The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038443	Aeromonas media strain R1-18 chromosome, complete genome	4743402	713197	805633	4743402	lysis,transposase,integrase,tRNA,protease,terminase,tail,holin,capsid,head,portal,plate	Aeromonas_virus(21.28%)	102	755449:755503	788781:788835
WP_171272664.1|713197_714028_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_041206420.1|714105_714525_-	DUF4426 domain-containing protein	NA	NA	NA	NA	NA
WP_043128939.1|714529_714838_-	YggU family protein	NA	NA	NA	NA	NA
WP_025325667.1|714837_715389_-	YggT family protein	NA	NA	NA	NA	NA
WP_043128937.1|715412_716240_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_171272665.1|716398_717100_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_041206426.1|717139_718174_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_042649788.1|718200_719310_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_171272666.1|719342_720116_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005332263.1|720307_721531_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	4.5e-45
WP_171272667.1|721659_722370_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_041207086.1|722561_723869_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_005332255.1|724189_724651_-	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_041206428.1|724640_725099_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_171272668.1|725235_726222_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005332250.1|726224_726374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005332247.1|726449_726875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005305063.1|726988_727261_-	DNA-binding protein HU-alpha	NA	A0A249Y2G7	Serratia_phage	44.2	3.6e-11
WP_043128929.1|727599_728082_+	Rsd/AlgQ family anti-sigma factor	NA	NA	NA	NA	NA
WP_041207087.1|728184_728568_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_043128928.1|728625_729990_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_005332239.1|730090_732457_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_171272669.1|732516_733422_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_171272670.1|733450_734455_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_041207088.1|734581_735220_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171272671.1|735771_737406_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_081805783.1|737405_738347_+	DUF2950 domain-containing protein	NA	NA	NA	NA	NA
WP_005332225.1|738700_739414_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_005332223.1|739491_740700_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_171272672.1|740714_742046_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.5	1.2e-78
WP_171272673.1|742118_742892_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_005332215.1|743282_743453_-	DUF1427 family protein	NA	R4TMJ4	Halovirus	60.0	6.3e-06
WP_042649780.1|743576_744851_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_171272674.1|745060_745852_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_171272675.1|745892_746507_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_171274281.1|746731_747097_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_171272676.1|747215_748181_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_171272677.1|748422_749775_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	42.2	2.9e-93
WP_171272678.1|750008_751436_-	ammonium transporter	NA	NA	NA	NA	NA
WP_001310555.1|752917_753934_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_171272679.1|753943_754270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171272680.1|754326_755337_-|integrase	site-specific integrase	integrase	H2BDD9	Pseudomonas_virus	29.0	2.4e-20
755449:755503	attL	AATGGTGCCCGGGGTCGGACTCGAACCGACACGTCTTTCAACGGCGGATTTTGAA	NA	NA	NA	NA
WP_171272681.1|755572_756625_-|integrase	site-specific integrase	integrase	A5X9F3	Aeromonas_virus	80.0	4.8e-160
WP_171272682.1|756621_757293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171272683.1|757311_757929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171272684.1|758003_758693_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	41.8	9.7e-37
WP_171272685.1|758807_759104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171272686.1|759109_759397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171272687.1|759425_759941_+	phage regulatory CII family protein	NA	A5X9F7	Aeromonas_virus	39.5	1.7e-22
WP_171272688.1|759949_760297_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_171272689.1|760321_760780_+	hypothetical protein	NA	A5X9F8	Aeromonas_virus	84.2	5.4e-68
WP_171272690.1|760841_761018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171272691.1|761020_761194_+	hypothetical protein	NA	A5X9F9	Aeromonas_virus	87.7	3.2e-21
WP_171272692.1|761190_761388_+	hypothetical protein	NA	A5X9G0	Aeromonas_virus	55.4	4.1e-09
WP_163147954.1|761384_761594_+	hypothetical protein	NA	A5X9G1	Aeromonas_virus	94.2	3.6e-27
WP_171272693.1|761590_762007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171272694.1|762003_762432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171272695.1|762428_762743_+	hypothetical protein	NA	A5X9G2	Aeromonas_virus	92.3	2.0e-50
WP_171272696.1|762739_762997_+	hypothetical protein	NA	A5X9G3	Aeromonas_virus	85.9	2.4e-33
WP_171272697.1|762993_765336_+	replication endonuclease	NA	A5X9G4	Aeromonas_virus	87.3	0.0e+00
WP_171272698.1|765338_765830_+	hypothetical protein	NA	A5X9G5	Aeromonas_virus	87.8	9.8e-76
WP_171272699.1|765832_766435_+	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	47.6	4.6e-43
WP_171272700.1|766646_766979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171272701.1|767430_768492_-|portal	phage portal protein	portal	A0A077K9Q8	Ralstonia_phage	60.4	6.6e-117
WP_171272702.1|768488_770258_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	70.6	1.4e-241
WP_171272703.1|770407_771238_+|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	45.6	2.6e-52
