|3923515_3923617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119763.1|3923635_3923971_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|3923960_3924698_-	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_170969489.1|3924821_3926006_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216521.1|3926197_3927190_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774996.1|3927247_3928312_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985494.1|3928304_3929507_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777938.1|3929861_3930821_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	5.9e-133
WP_000246508.1|3930830_3932975_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.1	2.4e-195
WP_000080944.1|3932947_3933358_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_001223227.1|3933354_3933600_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001295174.1|3933847_3934177_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|3934328_3934673_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|3934709_3935159_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|3935826_3936231_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229468.1|3936277_3936802_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137280.1|3936811_3937111_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|3937293_3937452_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522424.1|3937535_3937985_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|3937985_3938648_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001325764.1|3938668_3940069_-	GABA permease	NA	NA	NA	NA	NA
WP_001087606.1|3940379_3941660_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
WP_000772857.1|3941673_3943122_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271938.1|3943144_3944413_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_170969490.1|3944432_3945410_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000340076.1|3951141_3951330_+	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	69.2	9.1e-06
WP_001120794.1|3951484_3951604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947772.1|3951718_3952932_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
3955961:3956006	attL	TTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_040079989.1|3956122_3957064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023241491.1|3957102_3958131_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	92.4	1.3e-189
WP_023167678.1|3958132_3958765_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	89.5	4.9e-104
WP_000102105.1|3958884_3959127_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_023135327.1|3959159_3959669_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.7	3.0e-83
WP_024144585.1|3959676_3959973_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	2.4e-21
WP_001747374.1|3960090_3960432_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	6.6e-55
WP_001244227.1|3960499_3960733_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	3.2e-32
WP_000752622.1|3960732_3960960_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_170969491.1|3960956_3961814_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	3.0e-160
WP_170969492.1|3961810_3964225_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.1	0.0e+00
WP_001154434.1|3964378_3964567_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|3964577_3964811_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001146828.1|3965186_3966101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185757.1|3966097_3966838_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000518064.1|3966872_3967910_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
WP_170969493.1|3967909_3969676_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_028985769.1|3969818_3970652_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	89.9	1.8e-122
WP_028985768.1|3970668_3971724_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.3	1.9e-180
WP_170969494.1|3971727_3972378_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.3	7.3e-111
WP_028985766.1|3972473_3972938_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	9.3e-76
WP_052928641.1|3972937_3973141_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	1.8e-31
WP_000171568.1|3973144_3973360_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_028985765.1|3973340_3973853_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	9.0e-88
WP_170969495.1|3973854_3974232_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.8	7.9e-17
WP_170969496.1|3974228_3974657_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.2e-47
WP_170969497.1|3974752_3975184_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	3.8e-71
WP_170969498.1|3975176_3975623_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	8.7e-63
WP_170969499.1|3975691_3976270_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
WP_000177574.1|3976266_3976626_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	4.2e-52
WP_170969500.1|3976612_3977521_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	4.6e-143
WP_001086845.1|3977513_3978119_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	2.0e-110
WP_032217052.1|3978115_3979846_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	62.8	4.7e-80
WP_170969501.1|3979845_3980280_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	40.6	2.5e-22
WP_032253870.1|3980412_3981585_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
WP_001207660.1|3981594_3982110_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281016.1|3982164_3982467_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_000763312.1|3982481_3982601_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	1.1e-12
WP_084558121.1|3982593_3985671_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.4	0.0e+00
WP_170969502.1|3985667_3986153_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_023277633.1|3986149_3987250_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.8	1.2e-177
WP_000980501.1|3987318_3987537_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_033558725.1|3987563_3988046_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.9	4.1e-18
WP_000162574.1|3988746_3989229_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