WP_171272704.1|771250_772303_+|capsid	phage major capsid protein, P2 family	capsid	A4JWU7	Burkholderia_virus	57.6	2.7e-107
WP_171272705.1|772313_773099_+|terminase	terminase	terminase	A4PE31	Ralstonia_virus	47.2	3.5e-43
WP_171272706.1|773205_773676_+|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	48.1	1.7e-29
WP_048209105.1|773675_773879_+|tail	tail protein X	tail	A0A2H4J946	uncultured_Caudovirales_phage	57.6	5.2e-15
WP_171274282.1|773881_774112_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_171272707.1|774127_774517_+	hypothetical protein	NA	E5E3R9	Burkholderia_phage	43.1	2.1e-12
WP_171272708.1|774503_774827_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_171272709.1|774823_775645_+	DUF3380 domain-containing protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	51.1	5.7e-68
WP_171272710.1|775634_776108_+|lysis	phage lysis regulatory protein LysB	lysis	E5FFH9	Burkholderia_phage	36.4	3.2e-07
WP_048209095.1|776218_776695_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	45.3	9.0e-34
WP_171272711.1|776670_777309_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	34.7	2.3e-16
WP_171272712.1|777387_777939_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	40.6	1.7e-23
WP_171272713.1|777935_778307_+	GPW/gp25 family protein	NA	O80315	Escherichia_phage	51.5	1.8e-21
WP_171272714.1|778303_779203_+|plate	baseplate J/gp47 family protein	plate	Q9ZXK8	Pseudomonas_virus	59.3	7.6e-90
WP_171272715.1|779199_779832_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	59.5	7.7e-65
WP_171272716.1|779828_781244_+|tail	phage tail protein	tail	A4PE45	Ralstonia_virus	51.2	1.7e-80
WP_171272717.1|781243_781852_+|tail	tail fiber assembly protein	tail	H9C0Y3	Aeromonas_phage	46.3	4.8e-48
WP_171272718.1|782032_783211_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	61.8	3.8e-134
WP_171272719.1|783220_783739_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	59.3	1.0e-51
WP_025327469.1|783819_784104_+|tail	phage tail assembly protein	tail	E5FFG6	Burkholderia_phage	45.3	1.4e-10
WP_171272720.1|784112_784244_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_171272721.1|784240_786868_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	42.8	2.7e-156
WP_171272722.1|786880_787375_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	57.1	3.9e-32
WP_171272723.1|787410_788523_+	phage late control D family protein	NA	A0A1S5NV58	Burkholderia_phage	55.1	5.5e-98
WP_005332441.1|789009_789528_+	RDD family protein	NA	NA	NA	NA	NA
788781:788835	attR	AATGGTGCCCGGGGTCGGACTCGAACCGACACGTCTTTCAACGGCGGATTTTGAA	NA	NA	NA	NA
WP_041206454.1|789611_790682_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_005332438.1|790707_791820_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_041206455.1|791992_793504_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.6	1.4e-48
WP_041206456.1|793660_794116_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_171272724.1|794181_797034_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.4	8.1e-138
WP_043128915.1|797276_798569_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_005332433.1|798587_799253_+	DedA family protein	NA	NA	NA	NA	NA
WP_171272725.1|799389_800217_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_005315760.1|801462_801651_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	5.0e-12
WP_005332431.1|801744_802992_-	aspartate kinase	NA	NA	NA	NA	NA
WP_171272726.1|803008_805633_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.7	5.3e-75
>prophage 2
NZ_CP038443	Aeromonas media strain R1-18 chromosome, complete genome	4743402	2032148	2041358	4743402	tRNA	uncultured_Mediterranean_phage(14.29%)	9	NA	NA
WP_005332743.1|2032148_2032766_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	2.4e-34
WP_041205044.1|2032762_2033344_+	DedA family protein	NA	NA	NA	NA	NA
WP_041205045.1|2033353_2034418_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	36.2	4.9e-11
WP_005331913.1|2034464_2035448_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.7	4.9e-34
WP_005331910.1|2035535_2036549_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	3.1e-108
WP_005309452.1|2036728_2036944_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005331908.1|2036959_2037403_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	2.0e-27
WP_005331907.1|2037491_2039279_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.4	4.0e-74
WP_081805626.1|2039492_2041358_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
>prophage 3
NZ_CP038443	Aeromonas media strain R1-18 chromosome, complete genome	4743402	2064000	2119623	4743402	transposase,integrase,tRNA	uncultured_Caudovirales_phage(23.08%)	48	2080384:2080401	2117032:2117049
WP_099992639.1|2064000_2065017_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_019706001.1|2065269_2066217_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_005329005.1|2069036_2069885_-	TIGR03899 family protein	NA	NA	NA	NA	NA
WP_041205057.1|2070031_2070508_-	DUF3299 domain-containing protein	NA	NA	NA	NA	NA
WP_171273246.1|2070543_2071791_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_171273247.1|2071870_2072557_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.8	4.6e-23
WP_171273248.1|2072561_2073137_-	DUF2796 domain-containing protein	NA	NA	NA	NA	NA
WP_171273249.1|2073172_2073463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005329017.1|2073506_2074049_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_041205060.1|2074268_2075147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171268588.1|2075270_2075621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005329022.1|2075647_2076178_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	60.2	4.6e-55
WP_171273250.1|2076413_2077778_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_171273251.1|2077774_2078386_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_042648901.1|2078460_2079075_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041205063.1|2079276_2079807_+	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_005329031.1|2079919_2080837_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.8	1.1e-22
2080384:2080401	attL	GCTGCTGATCCTGGATGA	NA	NA	NA	NA
WP_041205064.1|2080833_2081607_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_171273252.1|2081662_2082010_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_171273253.1|2082030_2082885_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_171273254.1|2082988_2083783_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_171273255.1|2083801_2084299_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	38.2	2.9e-14
WP_042648906.1|2084309_2085782_-	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	36.7	2.2e-25
WP_041206812.1|2085925_2086828_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_005329052.1|2086940_2087390_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_005327571.1|2087515_2088253_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_005327573.1|2088249_2088795_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_171273256.1|2089031_2091479_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	27.8	2.9e-27
WP_005327576.1|2091743_2094065_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_042650422.1|2094107_2094518_+	VOC family protein	NA	NA	NA	NA	NA
WP_042649474.1|2094600_2094921_-	ligand-binding protein SH3	NA	NA	NA	NA	NA
WP_042649475.1|2094908_2095301_-	multidrug transporter	NA	NA	NA	NA	NA
WP_042649476.1|2095459_2096341_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042649477.1|2096404_2096920_-	DUF2937 family protein	NA	NA	NA	NA	NA
WP_042649479.1|2098091_2099012_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_042649483.1|2099050_2099875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042649480.1|2100085_2101372_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_042649481.1|2101594_2102989_+	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_041205072.1|2103076_2103769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025328177.1|2103858_2104209_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	49.5	6.7e-26
WP_171273257.1|2110288_2110921_+	LysE family translocator	NA	NA	NA	NA	NA
WP_171273258.1|2111158_2112376_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	50.1	4.3e-104
WP_041205253.1|2113187_2114525_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_171273259.1|2114990_2116532_+|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.4	9.8e-130
WP_039272515.1|2116546_2117302_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	50.6	1.3e-58
2117032:2117049	attR	GCTGCTGATCCTGGATGA	NA	NA	NA	NA
WP_171273260.1|2117403_2117838_+	lecithin retinol acyltransferase family protein	NA	NA	NA	NA	NA
WP_167562305.1|2117826_2118171_-	helix-turn-helix domain-containing protein	NA	A0A2H4J5G9	uncultured_Caudovirales_phage	35.2	9.8e-06
WP_171273010.1|2118354_2119623_-|transposase	IS4-like element ISAeme3 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP038443	Aeromonas media strain R1-18 chromosome, complete genome	4743402	2665177	2690049	4743402	transposase,tRNA	Bacillus_thuringiensis_phage(100.0%)	23	NA	NA
WP_041205253.1|2665177_2666515_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_005331469.1|2666558_2667143_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	43.6	2.5e-41
WP_005331467.1|2667431_2667776_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_171273444.1|2667853_2669065_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_171273445.1|2669275_2671261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205334.1|2671257_2671581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171273446.1|2671744_2672383_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_171273447.1|2672382_2673342_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171273448.1|2673655_2675383_-	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_171273449.1|2675577_2676270_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_171274337.1|2679019_2679988_+	homoserine kinase	NA	NA	NA	NA	NA
WP_171273450.1|2679984_2681259_+	threonine synthase	NA	NA	NA	NA	NA
WP_139751429.1|2681364_2681790_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_171273451.1|2681958_2682909_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041204923.1|2682958_2684101_-|transposase	IS4-like element ISAs18 family transposase	transposase	NA	NA	NA	NA
WP_171273452.1|2684687_2685014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010676219.1|2685110_2686208_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_171273453.1|2686260_2686557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273454.1|2686543_2686990_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_171273455.1|2687003_2687609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005342491.1|2687705_2688656_-|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
WP_171273456.1|2688726_2689245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273457.1|2689533_2690049_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038443	Aeromonas media strain R1-18 chromosome, complete genome	4743402	2934845	3008811	4743402	transposase,integrase,tRNA	Bacillus_phage(20.0%)	57	2984492:2984548	3018877:3018933
WP_171273566.1|2934845_2935370_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_163149793.1|2935575_2937813_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_106886380.1|2937864_2939514_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005328825.1|2939621_2940440_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	27.8	3.6e-14
WP_025327511.1|2940530_2941241_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_041206040.1|2941433_2942753_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_171273567.1|2942773_2943316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171273568.1|2943600_2944503_+	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_171273569.1|2944512_2945913_+	amino acid permease	NA	NA	NA	NA	NA