3988169:3988214	attR	TTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000600190.1|3989360_3989837_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|3989826_3990117_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|3990178_3990520_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|3990668_3992330_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|3992415_3993294_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001300112.1|3993416_3994007_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287917.1|3994041_3994647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723175.1|3994769_3996056_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|3996076_3996868_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_170969503.1|3997034_3998396_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|3998532_3998781_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|3998799_3999348_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|3999378_4000146_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|4000187_4000535_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|4000611_4001094_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969032.1|4001109_4002336_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|4002325_4002844_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|4002993_4003359_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168044.1|4003568_4004639_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225221.1|4004649_4005771_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|4005813_4006974_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|4007072_4007120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|4007223_4007565_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|4007835_4008573_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079112.1|4008707_4009688_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040149.1|4009684_4010416_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|4010545_4013119_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000852116.1|4018983_4020282_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	2.2e-45
WP_001300818.1|4020278_4020602_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|4020647_4022003_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_170969504.1|4022116_4024777_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001343689.1|4024808_4025507_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_170969505.1|4025575_4025995_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	8.3e-15
WP_000997403.1|4026201_4027239_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP053234	Escherichia coli strain SCU-106 chromosome, complete genome	5186905	4494390	4503832	5186905		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|4494390_4495317_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|4495321_4496053_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|4496033_4496141_-	protein YohO	NA	NA	NA	NA	NA
WP_170969524.1|4496200_4496932_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|4497153_4498839_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_045172404.1|4498835_4499555_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4499601_4500072_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|4500112_4500574_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_069916368.1|4500698_4502699_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.9	0.0e+00
WP_001292774.1|4502695_4503832_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 11
NZ_CP053234	Escherichia coli strain SCU-106 chromosome, complete genome	5186905	4766345	4847162	5186905	tRNA,lysis,portal,capsid,holin,head,terminase,integrase,tail	Escherichia_phage(32.14%)	101	4830509:4830525	4857954:4857970
WP_000074972.1|4766345_4767464_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.6	1.5e-82
WP_000003742.1|4767432_4767702_-	excisionase	NA	NA	NA	NA	NA
WP_062883708.1|4767763_4770235_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	1.1e-58
WP_024218353.1|4770328_4770520_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|4770516_4770705_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001299931.1|4771104_4771269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171952.1|4771272_4771491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379588.1|4771650_4771806_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_001303511.1|4772097_4772376_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|4772377_4772569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123007420.1|4772589_4772961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|4773058_4773361_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_032210757.1|4773357_4773783_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_016234248.1|4773805_4774768_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000788950.1|4774774_4775521_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_170969545.1|4775542_4776256_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.2	7.6e-77
WP_101896892.1|4776689_4777010_+	hypothetical protein	NA	K7PMI0	Enterobacteria_phage	97.8	9.4e-19
WP_021577603.1|4777006_4777231_+	hypothetical protein	NA	Q286X0	Escherichia_phage	97.3	2.2e-35
WP_135560849.1|4777227_4777779_+	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	86.9	1.0e-60
WP_024193636.1|4777951_4778140_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	96.8	5.3e-30
WP_158004346.1|4778324_4778657_+	hypothetical protein	NA	V5URG6	Shigella_phage	96.4	1.2e-61
WP_135560847.1|4778653_4779571_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	72.5	1.4e-112
WP_001278450.1|4779686_4779791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016232625.1|4779979_4780192_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	58.6	1.3e-13
WP_024193993.1|4780359_4780638_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_170969546.1|4780639_4781689_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.5	6.9e-111
WP_032331587.1|4781702_4782065_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	6.2e-35
WP_170969547.1|4782057_4782747_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.9	1.4e-56
WP_047082680.1|4782958_4783156_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.4e-28
WP_170969548.1|4784211_4786191_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	59.3	8.5e-219
WP_000144786.1|4786336_4786531_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	5.5e-22
WP_001537095.1|4786556_4786826_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	74.2	3.7e-08
WP_000284506.1|4786901_4787117_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001041949.1|4787120_4787912_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_170969549.1|4788423_4788957_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.9	3.1e-99
WP_021566721.1|4789113_4789296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280932.1|4789310_4789442_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_032217790.1|4789664_4789850_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	6.2e-23
WP_040078692.1|4790507_4791014_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	47.9	3.7e-33
WP_062891540.1|4790985_4792914_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_000259002.1|4792897_4793104_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_012601424.1|4793100_4794693_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	8.4e-185
WP_032181872.1|4794682_4796188_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.3	2.1e-100
WP_021565183.1|4796224_4796572_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_000522624.1|4796629_4797658_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	2.9e-114