WP_171273570.1|2945984_2946824_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_171273571.1|2947080_2947443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171273572.1|2947562_2948306_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	1.2e-35
WP_163135109.1|2949344_2950145_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_171273573.1|2950625_2951753_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_171273574.1|2951763_2953098_-	MFS transporter	NA	NA	NA	NA	NA
WP_171273575.1|2953119_2954640_-	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_171273576.1|2954636_2955227_-	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_041206035.1|2955429_2955825_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_171273577.1|2956050_2956824_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_171273578.1|2956868_2957552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273579.1|2957602_2958970_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_041206032.1|2958993_2960385_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_171273580.1|2960711_2961662_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_171273581.1|2961902_2963051_+	MFS transporter	NA	NA	NA	NA	NA
WP_171273582.1|2963211_2964108_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	26.1	8.2e-12
WP_171273583.1|2964180_2964840_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
WP_171273584.1|2964984_2967072_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.3	2.1e-42
WP_163153748.1|2967457_2968519_+	porin	NA	NA	NA	NA	NA
WP_171273585.1|2968721_2969663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005329100.1|2969808_2970999_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_171273586.1|2971159_2972665_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	46.4	1.1e-85
WP_171273587.1|2972791_2973286_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_106886404.1|2973279_2973798_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_171274352.1|2973826_2976082_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_163150103.1|2976463_2978233_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.4	5.5e-60
WP_171273588.1|2978232_2979228_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005331987.1|2979381_2979582_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_171273589.1|2979578_2980328_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_025327477.1|2980538_2981183_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_025327475.1|2983499_2984054_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
2984492:2984548	attL	GATTTAAAATCCCTCGACGTTCGCGTCGTGCCGGTTCGATTCCGGCCTCGGGCACCA	NA	NA	NA	NA
WP_043128800.1|2984912_2986118_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	35.3	1.7e-12
WP_042058838.1|2986265_2986622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025201450.1|2986614_2986917_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_050504253.1|2987039_2987645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043128796.1|2987707_2988127_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_171273590.1|2988904_2990830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171274353.1|2990912_2993651_+	DEAD/DEAH box helicase family protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	24.4	5.8e-40
WP_171273591.1|2993758_2996632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273592.1|2996700_2997153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125729348.1|2997169_2997364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273593.1|2997431_2998574_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_171273594.1|2998666_2999686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001809438.1|2999854_3000886_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_001809438.1|3002190_3003222_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_001809438.1|3004526_3005558_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_171273595.1|3005569_3007777_-	DEAD/DEAH box helicase family protein	NA	A7WKH8	Acidianus_filamentous_virus	24.9	3.2e-09
WP_099368881.1|3007794_3008811_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
3018877:3018933	attR	GATTTAAAATCCCTCGACGTTCGCGTCGTGCCGGTTCGATTCCGGCCTCGGGCACCA	NA	NA	NA	NA
>prophage 6
NZ_CP038443	Aeromonas media strain R1-18 chromosome, complete genome	4743402	3315510	3368788	4743402	transposase,integrase	Pseudomonas_phage(20.0%)	42	3309055:3309114	3391439:3391529
3309055:3309114	attL	AATAATGGGGTGGCTGATGGGGCTCGAACCCACGACAACCGGAATCACAATCCGGGACTC	NA	NA	NA	NA
WP_099369130.1|3315510_3317859_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_171273732.1|3317843_3321152_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010674971.1|3321642_3321843_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	36.9	1.5e-06
WP_021140683.1|3321974_3322184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010674969.1|3322199_3323444_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	29.1	4.9e-39
WP_104453295.1|3323565_3324318_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_158512853.1|3324373_3324541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102948393.1|3325332_3326536_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.1	4.5e-114
WP_024941327.1|3330054_3330699_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024941328.1|3330698_3331136_+	CsgE	NA	NA	NA	NA	NA
WP_024941329.1|3331147_3331546_+	curli production assembly protein CsgF	NA	NA	NA	NA	NA
WP_171273733.1|3331553_3332408_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.6	8.6e-43
WP_005895593.1|3332673_3333195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024941331.1|3333229_3334804_+	curlin	NA	NA	NA	NA	NA
WP_171273734.1|3334983_3335181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064338153.1|3338969_3339467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171273735.1|3339466_3340255_+	OmpA family protein	NA	NA	NA	NA	NA
WP_005327394.1|3341112_3342036_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_041205619.1|3342136_3342427_+	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_001274811.1|3342896_3344438_+|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	4.4e-130
WP_000194037.1|3344452_3345208_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.5	3.4e-59
WP_041206914.1|3345428_3345689_+	ADP-ribosylglycohydrolase	NA	NA	NA	NA	NA
WP_059169687.1|3345805_3346018_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042011229.1|3346141_3346351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171273736.1|3346362_3347601_+	DUF3596 domain-containing protein	NA	A0A1W6JTA0	Pseudomonas_phage	29.5	3.9e-36
WP_069785115.1|3347584_3348475_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_081100795.1|3348409_3348748_-	single-stranded DNA-binding protein	NA	A0A067ZIP0	Vibrio_phage	50.9	4.9e-26
WP_103859356.1|3348999_3350259_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	53.7	2.3e-121
WP_171274362.1|3350289_3350682_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	48.7	3.1e-24
WP_139127925.1|3351218_3351443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171274363.1|3353301_3353688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042011562.1|3353841_3354441_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_171273737.1|3355158_3358854_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_160837715.1|3358928_3360173_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_160837713.1|3360175_3360937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160837711.1|3360987_3362958_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_160837709.1|3362997_3363474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160837707.1|3363544_3364033_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_171273738.1|3364067_3365855_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_171273739.1|3366010_3366721_+	DUF3944 domain-containing protein	NA	NA	NA	NA	NA
WP_171273740.1|3366745_3367726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171274364.1|3368266_3368788_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
3391439:3391529	attR	AATAATGGGGTGGCTGATGGGGCTCGAACCCACGACAACCGGAATCACAATCCGGGACTCTACCAACTGAGCTACAGCCACCACTGAAATC	NA	NA	NA	NA
>prophage 7
NZ_CP038443	Aeromonas media strain R1-18 chromosome, complete genome	4743402	3530450	3559261	4743402	transposase,protease,tail,terminase,capsid,head,portal	Vibrio_phage(30.0%)	29	NA	NA
WP_012564931.1|3530450_3531398_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_005342491.1|3531570_3532521_-|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
WP_171273776.1|3532577_3536030_-	DUF1983 domain-containing protein	NA	A0A2I7RWK4	Vibrio_phage	38.2	1.6e-07
WP_171273777.1|3536100_3536490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273778.1|3536474_3537008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273779.1|3537004_3537553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010676219.1|3537518_3538616_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_171273780.1|3539107_3540001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273781.1|3540271_3540742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273782.1|3540922_3541672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273783.1|3542304_3542871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273784.1|3543868_3544675_+	phage antirepressor KilAC domain-containing protein	NA	X2KQ88	Campylobacter_phage	30.5	6.3e-19
WP_171269473.1|3544787_3546002_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.5	8.7e-49
WP_005325174.1|3546311_3546614_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_041205730.1|3546613_3546979_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005325170.1|3547027_3548644_+|transposase	IS66-like element ISAeme5 family transposase	transposase	A0A218MNE7	uncultured_virus	32.8	4.7e-42
WP_171273785.1|3548660_3548810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273786.1|3548898_3549507_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7S7P2	Vibrio_phage	47.2	4.7e-27
WP_171273787.1|3549499_3550702_-|portal	phage portal protein	portal	Q7Y5L0	Xanthomonas_virus	23.4	8.2e-15
WP_171273788.1|3550757_3551504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005342491.1|3551633_3552584_+|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
WP_171273789.1|3552492_3553578_-	hypothetical protein	NA	M4MBI0	Vibrio_phage	32.1	3.6e-46
WP_171273790.1|3553577_3553988_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_171273791.1|3553965_3554265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273792.1|3555398_3555887_-	glycoside hydrolase family protein	NA	A0A219YC19	Aeromonas_phage	55.8	1.5e-39
WP_171273793.1|3555946_3556342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171273794.1|3556381_3557302_+|capsid	phage major capsid protein	capsid	A0A141GEW2	Brucella_phage	25.6	6.1e-10
WP_171273795.1|3557489_3558032_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_021141311.1|3558124_3559261_-|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP038443	Aeromonas media strain R1-18 chromosome, complete genome	4743402	3627814	3699814	4743402	transposase,integrase,tRNA	Salmonella_phage(21.05%)	53	3674882:3674912	3700010:3700040
WP_171273010.1|3627814_3629083_+|transposase	IS4-like element ISAeme3 family transposase	transposase	NA	NA	NA	NA
WP_081805875.1|3630145_3631822_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.1	9.6e-38
WP_041205740.1|3631922_3633035_+	ribonuclease D	NA	NA	NA	NA	NA
WP_042650173.1|3633253_3633622_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_042650172.1|3633703_3634669_-	DMT family transporter	NA	NA	NA	NA	NA
WP_171268965.1|3634744_3635572_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_042650170.1|3635628_3636573_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_042650169.1|3636750_3637128_+	YbaN family protein	NA	NA	NA	NA	NA
WP_042650168.1|3637260_3637806_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	40.9	3.4e-29