WP_000201501.1|4797709_4798093_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_032325851.1|4798085_4798439_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974980.1|4798454_4798988_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|4798984_4799380_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_016232503.1|4799387_4800140_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.0	3.1e-129
WP_062891538.1|4800153_4800585_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	66.0	5.8e-40
WP_170969550.1|4800611_4801025_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	85.9	3.2e-43
WP_170969551.1|4801005_4803579_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.0	0.0e+00
WP_000847280.1|4803575_4803905_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_170969552.1|4803904_4804603_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_170969553.1|4804613_4805357_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.4	7.0e-150
WP_047634908.1|4805254_4805893_+|tail	tail assembly protein	tail	S5MDP1	Escherichia_phage	97.8	2.1e-94
WP_170969554.1|4806134_4809665_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	80.2	0.0e+00
WP_032330533.1|4809849_4811271_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9LA62	Enterobacterial_phage	98.3	3.2e-58
WP_001537058.1|4811620_4812292_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	86.1	1.5e-106
WP_074015512.1|4812456_4812786_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000799399.1|4812950_4813814_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|4813797_4814934_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359463.1|4815183_4816413_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|4816558_4817680_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|4817755_4819216_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|4819215_4819887_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|4820054_4821425_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|4821428_4822070_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|4822105_4823212_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476089.1|4823265_4823727_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|4823736_4824390_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|4824561_4825812_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001307134.1|4825914_4826238_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_032141808.1|4826770_4826881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|4826933_4827338_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|4827558_4828290_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_001297681.1|4828494_4829706_-	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000554153.1|4830019_4830256_+	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_000858002.1|4830298_4830571_+	two-component-system connector protein YmgA	NA	NA	NA	NA	NA
4830509:4830525	attL	AGAACAGCGACAGCTGA	NA	NA	NA	NA
WP_000888772.1|4830599_4830866_+	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_001065752.1|4830978_4831227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001246498.1|4831558_4833082_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_001299921.1|4833213_4833432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001307135.1|4833831_4834041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001307136.1|4834157_4836479_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.8	1.5e-89
WP_000979977.1|4836535_4836871_-	YmgD family protein	NA	NA	NA	NA	NA
WP_001304448.1|4836874_4837159_-	glycine zipper family protein	NA	NA	NA	NA	NA
WP_000122462.1|4837220_4837394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001325743.1|4837494_4837680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131446.1|4837640_4837760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001185665.1|4838510_4838777_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000101055.1|4838780_4839593_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000072536.1|4839616_4840312_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_170969555.1|4840831_4841200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000695223.1|4841319_4841721_-	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001297679.1|4841962_4842256_+	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000284277.1|4842327_4842987_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000807626.1|4843063_4843525_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000897378.1|4845014_4845434_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001459668.1|4845632_4847162_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4857954:4857970	attR	AGAACAGCGACAGCTGA	NA	NA	NA	NA
>prophage 12
NZ_CP053234	Escherichia coli strain SCU-106 chromosome, complete genome	5186905	4937046	5015330	5186905	protease,capsid,holin,head,terminase,integrase,transposase,tail	Stx2-converting_phage(25.86%)	76	4936868:4936895	4999492:4999519
4936868:4936895	attL	CAGTCTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_116835744.1|4937046_4938177_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	9.8e-103
WP_000113183.1|4938154_4938403_-	excisionase	NA	NA	NA	NA	NA
WP_170969558.1|4938467_4940939_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	4.0e-56
WP_000449168.1|4941219_4941408_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000379611.1|4941880_4942033_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.3e-07
WP_000362152.1|4942298_4942718_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_000391950.1|4942818_4943100_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_001685567.1|4943083_4943509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050439863.1|4943531_4944500_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	52.1	6.5e-71
WP_170969559.1|4944506_4945253_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.0	5.8e-112
WP_074435423.1|4946023_4946305_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	74.2	9.4e-31
WP_032330547.1|4946301_4946598_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	84.5	2.1e-44
WP_042110866.1|4946587_4946947_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	90.2	1.8e-42
WP_032330548.1|4946858_4947176_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	9.9e-45
WP_032330549.1|4947162_4947600_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	95.2	5.0e-39
WP_072149359.1|4948816_4948921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032330550.1|4949087_4949732_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.7	7.4e-55
WP_033804594.1|4949716_4950943_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.1	1.1e-59
WP_032330552.1|4951115_4951388_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	6.1e-11
WP_032330553.1|4951389_4952439_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.5e-108
WP_032330554.1|4952451_4952811_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.8	2.0e-38
WP_032330555.1|4952807_4953491_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	4.4e-58