WP_011706069.1|3640628_3640958_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_043131365.1|3641484_3642111_-	hydrolase	NA	NA	NA	NA	NA
WP_042648682.1|3642274_3643141_-	pirin family protein	NA	NA	NA	NA	NA
WP_005330645.1|3644211_3645534_-	YjiH family protein	NA	NA	NA	NA	NA
WP_171268967.1|3645981_3647052_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005325086.1|3647134_3647557_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_042650065.1|3647733_3651660_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	27.6	1.8e-55
WP_041205747.1|3651758_3652601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205748.1|3652764_3653052_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_042650066.1|3654906_3655923_+	response regulator	NA	W8CYM9	Bacillus_phage	33.9	3.2e-12
WP_042650067.1|3655898_3656543_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005328332.1|3656536_3657667_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_041205752.1|3657719_3658757_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_005328336.1|3659085_3659730_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_005328337.1|3660143_3661337_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_041205051.1|3661607_3662945_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_042650068.1|3662992_3664423_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.3	8.5e-19
WP_005328342.1|3664506_3664779_+	acylphosphatase	NA	NA	NA	NA	NA
WP_139751574.1|3664798_3665542_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_042650070.1|3665609_3667643_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	26.5	2.9e-44
WP_005328348.1|3667828_3668911_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_041205758.1|3669019_3669664_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.0	3.0e-32
WP_005328350.1|3669727_3670309_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	39.5	9.1e-28
WP_041205760.1|3670657_3672130_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_041206683.1|3672437_3673979_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	3.2e-128
3674882:3674912	attL	CCGCAGAATTCGGAAAAAATCGTACGCTAAG	NA	NA	NA	NA
WP_001138014.1|3674907_3677874_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|3677877_3678438_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_000845048.1|3678774_3679788_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_024167031.1|3679991_3680228_+	trimethoprim-resistant dihydrofolate reductase DfrB4	NA	A0A0H5ARK7	Pseudomonas_phage	66.0	2.8e-12
WP_000186237.1|3680366_3680999_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_045898630.1|3681157_3682003_+	AadA family aminoglycoside 3''-O-nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000679427.1|3682018_3682366_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|3682359_3683199_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|3683326_3683827_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|3684333_3685098_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_011191339.1|3685389_3685959_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	51.6	1.4e-41
WP_171273815.1|3686154_3687678_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_171273816.1|3687754_3688111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273817.1|3688167_3688359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017411290.1|3688758_3689976_-	tetracycline efflux MFS transporter Tet(E)	NA	NA	NA	NA	NA
WP_088813956.1|3691319_3693131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033991895.1|3693107_3696074_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	98.8	0.0e+00
WP_033943780.1|3696077_3696638_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	99.2	1.9e-59
WP_171269473.1|3698599_3699814_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.5	8.7e-49
3700010:3700040	attR	CTTAGCGTACGATTTTTTCCGAATTCTGCGG	NA	NA	NA	NA
>prophage 9
NZ_CP038443	Aeromonas media strain R1-18 chromosome, complete genome	4743402	3872676	3932438	4743402	transposase,integrase	Bacillus_phage(18.18%)	53	3899762:3899821	3932493:3932610
WP_019706001.1|3872676_3873624_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_171273876.1|3873589_3874102_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	41.2	3.6e-12
WP_010676219.1|3874150_3875248_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_171273877.1|3875300_3875702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273878.1|3876209_3878246_-	glycoside hydrolase family 3 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_171273879.1|3878477_3879488_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171273880.1|3879467_3880391_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171273881.1|3880515_3881274_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_171273882.1|3882958_3883861_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171273883.1|3883995_3885570_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.5	3.9e-17
WP_171274374.1|3885582_3886686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273884.1|3886973_3889271_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_171273885.1|3889254_3890040_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_171274375.1|3890200_3891079_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171273886.1|3891142_3891994_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_171273887.1|3892125_3893040_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021141311.1|3893361_3894498_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_171273888.1|3894855_3895815_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_171273889.1|3895904_3897413_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	21.7	7.6e-10
WP_171273890.1|3897414_3898437_+	ABC transporter permease	NA	NA	NA	NA	NA
3899762:3899821	attL	TAACTTATTGAATTGCATAAACAGGTGGTGGCCCCACCAGCCACATCCCGGCACTCGAGT	NA	NA	NA	NA