WP_000917768.1|4953933_4954131_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_170969560.1|4954281_4955340_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	91.5	6.8e-191
WP_032330558.1|4955820_4956249_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000526135.1|4956677_4957136_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_032330559.1|4958428_4960417_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	57.7	3.4e-215
WP_032330560.1|4960563_4960746_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	90.0	1.2e-23
WP_032330561.1|4960783_4961053_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	76.4	2.3e-10
WP_000284506.1|4961128_4961344_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_170969561.1|4961348_4961882_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	96.6	2.8e-100
WP_000422722.1|4962240_4962666_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	96.9	9.8e-48
WP_000624684.1|4962662_4963013_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	67.2	2.8e-40
WP_170969401.1|4963043_4964657_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.0	1.8e-166
WP_032140280.1|4964976_4965063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|4965284_4965470_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000828070.1|4965870_4966197_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|4966328_4966529_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_170969562.1|4966570_4966936_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	8.1e-59
WP_000958387.1|4967226_4967790_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_170969563.1|4967786_4969448_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.5	0.0e+00
WP_170969330.1|4969511_4971449_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
WP_001063099.1|4971493_4971715_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125999.1|4974403_4974730_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	99.1	2.7e-53
WP_001029274.1|4974739_4975090_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_000573391.1|4975086_4975533_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|4975529_4975874_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_032331259.1|4975940_4976657_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	98.7	1.5e-125
WP_000710934.1|4976671_4977046_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	7.8e-65
WP_001513217.1|4977141_4977351_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_170969564.1|4977398_4980665_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	79.2	0.0e+00
WP_000343408.1|4980657_4980999_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	81.2	7.6e-51
WP_170969565.1|4981197_4982292_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	67.6	3.9e-141
WP_032331262.1|4982501_4983200_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.8	8.9e-131
WP_032331268.1|4988714_4989338_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	3.4e-65
WP_032331269.1|4989487_4991215_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	S5MDN9	Escherichia_phage	97.7	3.9e-228
WP_033804534.1|4991256_4991928_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	99.1	3.5e-124
WP_170969566.1|4992291_4993818_+	YadA-like family protein	NA	Q9LA53	Enterobacteria_phage	70.4	2.6e-90
WP_000864634.1|4993904_4994378_+	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	99.4	1.7e-88
WP_170969567.1|4994749_4998757_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	98.4	0.0e+00
WP_170969568.1|4999669_5000176_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
4999492:4999519	attR	CAGTCTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|5000221_5000722_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|5000807_5000987_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|5001367_5002174_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|5002173_5003367_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983912.1|5003378_5004740_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|5004740_5006336_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194590.1|5006335_5007898_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|5007989_5008034_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285673.1|5008171_5009053_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|5009049_5009670_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001498960.1|5009697_5011593_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|5011803_5012676_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278894.1|5012715_5013306_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559282.1|5013302_5014061_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_000422043.1|5014280_5015330_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 1
NZ_CP053235	Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence	159399	14844	60657	159399	integrase,transposase	Enterobacteria_phage(16.67%)	41	50580:50595	55977:55992
WP_170969595.1|14844_17802_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	38.3	1.5e-182
WP_136763385.1|17947_18940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136763386.1|18998_19616_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_032331137.1|19805_21362_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_032331138.1|21624_22215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032280055.1|22214_22448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000670960.1|22776_23229_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000422722.1|24275_24701_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	96.9	9.8e-48
WP_000624684.1|24697_25048_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	67.2	2.8e-40
WP_170969401.1|25078_26692_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.0	1.8e-166
WP_170969596.1|26721_27333_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	2.1e-06
WP_000379710.1|27329_27599_-	SemiSWEET transporter	NA	NA	NA	NA	NA
WP_032280058.1|27600_28617_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000154003.1|28619_29447_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_032331142.1|29430_30669_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	27.8	2.8e-26
WP_000255944.1|32239_33262_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|33261_34041_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000253407.1|34820_35690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000952231.1|35691_36780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000991830.1|37077_38010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246635.1|38013_39009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465034.1|39688_40102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032331145.1|40103_40883_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	4.0e-55
WP_001144036.1|41063_41708_+	ParA family protein	NA	NA	NA	NA	NA
WP_000030199.1|41794_42103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032331146.1|42516_43497_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.1	3.8e-79
WP_001278818.1|43489_43906_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001459672.1|45497_46586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032160020.1|47021_48122_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_011264071.1|48123_49083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011264070.1|49338_49779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053266037.1|49780_51772_-	hypothetical protein	NA	NA	NA	NA	NA
50580:50595	attL	GATTTGAGGTTTTTTG	NA	NA	NA	NA
WP_170969556.1|51768_53619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001459668.1|53618_55148_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_032285024.1|55346_55784_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000619113.1|55780_56029_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.4e-14
55977:55992	attR	GATTTGAGGTTTTTTG	NA	NA	NA	NA
WP_032331148.1|56329_56572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000219395.1|56669_57686_+|transposase	IS110-like element ISShdy1 family transposase	transposase	NA	NA	NA	NA
WP_077880838.1|58401_59304_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_170969597.1|59300_59543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000219395.1|59640_60657_+|transposase	IS110-like element ISShdy1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP053235	Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence	159399	95212	105660	159399	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_001536663.1|95212_96751_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	1.2e-297
WP_000264909.1|96973_97165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001536659.1|97174_97540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000789660.1|97550_97742_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	41.3	3.5e-05
WP_062876447.1|98044_101950_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	39.8	1.5e-235
WP_162860924.1|102120_103349_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.0	2.5e-168
WP_000255944.1|103858_104881_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|104880_105660_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
>prophage 3
NZ_CP053235	Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence	159399	137895	144428	159399	integrase,transposase	Enterobacteria_phage(33.33%)	7	129060:129075	140849:140864
129060:129075	attL	GGAATGCCGGTTCGCC	NA	NA	NA	NA
WP_062859186.1|137895_139065_-|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	43.7	3.2e-48
WP_000422722.1|139162_139588_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	96.9	9.8e-48
WP_000624684.1|139584_139935_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	67.2	2.8e-40
WP_170969401.1|139965_141579_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.0	1.8e-166
140849:140864	attR	GGAATGCCGGTTCGCC	NA	NA	NA	NA
WP_001168072.1|141931_143296_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	K7P7Q7	Enterobacteria_phage	39.6	1.1e-23
WP_113440977.1|143300_143936_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_000870986.1|143954_144428_-	lytic transglycosylase domain-containing protein	NA	A0A0A8J856	Ralstonia_phage	36.3	2.9e-08
>prophage 1
NZ_CP053236	Escherichia coli strain SCU-106 plasmid pSCU-106-2, complete sequence	111501	1262	60738	111501	tRNA,transposase,integrase	Salmonella_phage(41.18%)	46	NA	NA
WP_001066953.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_089563345.1|2123_2279_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_012904651.1|3109_4078_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	2.0e-176
WP_032186105.1|5063_5411_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	6.3e-61
WP_001171554.1|5407_5788_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000251882.1|6869_7031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387384.1|7048_7396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032331368.1|7697_8180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050439874.1|9146_9371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032331369.1|9622_9952_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	45.1	1.1e-17
WP_000780222.1|9932_10214_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_032331371.1|10228_10555_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_167851757.1|11331_12494_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.0	9.3e-165
WP_001105066.1|12705_12987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109538519.1|14743_15109_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_170969615.1|15408_15762_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_032331474.1|15841_18049_-	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_170969612.1|19020_19296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109538519.1|25145_25511_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001138082.1|26546_29432_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
WP_000904906.1|29557_30172_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_001323889.1|30452_32030_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_001323888.1|32183_32351_-	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_001161490.1|32339_32900_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|32903_35870_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_000844627.1|35927_36170_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_063091327.1|36201_36852_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_077519757.1|36957_38157_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_096954139.1|38188_39109_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001214976.1|39246_39654_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001082319.1|42641_43445_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|43444_44281_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_170969595.1|45159_48117_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	38.3	1.5e-182
WP_000904945.1|48097_48721_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.7	3.4e-41
WP_000774297.1|49065_49923_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001273588.1|49915_50398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442103.1|50390_50465_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083845.1|50696_50954_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001351576.1|51237_51444_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001299730.1|52067_52280_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025670714.1|52415_52976_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704513.1|53078_53939_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_000205749.1|53997_54744_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	8.7e-07
WP_025670715.1|54763_60031_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000450520.1|60112_60340_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000911333.1|60339_60738_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