WP_171273891.1|3900146_3900383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273892.1|3900366_3900708_-	DUF1232 domain-containing protein	NA	A0A2I7S9Z5	Vibrio_phage	31.3	1.1e-06
WP_171273893.1|3902414_3902960_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	47.5	2.2e-31
WP_010791757.1|3903153_3904836_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000393453.1|3904838_3905747_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000801210.1|3905743_3906961_+	TniQ family protein	NA	NA	NA	NA	NA
WP_000904941.1|3907021_3907636_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	51.9	1.3e-37
WP_001087809.1|3907688_3907925_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_003465059.1|3907921_3908287_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000136268.1|3908303_3909950_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
WP_000654684.1|3909946_3910192_-	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
WP_000735441.1|3910194_3910470_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_032454987.1|3910485_3910836_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000429838.1|3910907_3911342_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000259031.1|3911823_3912663_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3912656_3913004_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|3913167_3913959_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000845048.1|3914104_3915118_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_171273894.1|3915515_3915659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163148202.1|3915655_3915796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273895.1|3915801_3916170_-	DUF2787 family protein	NA	NA	NA	NA	NA
WP_171273896.1|3916166_3916616_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_171273897.1|3917001_3917379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171273898.1|3917544_3917721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273899.1|3917787_3920964_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_171273900.1|3920960_3921410_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_171273901.1|3921418_3921826_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_171273902.1|3921908_3922373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171273903.1|3922372_3923329_-	DUF91 domain-containing protein	NA	NA	NA	NA	NA
WP_171273904.1|3923325_3924657_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_171273905.1|3925909_3927868_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.2	1.2e-31
WP_171273906.1|3928457_3931097_+	toprim domain-containing protein	NA	A0A1B2AQ05	Phage_Wrath	32.4	5.3e-67
WP_171273907.1|3931319_3932438_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3932493:3932610	attR	TAACTTATTGAATTGCATAAACAGGTGGTGGCCCCACCAGCCACATCCCGGCACTCGAGTCCCCCGCCTTGGCTGCTACCTTCCGGTCCTGACCAGGTTGACGAGTTATCAATGCGAG	NA	NA	NA	NA
>prophage 10
NZ_CP038443	Aeromonas media strain R1-18 chromosome, complete genome	4743402	4177713	4254540	4743402	transposase,integrase	Escherichia_phage(25.0%)	58	4164386:4164405	4201450:4201469
4164386:4164405	attL	CCATGCTGAACCTGCGCAAC	NA	NA	NA	NA
WP_171274013.1|4177713_4178730_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.8	2.4e-185
WP_148304730.1|4178790_4179732_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005327430.1|4183155_4184592_+	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_005327429.1|4184585_4185512_+	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_005327427.1|4185508_4186309_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_005327426.1|4186325_4187027_+	peptidase	NA	NA	NA	NA	NA
WP_041205479.1|4187109_4187595_+	YqhA family protein	NA	NA	NA	NA	NA
WP_171274014.1|4187718_4188168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205476.1|4188172_4191142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005327419.1|4191141_4191966_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_005327418.1|4192051_4193476_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005327416.1|4194282_4195542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005327415.1|4195629_4197276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005327414.1|4197392_4198595_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.4	1.2e-21
WP_041205474.1|4198675_4199242_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_171274015.1|4199271_4200699_-	sodium:proton antiporter NhaD	NA	NA	NA	NA	NA
WP_005327410.1|4200825_4201299_-	DUF4357 domain-containing protein	NA	NA	NA	NA	NA
WP_005327408.1|4201451_4202132_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.5e-29
4201450:4201469	attR	CCATGCTGAACCTGCGCAAC	NA	NA	NA	NA
WP_005327404.1|4204569_4205643_+	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_171274016.1|4205817_4206834_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.8	1.1e-185
WP_171274017.1|4207041_4209834_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_041205467.1|4209833_4210478_-	LUD domain-containing protein	NA	NA	NA	NA	NA
WP_005327547.1|4210479_4211916_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_081805666.1|4211908_4212685_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_005327551.1|4214529_4215435_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041205463.1|4215473_4216283_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005327555.1|4216391_4216763_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_005327557.1|4216768_4217305_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041206878.1|4217316_4217652_+	DUF3802 family protein	NA	NA	NA	NA	NA
WP_005327561.1|4217918_4218551_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_041206877.1|4218803_4220132_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_148304685.1|4220305_4220485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005327565.1|4220549_4221902_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_041205459.1|4222038_4223133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161507314.1|4223383_4225645_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_171274018.1|4225844_4226855_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_005331601.1|4227015_4227333_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005331597.1|4228589_4229882_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005331594.1|4229956_4230496_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005331593.1|4230705_4232514_-	M3 family oligoendopeptidase	NA	A0A1X9I5X5	Streptococcus_phage	22.9	1.6e-09
WP_171274019.1|4234815_4235733_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_005331588.1|4235943_4236546_+	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	35.3	7.2e-20
WP_171269622.1|4236625_4237540_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.7	1.3e-33
WP_171274020.1|4237640_4239443_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_171274021.1|4239568_4240735_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	68.1	6.7e-147
WP_041205445.1|4240922_4241420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205443.1|4241488_4242349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205440.1|4242402_4243266_-	phosphotransferase	NA	NA	NA	NA	NA
WP_041205438.1|4243255_4243852_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_041205436.1|4243851_4244250_-	YcfL family protein	NA	NA	NA	NA	NA
WP_005330108.1|4244316_4245738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005330109.1|4245737_4246088_-	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
WP_171269615.1|4246345_4248358_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.7	2.2e-20
WP_171274022.1|4248433_4249309_-	6-carboxytetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.1	8.0e-12
WP_005330115.1|4249388_4250732_+	dihydroorotase	NA	NA	NA	NA	NA
WP_171274023.1|4251166_4251637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021141234.1|4252851_4254078_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
WP_041205449.1|4254135_4254540_+|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	1.1e-29
>prophage 11
NZ_CP038443	Aeromonas media strain R1-18 chromosome, complete genome	4743402	4627101	4652302	4743402		Aeromonas_phage(64.52%)	39	NA	NA
WP_171274194.1|4627101_4627503_-	hypothetical protein	NA	A0A1I9KG26	Aeromonas_phage	83.8	3.1e-43
WP_171274390.1|4627648_4629826_-	hypothetical protein	NA	W8FP98	Vibrio_phage	28.9	1.9e-38
WP_171274195.1|4629854_4631423_-	TerL	NA	A0A096XUU0	Cronobacter_phage	35.7	1.8e-75
WP_171274196.1|4631412_4632000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043144157.1|4632126_4632309_-	hypothetical protein	NA	A0A1I9KFC5	Aeromonas_phage	58.2	3.8e-09
WP_044303401.1|4632305_4632530_-	hypothetical protein	NA	A0A1I9KFG6	Aeromonas_phage	73.0	5.2e-24
WP_171274197.1|4632537_4633086_-	hypothetical protein	NA	A2I317	Vibrio_virus	55.1	1.5e-48
WP_158656263.1|4633082_4633325_-	hypothetical protein	NA	I3PUY0	Vibrio_phage	48.6	3.2e-11
WP_171274198.1|4633794_4633989_-	DUF3283 family protein	NA	NA	NA	NA	NA
WP_171274199.1|4634083_4634695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171274200.1|4634691_4635114_-	hypothetical protein	NA	A0A1I9KG18	Aeromonas_phage	82.9	1.3e-63
WP_171274201.1|4635110_4635428_-	hypothetical protein	NA	A0A1I9KFA7	Aeromonas_phage	91.4	4.6e-50
WP_171274202.1|4635424_4635865_-	recombination protein NinB	NA	A0A1I9KFA6	Aeromonas_phage	90.3	8.5e-71
WP_171274203.1|4635861_4636470_-	Rha family transcriptional regulator	NA	A0A2I6PG18	Plesiomonas_phage	53.0	3.1e-39
WP_171274204.1|4636545_4636848_-	hypothetical protein	NA	A0A1I9KFB1	Aeromonas_phage	90.9	1.2e-44
WP_111873656.1|4636850_4637279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005310225.1|4637316_4638351_-	conserved phage C-terminal domain-containing protein	NA	K7PLZ7	Enterobacterial_phage	42.9	4.1e-23
WP_171274205.1|4638347_4639814_-	DNA cytosine methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	48.4	3.8e-123
WP_171274206.1|4639810_4639975_-	hypothetical protein	NA	A0A1I9KFA1	Aeromonas_phage	77.4	3.4e-17
WP_005310218.1|4640028_4640247_-	hypothetical protein	NA	A0A1I9KFG0	Aeromonas_phage	97.2	2.1e-30
WP_171274207.1|4640251_4640641_-	hypothetical protein	NA	A0A1I9KF96	Aeromonas_phage	96.6	2.8e-57
WP_171274208.1|4640682_4641411_-	phage antirepressor KilAC domain-containing protein	NA	A0A1I9KFA9	Aeromonas_phage	84.3	2.7e-106
WP_111873660.1|4641444_4641660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162625767.1|4641754_4642393_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171274209.1|4643058_4643304_+	hypothetical protein	NA	A0A1I9KF98	Aeromonas_phage	88.9	3.1e-30
WP_171274210.1|4643613_4643805_+	hypothetical protein	NA	A0A1I9KG01	Aeromonas_phage	82.3	1.4e-17
WP_171274211.1|4643807_4644173_+	hypothetical protein	NA	A0A1I9KFC9	Aeromonas_phage	83.5	1.4e-50
WP_171274212.1|4644169_4645069_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1I9KFF5	Aeromonas_phage	72.0	1.4e-120
WP_171274213.1|4645065_4646172_+	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	63.3	1.3e-86
WP_171274214.1|4646220_4647261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171274215.1|4647257_4647842_+	adenine methylase	NA	A0A2I7QNI8	Vibrio_phage	58.5	6.9e-60
WP_171274216.1|4647900_4648080_+	hypothetical protein	NA	A0A1I9KFZ1	Aeromonas_phage	91.5	3.2e-24
WP_171274217.1|4648100_4649039_+	recombination-associated protein RdgC	NA	A0A1I9KFB4	Aeromonas_phage	97.8	6.5e-169
WP_171274218.1|4649035_4649380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171274219.1|4649376_4650138_+	hypothetical protein	NA	A0A1I9KFE6	Aeromonas_phage	73.2	1.4e-33
WP_171274220.1|4650101_4650320_+	hypothetical protein	NA	A0A1I9KF77	Aeromonas_phage	95.8	2.7e-33
WP_171274221.1|4650604_4651408_+	phage antirepressor N-terminal domain-containing protein	NA	A0A0H4IQ87	Shigella_phage	62.3	2.4e-39
WP_171274222.1|4651674_4652112_+	hypothetical protein	NA	A0A1I9KG69	Aeromonas_phage	74.8	2.7e-45
WP_042642185.1|4652104_4652302_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	57.4	3.3e-14
